ID: 1195740545

View in Genome Browser
Species Human (GRCh38)
Location X:108060888-108060910
Sequence CCAGGGGTATGGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195740545_1195740557 2 Left 1195740545 X:108060888-108060910 CCCTGTTCCCTCCATACCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 364
Right 1195740557 X:108060913-108060935 ATCTAGAGGGACTGACTCATGGG 0: 1
1: 0
2: 1
3: 14
4: 113
1195740545_1195740556 1 Left 1195740545 X:108060888-108060910 CCCTGTTCCCTCCATACCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 364
Right 1195740556 X:108060912-108060934 GATCTAGAGGGACTGACTCATGG 0: 1
1: 0
2: 0
3: 2
4: 97
1195740545_1195740559 10 Left 1195740545 X:108060888-108060910 CCCTGTTCCCTCCATACCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 364
Right 1195740559 X:108060921-108060943 GGACTGACTCATGGGCACTAGGG 0: 1
1: 0
2: 0
3: 3
4: 113
1195740545_1195740558 9 Left 1195740545 X:108060888-108060910 CCCTGTTCCCTCCATACCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 364
Right 1195740558 X:108060920-108060942 GGGACTGACTCATGGGCACTAGG 0: 1
1: 0
2: 1
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195740545 Original CRISPR CCAGGGGTATGGAGGGAACA GGG (reversed) Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900366378 1:2313520-2313542 CCAGGGGTGTGGAGGGTCGAGGG + Intergenic
901041862 1:6368776-6368798 CCCGGGGAATGCAGGGCACAGGG + Intronic
901079474 1:6575784-6575806 GCAGGGGAATGGAGTGAACCTGG - Intronic
901303368 1:8215579-8215601 CCAGGGGTGTTGGGGGTACAGGG + Intergenic
901517125 1:9755422-9755444 CCAGGGGTTTGGAGGGTCCGTGG + Intronic
902087235 1:13873010-13873032 CTAGGGGGATGGAGAGAGCATGG - Intergenic
903632452 1:24786430-24786452 ACAGGGGTGTGAAGGGAAGAGGG + Intronic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
905729925 1:40290289-40290311 GCAGGGGAATGGCGTGAACATGG + Intronic
905893318 1:41530431-41530453 CCAGGGGCATGGAGGGACATGGG - Intronic
906662265 1:47591099-47591121 CCAGGGGCACTGAGGGAACTTGG + Intergenic
906771066 1:48484675-48484697 CCAGGGGTTTGGACTGAACTGGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910136143 1:83972267-83972289 CCAGGGGTTGGGAGGGAATGGGG - Intronic
910169127 1:84359015-84359037 CCTGGGGGTTGGAGGGAGCATGG + Intronic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
913958592 1:143323082-143323104 CCAGGGATATGGCAGGACCAGGG + Intergenic
914052909 1:144148462-144148484 CCAGGGATATGGCAGGACCAGGG + Intergenic
914126288 1:144818079-144818101 CCAGGGATATGGCAGGACCAGGG - Intergenic
914731126 1:150371455-150371477 GCAGGAGAATGGAGTGAACACGG - Intronic
915608795 1:156973564-156973586 CCAGGCATATGGAGATAACAGGG - Intronic
915738967 1:158103567-158103589 CAAGGGGTATGGAAAGAACAAGG + Intergenic
916511274 1:165474168-165474190 CCAGCAGTATGGAGGGGCCAAGG + Intergenic
916545160 1:165797128-165797150 TGAGGGGGATGGGGGGAACAGGG - Intronic
917404134 1:174685344-174685366 GCAGGAGAATGGAGTGAACAGGG - Intronic
917513334 1:175686631-175686653 AGAGGGGGATGGAGGGGACAAGG - Intronic
917645963 1:177029095-177029117 CCAGGGGAAAGGAAGGAACTGGG + Intronic
918160740 1:181896788-181896810 CCAGGGGTAGGAAGAGAAAAGGG - Intergenic
918160896 1:181898556-181898578 CCAGGGGTAAGAAGAGAAAAGGG - Intergenic
918162580 1:181915089-181915111 CCTGGGGGATGGAGGTAACCAGG + Intergenic
920341317 1:205276725-205276747 CTTGGGGTATGGGGGGACCAAGG - Intergenic
