ID: 1195742036

View in Genome Browser
Species Human (GRCh38)
Location X:108074631-108074653
Sequence CTATAATAGAAGTCTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195742036 Original CRISPR CTATAATAGAAGTCTGAACA GGG Intronic
900573050 1:3369045-3369067 CTTAAATAGATGTCTGAACGTGG + Intronic
903093472 1:20945165-20945187 TTATAATAGAAGTCTTTAGAGGG - Intronic
904517950 1:31071418-31071440 CAATTATAGAAGTCTTAACACGG - Intergenic
906832912 1:49052389-49052411 CAAGAAGAGAAGACTGAACAAGG + Intronic
906999432 1:50834860-50834882 CTATAACAGATGTATGCACACGG + Intronic
907298616 1:53471245-53471267 GTATAATAGAAGTGTGGACAAGG + Intergenic
908012132 1:59789264-59789286 CAATAATGGAAGCCTGAAAAAGG + Intergenic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
909314906 1:74203707-74203729 CTTAATTAGAAGTCTAAACATGG + Intronic
910390995 1:86744285-86744307 TTAGAACAGAAGTCTTAACATGG - Intronic
911133571 1:94416368-94416390 CTATATTAGAGATATGAACAAGG - Intergenic
911691442 1:100839227-100839249 CTATAATAAAAGTATGTATAGGG - Intergenic
912370523 1:109170712-109170734 CCAGAATAGACGTCTGACCATGG - Intronic
912389729 1:109294584-109294606 CAATGATAGAGATCTGAACAAGG + Intronic
913002480 1:114595058-114595080 GTATAATAGAAATTTGTACAAGG - Intronic
913071754 1:115305026-115305048 CTGTAATAGAAGTATTAATAAGG + Intronic
915151630 1:153837197-153837219 GTATAATAGAGGGCTGAGCATGG + Intronic
915541728 1:156571733-156571755 CTTTAACAGAAGACTGGACATGG + Intronic
916763516 1:167838222-167838244 CTATGATACAGGTCTGCACAGGG - Intronic
917501565 1:175590584-175590606 CTATAATAGAACTATGTGCAAGG + Intronic
918925984 1:190786868-190786890 CTATTATCTAAGTCTGAAAATGG - Intergenic
919161486 1:193836234-193836256 CTATAATAGAAATAAGCACAAGG + Intergenic
919581903 1:199386974-199386996 CTATATTAGAAGCCTCAAGAAGG - Intergenic
921103257 1:211950052-211950074 CATTAATAGAATTCTGCACAAGG - Intronic
921699929 1:218257336-218257358 CTATAATAGAGATCAGAAGAAGG - Intergenic
922554885 1:226525276-226525298 TTATAATAGCATTCTGCACAGGG - Intergenic
1064386515 10:14897161-14897183 ATGTAATAGAAGTCTGAAGGTGG - Exonic
1065603888 10:27395759-27395781 CTCTAATTGAACTCTGAAAACGG - Intergenic
1065759476 10:28968569-28968591 ATATAATAGCAGTGTGAAAACGG - Intergenic
1068958300 10:62841215-62841237 GAATCATAGAAGTCTGAATAAGG - Intronic
1069228169 10:65970267-65970289 CTTTAAGAGAATTCTAAACATGG + Intronic
1070095609 10:73335186-73335208 ATATAAAAGAAGTCTGAGCTGGG - Intronic
1071039403 10:81287858-81287880 CAATAATAGAATTCAGAATATGG + Intergenic
1071213068 10:83366735-83366757 CTCTAATAGAAGTCTGGGGATGG - Intergenic
1073720992 10:106171305-106171327 GTATATTAGAAGTCTAAGCAAGG + Intergenic
1074793370 10:116914953-116914975 CTATAATAGAAGCCTCAGCAAGG + Intronic
1076553159 10:131300347-131300369 GTATAACTGAAGTCTGAAAAGGG - Intronic
1082691156 11:56306845-56306867 TTATAATACAAGTATTAACATGG - Intergenic
