ID: 1195746068

View in Genome Browser
Species Human (GRCh38)
Location X:108119776-108119798
Sequence CCTCCTTCTCCTCACCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195746063_1195746068 -5 Left 1195746063 X:108119758-108119780 CCTTTTCCCTTTCCTTTTCCTCC 0: 1
1: 3
2: 79
3: 834
4: 4390
Right 1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG 0: 1
1: 0
2: 7
3: 38
4: 428
1195746062_1195746068 -2 Left 1195746062 X:108119755-108119777 CCTCCTTTTCCCTTTCCTTTTCC 0: 1
1: 4
2: 41
3: 413
4: 3015
Right 1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG 0: 1
1: 0
2: 7
3: 38
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195746068 Original CRISPR CCTCCTTCTCCTCACCATGC TGG Intronic
900083288 1:874965-874987 CCTCATTCTCTTCACCAGGTGGG + Intergenic
900685502 1:3945411-3945433 CTTCACTCTCCTCACCCTGCTGG + Intergenic
900948720 1:5845637-5845659 CCTCCCTCCCTGCACCATGCTGG + Intergenic
901174144 1:7286213-7286235 CCTGCTCCTCCTCACCCTTCAGG - Intronic
901780415 1:11590552-11590574 TCTCCTTCTCCTGGGCATGCCGG + Intergenic
902206383 1:14871176-14871198 CCTGCACCTCCTCACGATGCTGG + Intronic
902573090 1:17359401-17359423 CCGCCACCTCCTCACCATGTTGG - Exonic
902820018 1:18938034-18938056 CCGGCTTCTTCTCGCCATGCTGG - Intronic
903356261 1:22749654-22749676 CATCCTTCCCCTCTCCATCCTGG - Intronic
903684434 1:25120457-25120479 CCTCCTTCTCAGCACCAGGAAGG + Intergenic
904240684 1:29142837-29142859 CCTCCTTCTCTTCACTCTTCCGG + Intergenic
904888060 1:33756630-33756652 CCTGCTTCTACCTACCATGCTGG - Intronic
904950105 1:34230625-34230647 ACTCCTTCACCTCATGATGCAGG - Intergenic
905245861 1:36612814-36612836 CCTCCTTCCCCTCCCAGTGCTGG - Intergenic
905531946 1:38686984-38687006 CCTCCTTCTCCCCATCATAGGGG + Intergenic
907688482 1:56637807-56637829 CCTCCTTGTCCACACCACTCTGG + Intronic
908171536 1:61510037-61510059 CCTCCTCCACCTCTCCATTCTGG - Intergenic
908633251 1:66133815-66133837 CCTCCTACTCCCCACCTTCCAGG - Intronic
909568482 1:77081838-77081860 CCTTCTTCTCCTCACATTCCTGG - Intergenic
909691179 1:78409537-78409559 CCTGCTTCTCCTCATTAGGCGGG + Intronic
909763582 1:79325147-79325169 TCTCCTTCTCCTCAGCATGATGG + Intergenic
910047760 1:82938487-82938509 CCTCCTCCTCCTCACAATGCTGG - Intergenic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
911097094 1:94063639-94063661 ACTCCCTCGCCTCCCCATGCTGG - Intronic
912511060 1:110190389-110190411 CCTCTTTCCCCTCAGCATGGGGG + Intronic
912558760 1:110535286-110535308 CCCCCTTCTCTCCAGCATGCAGG + Intergenic
912625025 1:111199527-111199549 CCTCCTTCTCCCTACCCTACCGG - Intronic
912953099 1:114134123-114134145 TTTCCTTCTGCTCAGCATGCGGG + Intronic
913547549 1:119884475-119884497 CTTCCTTCTCCACCCCAGGCTGG + Intergenic
915570719 1:156743824-156743846 CCTCCTTCTCCTCTCCTTCAGGG + Exonic
915895522 1:159808604-159808626 CCCCCCTCTCCCCACCATGGGGG + Intronic
915920758 1:159973616-159973638 CCCCCATCTCCCCACCATGGGGG - Intergenic