922709729 1:227817278-227817300 CCAGTGGTATGAGGTGAACAGGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1066759071 10:38737494-38737516 CCAGGGATATGGCAGGACCAGGG - Intergenic
1066962556 10:42235276-42235298 CCAGGGATATGGCAGGACCAGGG + Intergenic
1067793595 10:49305194-49305216 CCAGGAGTATGGAGGCTGCAAGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069592748 10:69652208-69652230 CCTCGGGTATGGGGGGCACAGGG - Intergenic
1071815568 10:89229314-89229336 CCAGGGGTTAGGAGGGAGGAAGG + Intronic
1072539893 10:96390331-96390353 ATAGGGGGATGGAGGGATCAAGG + Intronic
1073995256 10:109308352-109308374 CCAGGAGAAAGGATGGAACAGGG - Intergenic
1074101887 10:110360154-110360176 GCAGGAGAATGGAGGGAACACGG + Intergenic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1075922748 10:126226420-126226442 CAAGGGGTGTGAAGGCAACATGG + Intronic
1075934164 10:126325327-126325349 CCAAGGGTTGGGAGGGAACTGGG + Intronic
1078949440 11:16113125-16113147 CCCTGGCTATGAAGGGAACAGGG - Intronic
1079588310 11:22152436-22152458 GCAGGGGAATGGCGGGAACCCGG - Intergenic
1080441829 11:32301624-32301646 CCAGGGGAATGGAGGGGCAAGGG + Intergenic
1081063185 11:38505163-38505185 GCAGGAGAATGGAGGGAACCCGG - Intergenic
1081338040 11:41891858-41891880 CCAGGGGTAGGGGTGTAACAGGG - Intergenic
1081543295 11:44051572-44051594 CCAGGGGGATGGAGAAAGCATGG + Intronic
1083267199 11:61552120-61552142 GCAGGGGGAGGGAGGGAGCAGGG + Intronic
1084653544 11:70502506-70502528 GCAGGGGGAGGGAGGGGACAGGG + Intronic
1084949787 11:72658270-72658292 CCCAGGTTATGGAGGAAACAAGG + Intronic
1085109781 11:73877180-73877202 CGAGGGATATGGAGGGAACAGGG + Intronic
1085150823 11:74251710-74251732 CCAGTGGTAAGGCGGGTACAAGG + Exonic
1087757874 11:102073809-102073831 CCAAGGGAATGGGGGGTACAAGG + Intronic
1088737399 11:112739146-112739168 TCAGGTGTAGGGAGGGAAAAAGG + Intergenic
1089026723 11:115278587-115278609 CGATGAGTATAGAGGGAACAGGG + Intronic
1089349661 11:117815196-117815218 CCAAGGGGCGGGAGGGAACAAGG + Intronic
1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG + Intergenic
1090080355 11:123608528-123608550 ACAAGGGTATGGAGAGGACACGG - Intronic
1090231973 11:125113771-125113793 CCAGGGGTCTGGAAGGAATGGGG + Intergenic
1090314178 11:125770293-125770315 ACAGGGTTATGCAGGGAATAAGG - Intergenic
1091584089 12:1806024-1806046 GCTGGGGTGTGGAGGGAGCAGGG + Intronic
1091666747 12:2424353-2424375 CAAGGGGGAGGGAGGGAAAACGG + Intronic
1092782659 12:12001584-12001606 GCAGGAGAATGGCGGGAACACGG + Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1094383852 12:29872641-29872663 CCAATGGTGTGGAGGGAGCATGG + Intergenic
1094675665 12:32617783-32617805 CAAGGTTCATGGAGGGAACAGGG + Intronic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097700093 12:62811097-62811119 CATGGGGTATGGGGGGCACACGG + Intronic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1102319993 12:111924893-111924915 CCAGGGGTTTGGAGAGAAAGAGG + Intergenic
1103851821 12:123938422-123938444 GCAGGGGCAGGGAGGGACCAAGG - Intronic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104415844 12:128596179-128596201 CCAGTGTGATGGAGAGAACACGG - Intronic
1104724275 12:131066472-131066494 CCTGCGGTAGGGAGGGTACAGGG - Intronic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1106347364 13:28892129-28892151 CCAGGAATATGGAGTGAAAAAGG - Intronic
1107041806 13:35956671-35956693 CCAGGGATAGGTAGGGAATATGG + Intronic
1107190503 13:37578703-37578725 GCAGGAGAATGGAGTGAACATGG + Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108166293 13:47696703-47696725 CCAAGGGGATGGAGGAACCACGG - Intergenic
