ID: 1195743896

View in Genome Browser
Species Human (GRCh38)
Location X:108094856-108094878
Sequence CAGGGTTCAAAAACTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195743895_1195743896 -8 Left 1195743895 X:108094841-108094863 CCTTTGCACTTGCTTCAGGGTTC 0: 1
1: 0
2: 3
3: 12
4: 152
Right 1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195743896 Original CRISPR CAGGGTTCAAAAACTGCTGC TGG Intronic
900862140 1:5241389-5241411 CAGGAGTCAAAAACTGCTGCAGG - Intergenic
900964720 1:5949970-5949992 CTGTGTTTAAAACCTGCTGCTGG - Intronic
901252977 1:7795880-7795902 GGGGGTTAAAGAACTGCTGCTGG - Intronic
902334997 1:15749582-15749604 CACGGTTCAAAGGGTGCTGCTGG - Intergenic
902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG + Intronic
903402639 1:23067409-23067431 CAGGGTTCAAAATCGTCTGTTGG + Intronic
907842195 1:58169086-58169108 CAGGGTCCAGCAACTGCTGCAGG + Intronic
908863775 1:68521630-68521652 CAGAGTTCTCAAACAGCTGCTGG + Intergenic
910254154 1:85230480-85230502 CCTGCTTCAAGAACTGCTGCAGG + Intergenic
911092213 1:94026599-94026621 CAGGTTGGAAAAATTGCTGCTGG + Intronic
912366092 1:109135121-109135143 CAGGGTTCCCAAACTGCAGTAGG + Intronic
912766497 1:112416817-112416839 CAGCGTTCAAAAACAGCTAAGGG - Intronic
916185579 1:162129342-162129364 CAGGGTTTAAAAAATGAGGCTGG - Intronic
917541176 1:175916235-175916257 AAGCCTCCAAAAACTGCTGCTGG + Intergenic
918484740 1:185017194-185017216 CAGGAATAAAAAACTGATGCAGG - Intergenic
920848090 1:209610279-209610301 CAGGGATCAATAACTGTTCCAGG + Intronic
1063357644 10:5416126-5416148 CAGTCTTCAAAAAATGGTGCTGG - Intronic
1065901463 10:30211872-30211894 CAGGGTCCCAAGACGGCTGCTGG - Intergenic
1066616293 10:37298314-37298336 AAGCGTTCAAAAACCGCTGGCGG + Intronic
1067094989 10:43294412-43294434 CAGGGTCGAGAAACTGCTTCCGG + Intergenic
1067850678 10:49751891-49751913 CAGGGGTCTCAAACTTCTGCCGG + Exonic
1069872494 10:71541588-71541610 CTGGGTGCAGAAACTCCTGCCGG - Intronic
1070741898 10:78908687-78908709 CAGGGTTCAAACACCGCTTCCGG + Intergenic
1074383268 10:112997184-112997206 CAGGGTTCAAATACCACAGCTGG + Intronic
1075483418 10:122800481-122800503 CAGAGTTCAGCAGCTGCTGCTGG - Intergenic
1080590304 11:33717635-33717657 CAGGGTCCAAAAAATGTTGCTGG - Intronic
1080672595 11:34394979-34395001 CAGGCTTGAAAACCTGCTTCAGG + Intergenic
1081294319 11:41367012-41367034 CTGGGTTCAAATTCTGCTTCCGG - Intronic
1081855023 11:46297434-46297456 CAGGGTGCAAACCCTGCTTCAGG + Intronic
1083181643 11:60989610-60989632 CATGGCTCAAGAAATGCTGCGGG + Intronic
1087266131 11:96063212-96063234 CAGGGTTCACAATCTTCTGTAGG + Intronic
1088378354 11:109166611-109166633 CAGAGGTTAAAAACTGCTCCCGG - Intergenic