917055702 1:170978750-170978772 AGTCCTTCTCCTCACCAGACAGG - Intronic
917225369 1:172775902-172775924 CCTCCTCCTCTTCTCCAAGCGGG - Intergenic
919231478 1:194779948-194779970 CCTATTCCTCCTCACCAGGCGGG + Intergenic
919453647 1:197799481-197799503 CCTCCAACTCTTCACCAGGCAGG - Intergenic
919974474 1:202601892-202601914 CCTCCTTTTCCCCGCCTTGCAGG + Exonic
921051230 1:211513272-211513294 CATGCTGCTTCTCACCATGCAGG + Intergenic
922030210 1:221790425-221790447 CCTCTGCCTCCCCACCATGCAGG + Intergenic
922465884 1:225845440-225845462 CCTCCGTCCCCTGCCCATGCTGG + Exonic
923838234 1:237639083-237639105 CCACCTTCTCCTCTCAAAGCAGG - Exonic
924243457 1:242060848-242060870 CCAGCTACTCCTCACCATGATGG + Intergenic
1064943556 10:20761937-20761959 CCTCCTTCTCCACACTACTCTGG + Intergenic
1066460377 10:35607951-35607973 CCTCCTCCTCCGGACCCTGCTGG + Exonic
1067055021 10:43045225-43045247 CCTCCTTCCCCTCCCACTGCAGG + Intergenic
1067470636 10:46535520-46535542 CCTCTTTCTCCTCCCCATCAAGG + Intergenic
1067725974 10:48771335-48771357 CCACCATCTCCTCTCCACGCGGG - Intronic
1068674946 10:59761160-59761182 CCCCATTCTCCCCACCAGGCTGG + Intergenic
1069808063 10:71138292-71138314 CCTGCTTCTCCTCCCTCTGCCGG + Intergenic
1069832133 10:71287854-71287876 GCACCTTCTGCTCCCCATGCTGG - Intronic
1069916744 10:71791241-71791263 CCACCTGCTCATCACCATCCTGG + Intronic
1070279410 10:75037850-75037872 CATCCTCCTCCTCACCGTCCTGG + Exonic
1071281298 10:84106456-84106478 CTGCATTATCCTCACCATGCTGG + Intergenic
1071503944 10:86221907-86221929 CCTCCTCCTCCTCACCCGGAAGG + Intronic
1072617998 10:97062577-97062599 CCGACTCCTCCTCACCCTGCAGG - Intronic
1073002017 10:100292982-100293004 TCTCCTGCTCCCCACCCTGCAGG + Exonic
1075377954 10:121994677-121994699 TCTCCTCCTCCTCTCCACGCTGG + Intronic
1075433790 10:122416114-122416136 CCTGACTCTCCTCAGCATGCCGG - Intronic
1075870972 10:125772746-125772768 CCTCCTCCCCCTCGCCAGGCCGG - Exonic
1076255557 10:129021831-129021853 GCTCCTTTTCCTCACCAGACTGG - Intergenic
1076369048 10:129940224-129940246 CCTCCTCCTCCTCACCTTGCAGG + Intronic
1076599166 10:131645964-131645986 GCTCCTTTTCCTCACCTGGCTGG + Intergenic
1076620797 10:131786123-131786145 CCTGCTTCTGCACACCAGGCAGG + Intergenic
1076650105 10:131981746-131981768 CCTCCTCCGCCTCACCCTGCAGG + Exonic
1076739991 10:132478263-132478285 CCTCCTGCTCCTCACCCTGCTGG + Intergenic
1077364435 11:2155863-2155885 CCTCCCTCTCCTCACGGCGCTGG + Intronic
1078087845 11:8244855-8244877 CCACCTTCTGCTCACCTTCCTGG + Intronic
1078286632 11:9962708-9962730 CCTCCTTCAGTTCACCATGTAGG + Intronic
1079464725 11:20718759-20718781 CCTCGTTCTCCTCATCGTACTGG - Intronic
1079727729 11:23897067-23897089 TCTCCCTCTCTTCACCATGTAGG - Intergenic
1080547934 11:33339964-33339986 CCTCCTTTTCTTCAAAATGCAGG - Intronic
1081411720 11:42766546-42766568 CCTCCTTATCATCACCATCATGG + Intergenic
1081805148 11:45886196-45886218 CCTCCTTCTCCCCAACCTCCGGG + Intronic
1081862052 11:46338950-46338972 CCTCCATCTCCACACCTTACAGG - Intronic
