ID: 1195738004

View in Genome Browser
Species Human (GRCh38)
Location X:108033386-108033408
Sequence TGCCAGGAATAGAACTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195738004_1195738011 17 Left 1195738004 X:108033386-108033408 CCACCTGAGTTCTATTCCTGGCA No data
Right 1195738011 X:108033426-108033448 CTCCTCATGCTGCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195738004 Original CRISPR TGCCAGGAATAGAACTCAGG TGG (reversed) Intergenic
No off target data available for this crispr