1089248873 11:117143538-117143560 CAGGGCTCTTAAACTGATGCGGG - Intergenic
1089306315 11:117528492-117528514 CAGGCTTGAGAAACTGCTGGGGG + Intronic
1091018230 11:132073587-132073609 GAGGTTTTAAAAACTGCTCCAGG - Intronic
1091251365 11:134146865-134146887 AAGGATTCAAAAAATGCTCCTGG - Intronic
1092836058 12:12489397-12489419 CAGGGTGCAGAAACTGATTCAGG + Intronic
1095666231 12:44802171-44802193 CAGGATTCAAGATCTGTTGCAGG - Intronic
1096252422 12:50041534-50041556 CTGGGTAGAAAAACTGCTGTGGG - Intergenic
1096749479 12:53749628-53749650 CAGGTTTCAGCAACTGCTGCAGG + Intergenic
1096813057 12:54183790-54183812 CAGGCTCCGAAAACTGCAGCTGG + Exonic
1098241139 12:68468235-68468257 CAGGGTCCAAAAATAGCTCCAGG + Intergenic
1102106369 12:110327550-110327572 TAGGGTACAAACATTGCTGCTGG + Exonic
1105349563 13:19602739-19602761 CAGGGAACACAAACTGCTGCGGG - Intergenic
1105445792 13:20455995-20456017 TAGGGTTCAACAAATGGTGCTGG + Intronic
1106462549 13:29985042-29985064 CCCTGTTCAAAAACTGGTGCTGG - Intergenic
1107481664 13:40790211-40790233 CAGGGAACACGAACTGCTGCGGG - Intronic
1108662486 13:52599842-52599864 CAGGGAACACTAACTGCTGCGGG + Intergenic
1111916257 13:94363765-94363787 CAGGTTTCAAAATCTGTTGTGGG - Intronic
1119445315 14:74658373-74658395 CATGGTTAAGAAGCTGCTGCTGG + Intronic
1121588750 14:95082980-95083002 GAGGGTTCAACAAATGGTGCTGG + Intergenic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1124147245 15:27139240-27139262 CAGGCTTGAGAAACTGCGGCTGG + Intronic
1125055979 15:35359276-35359298 CAGGCTTGAAAATCTACTGCAGG + Intronic
1126165199 15:45649058-45649080 CAGAGTTCAAACAGAGCTGCTGG - Intronic
1128022712 15:64406663-64406685 CAGGAATCAAAAAATGCTACAGG - Intronic
1134477197 16:14585150-14585172 CGTGGTTCAAATACTGCTGCCGG + Intronic
1135797555 16:25459959-25459981 CAGGGTTGAAAAACTACTCATGG + Intergenic
1136738268 16:32484423-32484445 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1137298429 16:47121316-47121338 CATGGATAAAACACTGCTGCAGG - Intronic
1138126493 16:54443111-54443133 CATGGTTTAAAAACTGCCACTGG - Intergenic
1141695180 16:85615765-85615787 CGGTGTTTTAAAACTGCTGCTGG + Intronic
1141982026 16:87556739-87556761 CAGGGTTCAAAGCCTGTTACTGG - Intergenic
1144556305 17:16285849-16285871 CAGGGTCCAACAACTTCTGGGGG - Intronic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148417643 17:47519706-47519728 AAGGGGTCAAAAACTGATGTAGG - Intergenic
1151957963 17:77389828-77389850 CCGGGTTCTAAACCAGCTGCTGG - Intronic
1152799013 17:82322508-82322530 CTGGGTTCTGAAACTGCTGGAGG + Intronic
1153229071 18:2919852-2919874 CAGGGTCCCTGAACTGCTGCGGG - Exonic