1108257808 13:48627699-48627721 ACAGAGGCATGGAGTGAACAAGG + Intergenic
1112191679 13:97184473-97184495 CCAGGGGTGAGGGGGGAACACGG - Intergenic
1112328109 13:98457268-98457290 CCAGGCGTGCGGAGGGAACTTGG - Exonic
1113647690 13:112010877-112010899 CCAGGGGTATCGGCGGAGCAGGG - Intergenic
1114367926 14:22050265-22050287 CCAGTGGTAGAGTGGGAACAGGG - Intergenic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119197551 14:72728408-72728430 CCAATGGCATGGAGGGAAGAAGG + Intronic
1119323484 14:73745194-73745216 CCAGGGGTAGGGTGGGATCCCGG - Intronic
1121405516 14:93717228-93717250 TCAGGGACATGGAGGGAACATGG - Intergenic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1202929815 14_KI270725v1_random:27098-27120 CCAGGGATATGGCAGGACCAGGG - Intergenic
1123422489 15:20144135-20144157 CCAGGGATATGGCAGGACCAGGG + Intergenic
1123442521 15:20302218-20302240 CCAGGGATATGGCAGGACCAGGG - Intergenic
1123531717 15:21150675-21150697 CCAGGGATATGGCAGGACCAGGG + Intergenic
1124926644 15:34076428-34076450 CCAGAGGTAGGCAGAGAACAAGG + Intergenic
1125434495 15:39630525-39630547 GGTGGGGCATGGAGGGAACAGGG + Intronic
1125717890 15:41830080-41830102 CCTCGGGGATGCAGGGAACAGGG - Intronic
1127097444 15:55527021-55527043 GCAGGGGGATGGAGGGCCCATGG + Intergenic
1127919469 15:63481983-63482005 GCAGGGGGATGGAGGGAAAAGGG - Intergenic
1128119455 15:65134783-65134805 CAAGGGGTGGGGAGGGACCAAGG - Intergenic
1129245532 15:74276669-74276691 CCAGGAGGCTGGAGGGCACAGGG - Intronic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1129875343 15:78971778-78971800 GGACGGGTATGGAGGGGACAGGG + Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130597626 15:85258122-85258144 CCAGGGCTGGGGAGGGGACAGGG + Intergenic
1131145966 15:90012384-90012406 CCAGGGGAATGGTGTGAACCCGG - Intronic
1135185669 16:20313811-20313833 GCAGCAGGATGGAGGGAACAAGG - Intronic
1135889585 16:26345176-26345198 CCTGGAGACTGGAGGGAACATGG + Intergenic
1136723724 16:32341693-32341715 CCAGGGGTATGGCAGGACCAGGG + Intergenic
1136773218 16:32858630-32858652 CCAGGGATATGGCAGGACCAGGG - Intergenic
1136842054 16:33547737-33547759 CCAGGGATATGGCAGGACCAGGG + Intergenic
1136862262 16:33711214-33711236 CCAGGGATATGGCAGGACCAGGG - Intergenic
1136897397 16:34002889-34002911 CCAGGGATATGGCAGGACCAGGG + Intergenic
1139955662 16:70691822-70691844 CCAGCGGTGTGGAGGGCACAGGG + Intronic
1140310002 16:73840036-73840058 CCAGGCATCTGGAGTGAACAGGG + Intergenic
1141338459 16:83179556-83179578 GCAGGGGAATGGAGTGAACCCGG + Intronic
1141422367 16:83925392-83925414 CCAGGGAAATGAAGAGAACAAGG - Exonic
1141800351 16:86303879-86303901 CCAGGGGCATGGAGGAAAGCTGG + Intergenic
1203002707 16_KI270728v1_random:176072-176094 CCAGGGGTATGGCAGGACCAGGG - Intergenic
1203075640 16_KI270728v1_random:1120740-1120762 CCAGGGATATGGCAGGACCAGGG - Intergenic
1203134313 16_KI270728v1_random:1712478-1712500 CCAGGGGTATGGCAGGACCAGGG - Intergenic
1203152219 16_KI270728v1_random:1848034-1848056 CCAGGGATATGGCAGGACCAGGG + Intergenic
1142480342 17:215027-215049 CCCGGGGTGTGGAGGGCACCCGG - Intronic
1142747777 17:1968620-1968642 CCCGGGGATGGGAGGGAACATGG - Intronic
1143817483 17:9529022-9529044 ACAGGGACATGGAGGGAAGAGGG + Intronic
1145278331 17:21450121-21450143 CCAAGGCTTTTGAGGGAACAAGG - Intergenic