1083214473 11:61209893-61209915 CTACACTGGAAGTCTGAACTGGG + Exonic
1083217357 11:61228722-61228744 CTACACTGGAAGTCTGAACTGGG + Exonic
1083220348 11:61248470-61248492 CTACACTGGAAGTCTGAACTGGG + Exonic
1085837648 11:79973785-79973807 CTACAACAGAAGTATGAACAGGG + Intergenic
1089042296 11:115463533-115463555 CTATAATACAATTCTGAAACAGG - Intronic
1089247617 11:117133753-117133775 CTATTATAGATGACTGAGCAAGG - Intergenic
1089259144 11:117211085-117211107 CTATTATAGATGACTGAGCAAGG + Intronic
1091076794 11:132626140-132626162 CTATACTAGATGCATGAACAGGG + Intronic
1093399584 12:18728615-18728637 ATGTCATAGAAGTCAGAACAGGG + Intronic
1093543210 12:20312593-20312615 TTATAATAGCAGCCTGAACAGGG + Intergenic
1093929327 12:24938812-24938834 CTACAGTAGAAGTCTGCACAAGG - Intronic
1095486427 12:42689527-42689549 CTATAATAGAAGTCTCTGCATGG + Intergenic
1096306078 12:50477324-50477346 CTTACATAGAACTCTGAACATGG - Exonic
1097901292 12:64875938-64875960 TTATAATAGGAGTTAGAACAGGG + Intronic
1099713337 12:86257732-86257754 CTATCATAAAAGTCAGAACTTGG - Intronic
1100802523 12:98248262-98248284 CAATAATGGAAGTGTGTACAAGG + Intergenic
1105029693 12:132874111-132874133 CTAAAATCCAGGTCTGAACAGGG - Intronic
1105047327 12:133015924-133015946 CTTTAATAGAAGTCTGAACTAGG + Exonic
1107333249 13:39324600-39324622 ATATAATAGAATTCTGAGCCAGG - Intergenic
1107521910 13:41191800-41191822 GTATAATAGAAAACTGAACTAGG - Exonic
1108026547 13:46184125-46184147 CTATAATAGAGGGGTGAAAAAGG + Intronic
1108149639 13:47520213-47520235 CTATAACAGAAGTCTTAGAATGG - Intergenic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1109176062 13:59157457-59157479 CTATAAGAGAAGTTTGAATGGGG - Intergenic
1110096986 13:71538471-71538493 CTATATAAGAATTCTGAGCAAGG + Intronic
1110722094 13:78774071-78774093 TGATAATAGAAGTCTGGTCAAGG + Intergenic
1110923287 13:81116777-81116799 TTACAATAGAAGTGTGAACTTGG + Intergenic
1111392755 13:87619583-87619605 CTATATTACAAATCTGAAAATGG + Intergenic
1112312789 13:98334355-98334377 GTATATTAGAAGCCAGAACAGGG - Intronic
1113048843 13:106186105-106186127 CTTTATTAGCAGTGTGAACATGG + Intergenic
1114196823 14:20485486-20485508 CTATTAGAGTAGACTGAACAAGG + Intergenic
1114625927 14:24130335-24130357 CTATAAAAGAATTTTGAACTAGG - Intronic
1115839768 14:37456368-37456390 CCATAATATAAGTATGAACAGGG - Intronic
1116202829 14:41821146-41821168 GTATAATAGAAGTATGAAAGTGG + Intronic
1117102789 14:52367698-52367720 CTATAGAAGAAGTCTGAAAGTGG + Intergenic
1118001154 14:61525137-61525159 CTATCATAGAAGTATAAACTGGG + Intronic
1118776007 14:68974434-68974456 CTATAATAGAAGAATGATAAGGG + Intronic
1119276215 14:73358683-73358705 CAATAATAGAAGTAAGAAGAAGG - Intronic
1121674134 14:95738791-95738813 CTACAACAGGAATCTGAACAGGG + Intergenic
1126640459 15:50819798-50819820 CTATCATAGATCTCTGACCACGG - Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1127947544 15:63770340-63770362 CTATAGTAGAAGTCTGTACTGGG - Intronic