1153992650 18:10414072-10414094 CACGGATGAATAACTGCTGCAGG + Intergenic
1159601068 18:70429357-70429379 CAGAGTTCAAAAGCTGAAGCGGG - Intergenic
1159768309 18:72517632-72517654 TAGGATTCTAAAACTGCTTCAGG - Intergenic
1162241411 19:9357699-9357721 CAGGGTTGGTAAACTGCTGAGGG - Intronic
1162266388 19:9578607-9578629 CAGTCTTCAATAAGTGCTGCTGG + Intronic
1163925858 19:20342844-20342866 CAGGATTAAAAAACTGTTACAGG + Intergenic
1165534304 19:36430484-36430506 GAAGATTCAAAAACTACTGCTGG - Intergenic
1165805338 19:38577381-38577403 CAGGTTTCTAAAACTGTTCCTGG - Intronic
1167123721 19:47534836-47534858 AAGTCTTCAAAAAATGCTGCTGG + Intronic
1167993100 19:53377451-53377473 CAGGTTTGAAAAACTGCGCCCGG + Intronic
926293745 2:11552322-11552344 CAGAGTTGAATAACTGCAGCAGG + Intronic
926819905 2:16840621-16840643 CACGCTACAAAAACTGCTGGGGG - Intergenic
928259973 2:29757864-29757886 CAGGGGTCAGAAACTGCAGCTGG - Intronic
928287995 2:30010072-30010094 CTGGCTTCAACCACTGCTGCAGG - Intergenic
928303897 2:30149759-30149781 CAAGGTACAAAGACTGCTGCAGG - Intronic
931762723 2:65431773-65431795 GAGAGGGCAAAAACTGCTGCGGG - Intronic
933873951 2:86599600-86599622 CAAGGTTCATAATCTGCTCCTGG - Intronic
935051684 2:99530082-99530104 CAGGGACCAAAAACTCCTGGAGG - Intergenic
935554799 2:104497874-104497896 CATGATTCAAAAACTGCTACAGG - Intergenic
939710408 2:145509906-145509928 CATGGTTCAAAGACTGTTCCTGG - Intergenic
942061005 2:172228724-172228746 CTTGGTTCAAAATATGCTGCCGG + Intergenic
942623100 2:177869433-177869455 CAGGATTCAACAAATGTTGCTGG - Intronic
944497570 2:200324021-200324043 AAGGGCTCAGAAACTGCTTCTGG + Intronic
946107426 2:217383789-217383811 CAGGGGTCAAACACTGCTCAAGG + Intronic
947997914 2:234544295-234544317 CAGGGTTCAGGAACAGCAGCGGG + Intergenic
1168928657 20:1603809-1603831 CAGGGCTCAAATACTGCTCCTGG - Intronic
1168940195 20:1704263-1704285 CAGTCTTCAAAAACTGGTGTTGG + Intergenic
1168969721 20:1922624-1922646 CAGGGCTCAAATACCGCCGCTGG + Exonic
1170443490 20:16401725-16401747 CAGGTTTAAACAGCTGCTGCAGG - Intronic
1172608626 20:36232540-36232562 CAGGATTCAAAAACTGAAACAGG - Exonic
1173243027 20:41314889-41314911 CAGGGCTCAGAAACTGCACCTGG - Intronic
1175687661 20:61043431-61043453 CTGGGATCAAAAACACCTGCAGG + Intergenic
1177914796 21:27075821-27075843 CAGGGATCAAAAGCAGGTGCAGG - Intergenic
1181844328 22:25694518-25694540 CAGGTTTCAAAAGCTGCAGAAGG - Intronic
1185249952 22:49795980-49796002 CAGGCTCCAAACAGTGCTGCTGG - Intronic
955184583 3:56702868-56702890 CAGAGTTCAAAGACTGCGGAAGG + Intergenic
957124176 3:76136377-76136399 CAGTGTTCAGAAATTGCTGTTGG + Intronic
957768615 3:84658777-84658799 GAGGGTGCAAAAGCTGCTGGTGG - Intergenic