1145316154 17:21736017-21736039 CCAAGGCTTTTGAGGGAACAAGG - Intergenic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1152600528 17:81259996-81260018 CCACCTGTATGCAGGGAACATGG - Intronic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1152745916 17:82039036-82039058 CCAGGAGTACGGGAGGAACATGG - Intergenic
1152747164 17:82046393-82046415 ACAGGGGTGAGGAGGGAACCAGG - Intergenic
1152934041 17:83125658-83125680 CCAGGGGTGTGGCAGGAAAAGGG - Intergenic
1154175868 18:12087058-12087080 CCAGGGATATGGAAGGACCAGGG - Intergenic
1154414801 18:14171091-14171113 CCAGGGCTATGGCAGGACCAGGG + Intergenic
1154414940 18:14171523-14171545 CCAGGGATATGGCAGGACCAGGG + Intergenic
1154415565 18:14173765-14173787 CCAGGGATATGGCAGGACCAGGG + Intergenic
1158424025 18:57322952-57322974 CCAGGGGGAGGGAGGGAGTATGG + Intergenic
1159105252 18:63996987-63997009 CCAGGGGAAGGGAGGGTACTTGG - Intronic
1159554230 18:69928498-69928520 CCGGGGGAATGCAGGAAACATGG + Intronic
1159881701 18:73864610-73864632 CAAGGGAGATGGAGGGATCAAGG - Intergenic
1160881173 19:1321361-1321383 CCAGGGCTGGGGAGGGAACGGGG - Intergenic
1161158299 19:2746646-2746668 GCAGGGGAATGGAGTGAACCTGG - Intergenic
1161459288 19:4387028-4387050 CCAGGAGTATGGCGTGAACCCGG - Intronic
1161476781 19:4490416-4490438 TCCGGTGTGTGGAGGGAACACGG + Intronic
1161845731 19:6710927-6710949 CCAGGGGTGCGGAAGAAACAAGG + Intronic
1162012551 19:7826639-7826661 GCAGGAGAATGGAGTGAACACGG + Intergenic
1162035884 19:7939004-7939026 CCAGGGGTTTGGTAGGAAGAGGG + Intronic
1162821188 19:13224650-13224672 CCAAGGGTAAGGAAGGGACAGGG - Exonic
1163814514 19:19456058-19456080 GCAGGAGAATGGAGTGAACACGG + Intronic
1164469214 19:28514398-28514420 CCAGGGTCAGGGAGAGAACATGG + Intergenic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1165094004 19:33400867-33400889 CCAGGGCTATGGAGGACCCAGGG + Intronic
1165824350 19:38697281-38697303 CCACTGGTATGCAGGGAAAATGG - Intronic
1166174734 19:41059272-41059294 CCAAGGGTATGGGGGCCACAAGG - Intergenic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167193988 19:48014054-48014076 GCGGGGGCAGGGAGGGAACACGG + Intronic
1167269908 19:48500882-48500904 TGAGGGGTATGGAGGGCAAACGG + Intronic
1202692306 1_KI270712v1_random:100886-100908 CCAGGGATATGGCAGGACCAGGG + Intergenic
924973573 2:153580-153602 CCAGGAGTATGGCGTGAACCCGG + Intergenic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926645523 2:15286501-15286523 CCAGGGATTTGGGTGGAACATGG - Intronic
927293535 2:21427585-21427607 CCAGTGATTTGGAGGGAGCAAGG - Intergenic
927374604 2:22399275-22399297 CCAAGGGTACGAAGGGTACAAGG + Intergenic
927894699 2:26774272-26774294 CGAGGGCTGTGGAGGGAGCAAGG + Exonic
928171364 2:29006627-29006649 CCAGGGAGATGGAGGGAATGAGG - Intronic
928352168 2:30568599-30568621 GCAGGGGAATGGCGGGAACCTGG - Intronic
929564979 2:42978600-42978622 CCAGCTGGATGGAGGGCACATGG + Intergenic
929580381 2:43078558-43078580 CCAGGGGTATCCAGGGAGGAGGG - Intergenic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931881767 2:66576620-66576642 CCTGGGGGCTGGAGGGCACATGG + Intergenic
932297217 2:70636307-70636329 CCAGGAGTATGGAGTAAAGAAGG - Intronic
933811325 2:86034547-86034569 GAAGTGGTATGGAGGGGACAGGG - Intronic
933954092 2:87353086-87353108 CCAGGGATATGGCAGGACCAGGG - Intergenic
934238295 2:90249329-90249351 CCAGGGATATGGCAGGACCAGGG - Intergenic
934274902 2:91567404-91567426 CCAGGGATATGGCAGGACCAGGG + Intergenic
934322406 2:91981843-91981865 CCAGGGATATGGCAGGACCAGGG - Intergenic
934460712 2:94212666-94212688 CCAGGGATATGGCAGGACCAGGG - Intergenic