1128372910 15:67053621-67053643 TTGGAATAGAAGTCTGAACAGGG + Intergenic
1129943597 15:79519944-79519966 CTTTAATAGAGGGCTGAAAATGG + Intergenic
1131001693 15:88943723-88943745 CTAAAATAGGAGACTGAAAAGGG + Intergenic
1131442368 15:92468554-92468576 CTATAATACAAGGCAGAATATGG - Exonic
1134861660 16:17565648-17565670 CTATAATAGAAGTCCGAAAAGGG + Intergenic
1136281492 16:29214488-29214510 ATAAAATAGACGTCCGAACAAGG + Intergenic
1141257096 16:82412426-82412448 GAATAATAGAATTCTGAATACGG - Intergenic
1141504553 16:84466589-84466611 CTATATTAATAGTCTGAAGAAGG + Intergenic
1146494545 17:33309714-33309736 CCACAATAGAAGTCTACACAAGG - Intronic
1149453607 17:56769489-56769511 CAATAAGAGAAGTATCAACAAGG + Intergenic
1150981130 17:70142760-70142782 CTGTTATAGCAGACTGAACAGGG + Intergenic
1153399550 18:4667817-4667839 CAATAATAGAATTCAGAATATGG + Intergenic
1155945788 18:31849699-31849721 CGATAAAAGAAGTCTGCACATGG + Exonic
1159396302 18:67862120-67862142 CTAAGATATAAGTCTGAACTAGG + Intergenic
1159803151 18:72924874-72924896 CTTTAATAGCAGTATGAAAATGG - Intergenic
1168163882 19:54533460-54533482 CTACAACAGAAATCTGTACATGG - Intronic
926040722 2:9670829-9670851 CAATGATAGAAGTTTGTACAAGG + Intergenic
926672217 2:15587222-15587244 TTATTATAGAAATCTGAAAAAGG - Intergenic
929642085 2:43591748-43591770 TTATGATAGAAGTCTGAATATGG + Intronic
930078779 2:47430343-47430365 TGTTATTAGAAGTCTGAACATGG - Intronic
932471803 2:71964000-71964022 CAATAATAGACTTCTGAAGAGGG - Intergenic
932539054 2:72632136-72632158 ACAGAATAGAAGTATGAACATGG + Intronic
933225835 2:79748577-79748599 CTATATTAAAAATCTGAAAATGG - Intronic
934138641 2:89022633-89022655 CTATAATAAAAGACTTAAAAAGG - Intergenic
934144730 2:89080697-89080719 CTATAATAAAAGACTGAAAAAGG - Intergenic
934224525 2:90119854-90119876 CTATAATAAAAGACTGAAAAAGG + Intergenic
934230606 2:90177927-90177949 CTATAATAAAAGACTTAAAAAGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935887876 2:107643326-107643348 CTTTATTAGAAGTGTGAAAATGG + Intergenic
936997338 2:118429289-118429311 CTATAATAGAAGTATGAACAAGG + Intergenic
938946507 2:136217096-136217118 CTAAAAGCCAAGTCTGAACAAGG - Intergenic
939361463 2:141177710-141177732 CTATTAGAAAAGTCTGAACCTGG - Intronic
940483660 2:154269465-154269487 CTATAATAGAAATATGGAGATGG + Intronic
940665299 2:156601525-156601547 CTATAATAGAAGTATAATCAAGG - Intronic
941153285 2:161941615-161941637 CAATAAGAGAACACTGAACATGG - Intronic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
943056701 2:182990717-182990739 CTATAATAGGAGTTTAAACATGG - Intronic
943898012 2:193392559-193392581 CTATAATAAAATTCTAAACTAGG - Intergenic
944701748 2:202252062-202252084 CTAAAATAGATGTGTTAACAGGG - Intergenic
946177644 2:217931181-217931203 CTATAATGGAGGTATGAAGAGGG + Intronic
946603768 2:221379497-221379519 CTATAATTGAAGTCTACAGATGG + Intergenic