958575927 3:95949935-95949957 CAGGGTCCAGGGACTGCTGCGGG - Intergenic
959741010 3:109719732-109719754 CAGTGTTCAAACTCTGCTCCTGG + Intergenic
960761641 3:121078648-121078670 CAGGGCTCAGAACCTGCAGCTGG - Intronic
960761646 3:121078672-121078694 CAGGGCTCAGAACCTGCAGCGGG - Intronic
967218174 3:187227681-187227703 CAGGGATCAAAAAATGCCCCAGG - Intronic
968621603 4:1605745-1605767 CAGGGTTTCAGAACTGCTGCGGG - Intergenic
970178007 4:13358779-13358801 CAGGGTTCAAAATCTGGTTCTGG + Intergenic
970581936 4:17481594-17481616 CAGGGTGCATGAAGTGCTGCTGG - Intronic
973981405 4:56311201-56311223 CAGGGTTCTTACACTCCTGCAGG - Intronic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
975645503 4:76542075-76542097 CAGGGATCAATAAATGCTGTTGG - Intronic
981762387 4:148208664-148208686 CAGAGTGCAGAAACTGCTGGTGG - Intronic
985499674 5:234874-234896 CAGGGATCACAGCCTGCTGCAGG - Intronic
985564670 5:609415-609437 CAGGCTTGAAAAACACCTGCAGG + Intergenic
986186784 5:5449727-5449749 CTGGTTTCAAAAACTGTTTCTGG + Intronic
986749397 5:10773026-10773048 CAGTATTTCAAAACTGCTGCAGG - Intergenic
988943768 5:36173567-36173589 CAAGGTTGAGAAACTGCTGTAGG + Intronic
989553659 5:42765669-42765691 CAGTCTTCAATAACTGGTGCTGG + Intronic
989830414 5:45910506-45910528 CAGTGTTTACAAACTGCTGAAGG - Intergenic
989943597 5:50187431-50187453 AAGGGTTTAAAAACTGCTCAAGG + Intergenic
990231153 5:53714268-53714290 CACTGTTCAATAACTGGTGCTGG + Intergenic
990952421 5:61311313-61311335 CAGGCTTGCTAAACTGCTGCAGG + Intergenic
991361546 5:65826192-65826214 AAGGGTTTAGAAACTTCTGCAGG + Exonic
992545617 5:77811587-77811609 CAGGGTCCAGGGACTGCTGCAGG + Intronic
992618346 5:78567889-78567911 CAGGGGTCAAGAACTGCTAGGGG + Intronic
992915109 5:81441886-81441908 ATGGGTTGAAAAACTGGTGCTGG + Intronic
995615394 5:113957253-113957275 CAGTCTTCAAAAAATGATGCTGG - Intergenic
1001003907 5:168032592-168032614 CAGAGGACAAAAACTGCTTCAGG - Intronic
1001557044 5:172643651-172643673 AAGGGCTCAAAAACTGGTGGTGG + Intronic
1003320948 6:5050502-5050524 CAGGCTCCAAAAACAGGTGCTGG - Intergenic
1005496296 6:26391006-26391028 CAGGGTTCATTAAGAGCTGCTGG - Intronic
1005813595 6:29533284-29533306 CAGGGTCCACAATCTGCTCCAGG + Intergenic
1006122693 6:31816788-31816810 CAAGGTGCAGAAGCTGCTGCAGG + Exonic
1006124556 6:31828982-31829004 CAAGGTGCAGAAGCTGCTGCAGG + Exonic
1006606840 6:35263593-35263615 CTGGGTTCTACAACTGCTGTGGG + Intronic
1007854435 6:44839999-44840021 CAGTAGTCAAAAACTGGTGCTGG - Intronic
1010552726 6:77242957-77242979 CAGTATTCAAAAAGTGCAGCAGG - Intergenic
1011814238 6:91169642-91169664 CAGGGCTCAACAACTCCTGGAGG + Intergenic
1012960069 6:105613212-105613234 CAGTTTTGAAAAACTGCTTCTGG + Intergenic