934825343 2:97416654-97416676 ACAGAGGAATGGAGGGAAGAAGG + Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934893124 2:98087703-98087725 CCTGGGCTTTGGAGGGAACATGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
937241046 2:120462959-120462981 GCAGGGGTGTGGGGGGCACAAGG - Intergenic
938984088 2:136556226-136556248 CCAGGGGCAAGGAGGGCAAAGGG + Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939273461 2:139970083-139970105 CCAGGGGCAGGGAGGGGCCAGGG - Intergenic
939971817 2:148670714-148670736 CGAGGGGAAGGGAGGGGACAGGG - Intronic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
945255901 2:207802894-207802916 CCAGGGGTGGGGAGGGGAAATGG - Intergenic
945752981 2:213811557-213811579 ACAGGGGTATAGAAGAAACATGG - Intronic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1170407249 20:16051029-16051051 CCAGTGGTATAGTGGGCACAAGG + Exonic
1170522775 20:17205452-17205474 CCAGGGGTATGGACAGACCATGG + Intergenic
1170772628 20:19347209-19347231 CCAGGGGTAGGGAGGAAGGAGGG + Intronic
1171246218 20:23611767-23611789 CCAGGGGTAGGCAGGCAAAAAGG + Intergenic
1172755103 20:37278237-37278259 GCAGGAGAATGGAGTGAACACGG - Intergenic
1173433974 20:43016222-43016244 CCCAGGGTCTGGAGGAAACATGG - Intronic
1173821530 20:46022892-46022914 CCTCGGGTCTGGAAGGAACAAGG + Intronic
1173984497 20:47250554-47250576 CCTGAGGTATGGAGGGAGCAGGG - Intronic
1174488191 20:50874331-50874353 ACAGGGGTATAGAGGTACCAAGG - Intronic
1174506709 20:51022243-51022265 CCGGAGGTATGGAAGGAAAAGGG - Intronic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1175983208 20:62751741-62751763 CCAGTGGGATGGAGGGTGCACGG + Intronic
1176591841 21:8655708-8655730 CCAGGGATATGGCAGGACCAGGG - Intergenic
1177198745 21:17930347-17930369 GCAGTTGTAGGGAGGGAACAGGG + Intronic
1177594360 21:23216385-23216407 GCAGGAGAATGGAGTGAACATGG - Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1178824781 21:36005793-36005815 CCAGGGGTAAAGTGGGAAAATGG + Intergenic
1178914321 21:36698461-36698483 CCAGGGGAAGGGAGGGGCCAGGG - Intergenic
1180274682 22:10632809-10632831 CCAGGGATATGGCAGGACCAGGG - Intergenic
1180333327 22:11552631-11552653 GCAAGGGCAGGGAGGGAACAAGG + Intergenic
1180887535 22:19257725-19257747 CCAGGGGTCTGGCAGGAATAGGG + Intronic
1181016585 22:20073131-20073153 GCAGGGGAATGGAGTGAACCTGG - Intergenic
1181355532 22:22294088-22294110 CCAGGGATATGGCAGGACCAGGG + Intergenic
1181558285 22:23684695-23684717 GCACGGGTAGGGAGGGGACAGGG - Intergenic
1181571089 22:23768103-23768125 CCAGGCGCAGGGAGGGAGCAGGG - Exonic
1183298817 22:37048208-37048230 CCAGGGGCAGGGAGGGAGAAAGG - Intergenic
1183522091 22:38301314-38301336 CGAGGGGCAGGCAGGGAACATGG + Intronic
1183984900 22:41563988-41564010 CCAGGAGAATGGCGGGAACCTGG + Intronic
1184464788 22:44662487-44662509 CCAGGGGTGTGTAAGGAAGATGG - Intergenic
1184517761 22:44973218-44973240 CCAGGGACAGGGAGGGGACAGGG - Intronic
1185056075 22:48578933-48578955 CCAGCAGGAGGGAGGGAACAAGG + Intronic
1185148118 22:49150179-49150201 CCAGCTGTGTGGAGGGAGCAGGG - Intergenic
1185171496 22:49297245-49297267 CCAGGGCCAGGGAGGGAACTGGG - Intergenic
950640272 3:14344091-14344113 CCAGGGGCAGGGAGGGAGGAAGG + Intergenic
950661614 3:14470106-14470128 CCAGGAGTATGGAGTGAATTTGG + Intronic
950831357 3:15878924-15878946 CCAGGTGACTGGGGGGAACATGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952912496 3:38203069-38203091 CCAGGGGTACGGGAGGAACACGG - Intronic
953262396 3:41352520-41352542 CCAGCAATATGAAGGGAACAAGG - Intronic
953625619 3:44568228-44568250 TCAGGGGTACGAAGGGCACAGGG - Intronic