949069734 2:242017243-242017265 CCAAAATACAAGTCAGAACAGGG + Intergenic
1169963085 20:11184285-11184307 CAATAATAGAAGTATGACAAAGG - Intergenic
1171328616 20:24318082-24318104 CTACAATGGGAGTCTGAACTGGG - Intergenic
1173928428 20:46798363-46798385 CTAAAATAGAAATCAGATCAGGG + Intergenic
1174835224 20:53850626-53850648 CTAAAGTAGAAGTTTCAACAAGG + Intergenic
1175301226 20:57943977-57943999 CTATAATTTCTGTCTGAACAGGG - Intergenic
1175618072 20:60420445-60420467 CTCTCATAGAAGCCTGAACCTGG + Intergenic
1179527808 21:41995084-41995106 CTTTATTAGAAGTGTGAAAATGG + Intronic
949259936 3:2093818-2093840 CTTTATTAGAAGTGTGAAAATGG + Intergenic
955217323 3:56995129-56995151 CTTTAATAGCAGTGTGAAAATGG + Intronic
956876412 3:73468321-73468343 CTATAATCAAGGTGTGAACATGG - Intronic
957173053 3:76764801-76764823 CTGTAACAGAAGTATGTACAGGG - Intronic
959503004 3:107128227-107128249 AGATTATAGAAGTCTGAATAGGG + Intergenic
965494648 3:169382908-169382930 CTATAGTAGAACACTGATCATGG - Intronic
968106951 3:196007982-196008004 CCAAAATACAAGTCAGAACAGGG - Intergenic
968389721 4:180383-180405 CTTTATTAGCATTCTGAACAGGG + Intergenic
968954815 4:3712835-3712857 CTAAAATACATGTCTCAACATGG + Intergenic
970396100 4:15667604-15667626 ATTTAATCAAAGTCTGAACAAGG + Intronic
970772392 4:19629371-19629393 CTGTGACAGAAGTCTGTACATGG + Intergenic
972847906 4:43011571-43011593 CCACAATAGAAGTGTGAACAAGG - Intronic
972968541 4:44543609-44543631 TTAAAATAGAAATGTGAACAAGG - Intergenic
974802375 4:66834646-66834668 GATTAATAGAAGTCTGAATAAGG - Intergenic
979236046 4:118401427-118401449 CTAAAATTGAGGTGTGAACAGGG - Intergenic
979382376 4:120022078-120022100 CTATAATAGCTGTCTTATCATGG + Intergenic
980218788 4:129886756-129886778 CTATAATAGAAGATGAAACATGG + Intergenic
982261228 4:153495997-153496019 CCAGAAAAGAAGTCTGAAGATGG + Intronic
982685008 4:158477746-158477768 CTATAATTGAAATCTGAATGAGG - Intronic
982912222 4:161158205-161158227 ATATAATAGATTTCAGAACAAGG - Intergenic
983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG + Intergenic
986599114 5:9453538-9453560 CTATAATTGATGCCTGAACAAGG - Intronic
987309078 5:16665506-16665528 TTATAATGGTGGTCTGAACAAGG - Exonic
987763991 5:22201726-22201748 CTACAAGAGAAGCCTTAACATGG + Intronic
988029801 5:25749261-25749283 CTATAACTCCAGTCTGAACAGGG + Intergenic
988194879 5:27992241-27992263 CTCTCATAGTATTCTGAACATGG - Intergenic
988900917 5:35731119-35731141 AGATAATAGAAGACTGAAAATGG + Intronic
989733712 5:44677705-44677727 CTACAATAAAAGTATGTACAGGG - Intergenic
990573705 5:57104608-57104630 TTATAATAAAAGTCTGTATAAGG - Intergenic
990720487 5:58689819-58689841 CTTTAATAGTCATCTGAACAAGG - Intronic
991346085 5:65669956-65669978 ATATGATAGAAGTTTGAAAATGG + Exonic
991898716 5:71434804-71434826 CTACAAGAGAAGCCTTAACATGG + Intergenic
992101502 5:73412031-73412053 ATAGAATAGAAGGCTGAAGAAGG - Intergenic