1013418234 6:109943706-109943728 CTGGGTTTACAAAGTGCTGCAGG + Intergenic
1013643840 6:112115920-112115942 CAGGGTTCCGGAACTGCTTCTGG + Exonic
1014727332 6:124987531-124987553 CAAGGTCCAAAAAATGCTGTTGG + Intronic
1015262022 6:131248695-131248717 CAGTGTTCAAAATTTGCTGTAGG + Intronic
1016530729 6:145055792-145055814 CTGGGTTCAAAAACTGTTTCAGG - Intergenic
1023926527 7:44673855-44673877 CAGGGGTCTCAAACTTCTGCCGG - Exonic
1024431414 7:49292255-49292277 CAGTGTTCAAAAGCTTCTGGAGG + Intergenic
1025526516 7:61819572-61819594 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025549892 7:62232128-62232150 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025579359 7:62692065-62692087 CAGGGTTTCTAAACTGCTGAAGG - Intergenic
1025579856 7:62698650-62698672 CAGGGTTTCCAAACTGCTGATGG + Intergenic
1025580683 7:62711979-62712001 CAGTGTTTAGAAACTGCTGAAGG + Intergenic
1028640277 7:93034673-93034695 CACTGTTCAAAAAATGGTGCTGG + Intergenic
1030526452 7:110660666-110660688 CAGGCAGCAAAAACTTCTGCTGG - Intergenic
1033482638 7:141757389-141757411 CAGGGCTGAGAAACTGCTCCAGG - Intronic
1036909235 8:12739979-12740001 CAGGGTACAAAAACATCTCCTGG + Intronic
1040435803 8:47390149-47390171 CAGCTTTCAAACACTGCTGATGG + Intronic
1041214016 8:55581923-55581945 CAGAGTTTACAAACTGCTTCAGG - Intergenic
1044118982 8:88370548-88370570 CAAGGTGCAAAAACCACTGCTGG - Intergenic
1045858411 8:106790297-106790319 CAGGGTTCAAGGACTGTTGTGGG + Intergenic
1049347154 8:142145158-142145180 CAGCAGTCAAAAACTGCTCCAGG - Intergenic
1050526281 9:6549468-6549490 CAGGGTTCTAAAGCTGCCTCAGG + Intronic
1055448461 9:76407350-76407372 GAGTGTTCAAGAAATGCTGCTGG - Intergenic
1055799302 9:80015471-80015493 CAGGGCTCAACAAGTGCTGTAGG + Intergenic
1056601427 9:88050178-88050200 CAGGGTGGAAAGACTGCTGCAGG - Intergenic
1057570778 9:96202823-96202845 CAGATTACAAAAACTGCTGGTGG + Intergenic
1058632425 9:107002902-107002924 CAAGTTTCAAATACTTCTGCAGG - Intronic
1203485841 Un_GL000224v1:53744-53766 CAAGATTCAAACTCTGCTGCAGG + Intergenic
1188463759 X:30455077-30455099 CAGGATTGAAAAATTTCTGCTGG - Intergenic
1189338935 X:40189604-40189626 CAGGGTTCAAACACTGGTAGCGG - Intergenic
1189611170 X:42737580-42737602 CAAGTTTTAAAAAATGCTGCTGG + Intergenic
1190989674 X:55533756-55533778 CTGGGTTCAATAAATGGTGCCGG - Intergenic
1192359968 X:70433203-70433225 CATGGTTCAAAACCTCCTGTTGG - Exonic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1196127506 X:112115141-112115163 CAGGGTCCAAAGACTGTTGTGGG - Intergenic
1201312210 Y:12607131-12607153 CAGGGTCCAGAAACTGTTGTGGG - Intergenic
1201378698 Y:13348940-13348962 CAGTGAACAGAAACTGCTGCTGG + Intronic