954426779 3:50447558-50447580 CCAGTGGTATGGGAGGGACATGG - Intronic
955956335 3:64293641-64293663 ACAGGGAAATGGAGGGAAAATGG - Intronic
959521394 3:107326567-107326589 GCAGGAGTTTGGAGGGAAGAAGG + Intergenic
960917996 3:122716746-122716768 GGAGGGGTATGGAGGAAGCATGG - Intronic
960998289 3:123353660-123353682 CCTGGGGTAAGGAGGGCACTTGG + Intronic
962947757 3:140187364-140187386 CCAGGGGTATGTCAGGATCAGGG - Intronic
963068361 3:141281646-141281668 CCTGGGGCAGGGAGGGGACATGG + Intronic
966039900 3:175470235-175470257 CCTGGGGTATGGAGGGAACGGGG + Intronic
968848612 4:3062402-3062424 CCAGGGGAAGGGAGGGTGCAGGG - Intergenic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
970541408 4:17083579-17083601 CCAGGGGAATGGCGTGAACCTGG + Intergenic
970662529 4:18302238-18302260 CCAGGACCATGGAGGGAACTGGG - Intergenic
970827177 4:20290070-20290092 CCAGGTGTAGGGAGGCAACTGGG - Intronic
971217027 4:24671363-24671385 CCAGGGGTTTGCAGGTAACCCGG + Intergenic
976064414 4:81167664-81167686 TCCGGGGTTGGGAGGGAACATGG + Intronic
976207901 4:82639681-82639703 AAAGGACTATGGAGGGAACATGG + Intronic
976702874 4:87990133-87990155 CCATGGGTCTCGAGGGAGCATGG + Intergenic
978140624 4:105313567-105313589 CCAGGATTAATGAGGGAACAAGG + Intergenic
979193068 4:117886659-117886681 GCAGGGGTATGGCGTGAACCCGG + Intergenic
980036571 4:127890124-127890146 CTAGGGGTATGGAGCCACCATGG + Exonic
981492780 4:145358153-145358175 CCAGGGGTTTAGGGGGAAAAGGG + Intergenic
982787025 4:159548046-159548068 CCAGGACTATGCAGGGAACATGG + Intergenic
983330993 4:166329084-166329106 GCAGGGGAAGGGAGGGAAGAAGG + Intergenic
985691448 5:1314920-1314942 CCAGGGGTCTGGAGGAAGGATGG - Intergenic
985719637 5:1482430-1482452 CCAGGGGCAGGGATGGAGCAGGG + Intronic
985865436 5:2510622-2510644 CCATCAGTTTGGAGGGAACATGG + Intergenic
986016406 5:3761370-3761392 CCAGGGAGATGGAGGGAGGAGGG - Intergenic
986809162 5:11338119-11338141 CCACAGGTAGGGAGTGAACAAGG + Intronic
987037305 5:14031465-14031487 ACAGGGGTAAGGAGAGAGCATGG - Intergenic
988400100 5:30751366-30751388 CCAGGGGTCTGGAAGGAAAAGGG - Intergenic
988623776 5:32849554-32849576 CCAGGGGTAGGGATGGTGCAGGG - Intergenic
989173244 5:38494331-38494353 CCAGGGGTAGGGTGGGGGCAAGG + Intronic
989380383 5:40804388-40804410 CATGGGGGATGGAGGGAACTTGG + Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
990579669 5:57156010-57156032 CCTGGGGTCTTGAGCGAACACGG + Intergenic
991631504 5:68660848-68660870 CCTGAGGCATGAAGGGAACAGGG - Intergenic
992382468 5:76251619-76251641 CCAGTGGTCTGGATGGAACCAGG + Intronic
992664848 5:78997989-78998011 CCAGGGGAATAGAGGAAACCAGG - Exonic
993176154 5:84488556-84488578 CCAGGGGTTTGAAGGGAAGGAGG + Intergenic
993601401 5:89929391-89929413 CCAGGGGCATGGAAAGATCAGGG - Intergenic
994270030 5:97765738-97765760 CCTGGGGTATGGAGTGCCCATGG + Intergenic
994742816 5:103642460-103642482 GCAGGGGAATGGCGGGAACCTGG + Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
998138896 5:139689004-139689026 CAAGGGGTATGGAGGCTCCAGGG - Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999305717 5:150518235-150518257 GCAGGGGGAAGGAGGGGACAGGG - Intronic
999540030 5:152561150-152561172 TCAGGGGTATGGAGGGATCGTGG + Intergenic
999840977 5:155426104-155426126 CCAGGGGAATGGAGGGTTCTTGG + Intergenic
1000239572 5:159397026-159397048 CCAGGGCGATGGAGGGATCGAGG + Intergenic
1000960547 5:167596345-167596367 CCAGTAGGATGGAGAGAACAGGG - Intronic