993110382 5:83649963-83649985 CTATAATGGAAGTCTACATAAGG + Intronic
993269439 5:85775095-85775117 CTTTTATAGAAATCTAAACATGG + Intergenic
994084199 5:95740720-95740742 CTAGAATACAAGTCAGATCATGG + Intronic
994861741 5:105204132-105204154 CTTTAAAAGAACTCTAAACATGG - Intergenic
994898258 5:105734497-105734519 CTATAGTAGAGGTCTGTACATGG - Intergenic
995766089 5:115621204-115621226 CTATGATAGAAGTATGAATGGGG - Intronic
995939395 5:117561853-117561875 TGATAATAGAAGTCAGAATATGG - Intergenic
997535403 5:134616598-134616620 TTATAAAAGAAGTCTGAATTAGG + Intronic
998680381 5:144460252-144460274 ATTTAATAGAAGTCTTTACAGGG - Intronic
998742751 5:145223611-145223633 ATCTAATGGAAGTCTAAACATGG + Intergenic
999167756 5:149565219-149565241 CTATACTAGAAGGAAGAACAGGG - Intronic
1000079930 5:157835267-157835289 CTATAACTGATGTCTGAACAGGG - Intronic
1000931599 5:167258581-167258603 ATATAATAGAATTCTAAATAAGG - Intergenic
1003092294 6:3114449-3114471 CTAGAATAGAAGACTGAAGCTGG + Exonic
1003267219 6:4576324-4576346 CTATGATAAAAGTCTGTACAGGG - Intergenic
1005122196 6:22402023-22402045 CTTTAATAGCAGTGTGAAAATGG + Intergenic
1005495073 6:26381357-26381379 CAATAATAGAAGACAGGACATGG + Intergenic
1008310083 6:49957439-49957461 CTATATTACAAGTCTGACCTAGG + Intergenic
1008377204 6:50805819-50805841 CCATAATGGAAGTCTGACTATGG - Intergenic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1011040754 6:83027613-83027635 CAGTAATGGAAGTCTGAAGACGG - Intronic
1013358612 6:109371586-109371608 TACTAATAGAAGTCTGACCAAGG + Intronic
1013446300 6:110231586-110231608 CTATATTAGATGTTTGAATATGG + Exonic
1014919158 6:127192168-127192190 CTAAAATAGAGGTGTGTACAAGG - Intronic
1015003310 6:128247010-128247032 CTATAATGGAAAGCTGAACTGGG + Intronic
1015408304 6:132862574-132862596 CTAAATTAGAAGTAGGAACAAGG - Intergenic
1016571448 6:145517874-145517896 CAGTAATAGAAGTCTAATCACGG - Intronic
1017587388 6:155942037-155942059 CTGTAATGGAAGTATGCACAGGG - Intergenic
1020715418 7:11668716-11668738 CTAAAACAGAAGTATGAATAAGG + Intronic
1021769623 7:23985270-23985292 CTATCATACAAGCCTGAACCTGG - Intergenic
1022555863 7:31295260-31295282 CTATAATTAAAGTCTCAAAAAGG - Intergenic
1023328998 7:39093057-39093079 CTATAAGAGAAGTTTGGGCATGG - Intronic
1023464584 7:40440081-40440103 CTATAATTGAAGTCATCACATGG - Intronic
1024097441 7:45994326-45994348 GGATTATAGAAGACTGAACATGG + Intergenic
1024190933 7:47008971-47008993 CTATTATAGGAGGCTGAAAATGG + Intergenic
1026302452 7:69109698-69109720 CTTTAATAGCAGTGTGAAAATGG - Intergenic
1026481504 7:70783591-70783613 CTAGAATGGAAGTATAAACAAGG - Intronic
1028155515 7:87424657-87424679 AAATAAGAGAAGTCTGCACAGGG - Intronic
1028550266 7:92053594-92053616 GTATAGTAGGAGTCTGACCATGG + Intronic
1030990885 7:116298563-116298585 CTATATTAGCAGTGTGAAAACGG + Intronic
1032430342 7:131855862-131855884 TTTTAATAGCAGTCTGAAAATGG + Intergenic
1033621013 7:143061995-143062017 CTATGATAGAGTTCTGAAAATGG - Intergenic
1037083029 8:14809680-14809702 CTATAATTTAAATCTGAAAATGG + Intronic
1037648536 8:20815905-20815927 GTATAATAGAAGTGAGTACAAGG - Intergenic
1038285517 8:26203301-26203323 CTGTGATAGAAGACTGTACAGGG - Intergenic
1038415057 8:27389073-27389095 CTCTAATAGAACTCTAAGCATGG - Intronic
1038498101 8:28020554-28020576 CTTTAGTACAAGTGTGAACATGG - Intergenic
1038617572 8:29109244-29109266 CTATAATATTAGTAGGAACAGGG + Intronic
1039200461 8:35086026-35086048 CTATAAAAGAAGTTTCAATATGG - Intergenic
1040027985 8:42799188-42799210 CAACAATAGAAGTCAGAAGATGG + Intergenic
1040964311 8:53069003-53069025 ATATAATTTAAGTCTCAACACGG - Intergenic
1041667802 8:60462852-60462874 CTATAATAGCATTCTTAAAATGG - Intergenic
1041906873 8:63042444-63042466 TTATAATAAAACTCTTAACAAGG - Intergenic
1042694046 8:71536272-71536294 ATATGATTGTAGTCTGAACAAGG + Intronic
1044337721 8:91007208-91007230 ATCCAATAGAAGTCTGTACATGG - Intronic
1045051849 8:98334646-98334668 CTAAAATGCAAGCCTGAACATGG + Intergenic
1045584084 8:103511767-103511789 CTATAATAGTAATTTGAACAGGG + Intronic
1046147335 8:110178018-110178040 CTTCAATAGAAGACTGAATATGG - Intergenic
1047562506 8:126003418-126003440 CTATTATAGAAGTCACAATAAGG + Intergenic
1050964394 9:11779930-11779952 CTAGAATAGAAGTCTCTACTTGG - Intergenic
1053335382 9:37265702-37265724 CTAAAATAGAGGTCTCATCATGG + Intronic
1056167794 9:83956001-83956023 TTAAAATAGAAGTATGAAAAGGG - Intronic
1059717534 9:116927595-116927617 TTACAATAGAAGTCTGTACTAGG + Intronic
1060262355 9:122087523-122087545 CTATAATAGATCTCAGGACAGGG + Intronic
1186250766 X:7663491-7663513 GTATCATTGAAGCCTGAACAGGG - Intergenic
1189637543 X:43027561-43027583 CAATCATATAAGTCTGAAAAAGG - Intergenic
1190147372 X:47906908-47906930 CTATATTAGATGTTTGAATATGG + Intronic
1191749691 X:64528423-64528445 CTATCATAGAGCTCTGCACATGG + Intergenic
1192929282 X:75787847-75787869 TGATGCTAGAAGTCTGAACAGGG - Intergenic
1193744332 X:85257384-85257406 TTATAAGAGAAGTCTAAACATGG - Intronic
1195742036 X:108074631-108074653 CTATAATAGAAGTCTGAACAGGG + Intronic
1195801537 X:108717327-108717349 CTATAACAAAAGTCTGAGCATGG + Intergenic
1195907492 X:109859541-109859563 GAATAATAGGAGTTTGAACATGG - Intergenic
1196675150 X:118412387-118412409 CTAAAACAAAAATCTGAACATGG - Intronic
1196862806 X:120043515-120043537 AAATAATAGTAGACTGAACATGG + Intergenic
1196880296 X:120192829-120192851 AAATAATAGTAGACTGAACATGG - Intergenic
1196945834 X:120825134-120825156 TGATAATAGAAATGTGAACAGGG - Intergenic
1196970612 X:121104361-121104383 CTATAATAAAAGTCAAAATAGGG + Intergenic
1197386246 X:125806406-125806428 ATATAATAGAAGTATGAAAAGGG + Intergenic
1198845842 X:140909532-140909554 ATATAATAGGAGTCTCACCAAGG - Intergenic
1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG + Intergenic
1201450888 Y:14113397-14113419 CAATAATAGAAATCAAAACATGG + Intergenic