1001962077 5:175885600-175885622 CCAGGGGTATGGGCGGATCTGGG - Intergenic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1002665084 5:180817115-180817137 AGAGGGGTATGGAGGGAGAAGGG + Intergenic
1003023676 6:2534330-2534352 CCAGGAGTTAGGAGAGAACATGG - Intergenic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004452031 6:15756506-15756528 GCAGGGGTATGGCGTGAACCCGG - Intergenic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1004789463 6:19007993-19008015 GCAGGGAAATGGAGGGAACTCGG + Intergenic
1005044519 6:21629172-21629194 GCAGGGGAATGGAGTGAACCCGG - Intergenic
1005580356 6:27228282-27228304 CCAGGAGAATGGAGTGAACTCGG + Intergenic
1005972981 6:30775992-30776014 GCAGGAGAATGGCGGGAACACGG - Intergenic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006098491 6:31671020-31671042 CCAGGGGCAGGGAGGGAGGAAGG + Intronic
1007246048 6:40463621-40463643 GCAGGGAAATGCAGGGAACATGG - Intronic
1007933225 6:45710902-45710924 GCAGGGATATGGAGAGCACACGG - Intergenic
1008969181 6:57346779-57346801 CCAGGGATGTGGAGGGCAAATGG + Intronic
1009158159 6:60248597-60248619 CCAGGGATGTGGAGGGCAAATGG + Intergenic
1010744711 6:79547511-79547533 TCAGGGGTAGGGAGGCAACACGG - Intergenic
1012069661 6:94597599-94597621 TGAGGGGCATGGAGGGAAAAGGG - Intergenic
1012283417 6:97358443-97358465 GCAGGGGAATGGAGTGAACCTGG + Intergenic
1013059880 6:106623254-106623276 CCAAGGATATGGATGGAACTGGG + Intronic
1013737316 6:113242666-113242688 CCAGGGGTATAGGGGGAAATTGG + Intergenic
1014285676 6:119494661-119494683 CCAGGAGTATGCAGAGATCAAGG + Intergenic
1017009126 6:150050964-150050986 CCCGTGGTATGAGGGGAACATGG - Intergenic
1018050826 6:160006236-160006258 CACGGGGTATGCAGGGTACAGGG - Intronic
1018839613 6:167508307-167508329 ACAGGGGAAGGGAGGGGACAGGG - Intergenic
1018839639 6:167508372-167508394 ACAGGGGAAGGGAGGGAACAGGG - Intergenic
1018839731 6:167508633-167508655 ACAGGGGAAGGGAGGGGACAGGG - Intergenic
1018839758 6:167508698-167508720 ACAGGGGAAGGAAGGGAACAGGG - Intergenic
1018839888 6:167509127-167509149 ACAGGGGGATGGAGGTGACAGGG - Intergenic
1018975602 6:168562942-168562964 CCAGTGAGATGGAGGGAACAGGG - Intronic
1019273685 7:164763-164785 ACAGGGGTTTGAGGGGAACATGG - Intergenic
1019739293 7:2664865-2664887 GCAGGGGCATTGGGGGAACAGGG + Intergenic
1020126938 7:5538358-5538380 CCAGGTGTATGTGGGGACCAAGG - Intronic
1023473578 7:40552293-40552315 ACAGAGGTATGGAGGGCAGAGGG - Intronic
1023852839 7:44159687-44159709 CCAGGGGTCTGTATGGAACTTGG + Intronic
1023897406 7:44445406-44445428 CTAGGGGAAGGGAGTGAACAGGG - Intronic
1025942103 7:66082281-66082303 CCAGGGATAGGGTGGGACCAAGG + Intronic
1026707041 7:72703116-72703138 GCAGGAGTATGGCGGGAACCCGG - Intronic
1026880273 7:73903339-73903361 CCAGGGGAATGGGGGACACAGGG - Intergenic
1026909233 7:74083136-74083158 CCAGGGTCCTGGAGGGAGCACGG - Intronic
1027404513 7:77846043-77846065 GAAGGGGTATGGAGGGACCTTGG - Intronic
1029033201 7:97490509-97490531 CCAGGTGCAGGGCGGGAACAAGG + Intergenic
1029615860 7:101656836-101656858 CCCGGGGTCTAGAGGGAACTTGG - Intergenic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1033097106 7:138441591-138441613 CCAGGTGATTGGGGGGAACATGG + Intergenic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1034509907 7:151525559-151525581 GCAGGAGAATGGAGGGAACCCGG + Intergenic
1035013654 7:155743875-155743897 CCAGGGGGATAGTGGGCACAAGG - Intronic
1035616227 8:1003776-1003798 TCTGGGGTATGGGGGGACCAAGG - Intergenic
1035706357 8:1678447-1678469 CCAGGGGTCTGGAGGGGGCAGGG - Exonic
1036524371 8:9521155-9521177 GCAGGGGAATGGAGTGAACCCGG + Intergenic
1036688798 8:10928444-10928466 CCAGGGGTTTAGGGGGGACATGG - Intronic
1037075386 8:14710274-14710296 GCAGGGGAATGGAGTGAACCCGG + Intronic
1037823898 8:22149180-22149202 CTAGGGTTATGGGTGGAACAAGG - Intronic
1037881119 8:22573963-22573985 GCAGGGGTGTGCAGGGAAAAGGG + Intronic
1043134128 8:76500311-76500333 CCTTGGGCCTGGAGGGAACATGG - Intergenic
1044051994 8:87516494-87516516 CCAAGGGTAAGGAGGGGACTGGG - Intronic
1045961410 8:107973174-107973196 CCAGGAGTATGGCGTGAACCCGG + Intronic
1046515291 8:115251637-115251659 CCAGGGGTTTGCAGGGAGAAAGG - Intergenic
1049533874 8:143169132-143169154 TCAGGTGTGTGGAGGGCACAGGG + Intergenic
1049782038 8:144433547-144433569 CCAGGGCTAGGGAGTGGACAGGG + Intronic
1051911782 9:22160881-22160903 GCAGGAGAATGGCGGGAACAGGG + Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1053078042 9:35151670-35151692 GGAGTGGTATGGAGGGAAAATGG + Intergenic
1056322024 9:85444276-85444298 AAAGAGGTATGGAGGGAAGAAGG - Intergenic
1057277408 9:93683435-93683457 CCCGGCCCATGGAGGGAACAGGG + Intergenic
1057482444 9:95456069-95456091 AGAGGGGTATGGAAGGTACATGG - Intronic
1057817243 9:98304632-98304654 CCAGGAGGATGGAGGCACCATGG + Intronic
1058402100 9:104631449-104631471 AAAGGGGGATGGAGGCAACATGG - Intergenic
1059988984 9:119846859-119846881 TCAGGCCAATGGAGGGAACATGG - Intergenic
1060733825 9:126053844-126053866 CAAGGGGCATGGTGGGTACAGGG - Intergenic
1060824491 9:126680130-126680152 CCAGGGTTATGGGGGGATGATGG - Intronic
1061087851 9:128409602-128409624 CCTGGAGTAGGGAGGGGACAGGG - Intergenic
1061408424 9:130405283-130405305 CCTGGGGAAGGGAGGGAACTCGG + Intronic
1061517250 9:131096960-131096982 CCAGGGGAAGGGAAGGAAGAGGG - Intronic
1062005030 9:134234793-134234815 CCAAGGGTATGGCGGGAAGAGGG - Intergenic
1062319283 9:135982517-135982539 CCAGGGGAGTGGAGGTAACGGGG + Intergenic
1062465515 9:136679228-136679250 CCAGGGCTGGGGAGGGGACAGGG - Intronic
1203621882 Un_KI270749v1:134527-134549 CCAGGGATATGGCAGGACCAGGG - Intergenic
1187423626 X:19158243-19158265 CCAGGAGAATGGAGTGAACCCGG + Intergenic
1188423731 X:30022422-30022444 CCAGGGGTTTGGAGGCAAGGAGG - Intergenic
1188799491 X:34510242-34510264 ACAGAGATATGGAGGGAAAAAGG - Intergenic
1188811220 X:34656609-34656631 CCAGGGATGGGGAGGGAAGAGGG + Intronic
1189002162 X:36958312-36958334 CCAGGGATGGGGAGGGAAGAGGG - Intergenic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192150761 X:68710909-68710931 CCAGGGGCATGACAGGAACAGGG + Intronic
1192168724 X:68841584-68841606 CCAAAGGTAAGGAGAGAACAGGG - Exonic
1192174012 X:68874636-68874658 AGAGGGTTATTGAGGGAACAGGG + Intergenic
1193046572 X:77060667-77060689 CCAGGGATTTGGAGGGAAAAAGG - Intergenic
1194896532 X:99448133-99448155 CCAGGGGTTAAGAGGGAATAAGG + Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195933905 X:110107082-110107104 CCAGGGGCAGGGAAGGAAGAAGG + Intronic
1196050437 X:111298380-111298402 CCAGGTGAATGCAGGGAAAAGGG + Exonic
1196313679 X:114197780-114197802 CCAGGGTTATGGAGGAAGGAGGG + Intergenic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1197621576 X:128756445-128756467 GCAGGGGAATGGTGTGAACACGG - Intergenic
1198404156 X:136295827-136295849 CCAGGCGTGCGGAGGGAACTTGG - Intergenic
1200063982 X:153496089-153496111 CCAGGGATCTGCAGGGCACAGGG + Intronic
1201677022 Y:16597315-16597337 GCAGGAGAATGGAGTGAACAAGG + Intergenic
1202583734 Y:26404919-26404941 CCAGGGATATGGCAGGACCAGGG + Intergenic