1083573378 11:63771876-63771898 CCTCCTCCTCCTCACTCAGCTGG - Intergenic
1083573409 11:63772022-63772044 CCTCCTTCTCTTCACTCAGCTGG - Intergenic
1083573417 11:63772071-63772093 CCTCCTTCTCTTCACTCAGCTGG - Intergenic
1083573425 11:63772120-63772142 CCTCCTTCTCTTCACTCAGCTGG - Intergenic
1083900784 11:65642302-65642324 CCTCCTTCTCCTCCCGCCGCAGG - Exonic
1084270935 11:68028808-68028830 CCTCCCTCTTCTCTCCAGGCAGG + Exonic
1085054191 11:73394522-73394544 CCACCATCTCCACACCGTGCAGG + Exonic
1085256607 11:75177115-75177137 CCTCCTCCTCCTCCCTATGGTGG - Intronic
1085279648 11:75321426-75321448 TCTCCTTCTTCTCTCCCTGCTGG + Intronic
1085803688 11:79614838-79614860 CTTGCTTCTCCTCACCATTTTGG + Intergenic
1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG + Intergenic
1088817928 11:113434040-113434062 CCTCCTCCTTCTCACCCTTCAGG + Intronic
1089776042 11:120836769-120836791 TCTCCTTCTCTTCGCCTTGCAGG + Exonic
1089984773 11:122803051-122803073 CATCCTTCTGCTCACACTGCTGG - Intronic
1090091108 11:123698814-123698836 CCTCCTTCCCTTCCCCATTCCGG - Intergenic
1090228925 11:125088097-125088119 CCCCCCTCTCCTCTTCATGCAGG + Exonic
1090637312 11:128697966-128697988 CACGCTTCTCCTCACCATCCTGG - Intronic
1090842580 11:130505479-130505501 CCTCTTTCTCCTCTCCTTTCAGG + Intergenic
1090938389 11:131365668-131365690 CCTCCTCCTCCTCCTCATGGTGG + Intergenic
1091155319 11:133366575-133366597 CCTTCTTCTCCCCATCATGAAGG - Intronic
1092441395 12:8508342-8508364 CCTGCTGCTCTTCACCAGGCAGG - Intergenic
1092441556 12:8509183-8509205 CCTGCTACTCCTCACTAGGCAGG - Intergenic
1093781776 12:23145759-23145781 CCTCCATCACATCACCATGATGG - Intergenic
1095698347 12:45165374-45165396 CCTGCTTCTCCTCACTGGGCAGG - Intergenic
1095891408 12:47237798-47237820 TCTCTTTCTCCTGACTATGCTGG - Intergenic
1096146797 12:49284101-49284123 CCTCCTTCTCATCATCTTCCAGG + Intergenic
1096542617 12:52316578-52316600 CCTTCATCTCCTCACACTGCAGG + Exonic
1097070911 12:56354297-56354319 GCTCCTCATCCTCACCACGCAGG - Intronic
1097173951 12:57132183-57132205 CTTCCTTCTCCAAACAATGCAGG - Intronic
1097718431 12:62993838-62993860 CTACTTTCTCCTCACCTTGCTGG + Intergenic
1099147409 12:79064022-79064044 CCTCCTTATCCCTACCATTCCGG + Intronic
1099576522 12:84390588-84390610 CCTCCTTCACCTCATCCAGCAGG - Intergenic
1101359682 12:104014578-104014600 CCTCTTTCTCCTCTCCCTGCTGG - Intronic
1101997978 12:109538698-109538720 CCAGCATCTCCTCACCCTGCTGG - Intergenic
1103253951 12:119524152-119524174 CCACCTTCTCATCACACTGCTGG - Intronic
1103331561 12:120157935-120157957 CCTCCTCCTCCTCACTGTGGTGG + Exonic
1103804171 12:123559572-123559594 CCTCCTGCCCCTAACCATGGTGG - Intergenic
1104355281 12:128079733-128079755 CCTCCTGCTCCCCATCATTCTGG - Intergenic
1104646706 12:130502555-130502577 CCTCCCTCTGCTCAACATGTAGG + Intronic
1104900049 12:132184741-132184763 CCTGCTTCTCTCCACCCTGCAGG + Intergenic
1105705002 13:22963188-22963210 TCTACTCCTCCTCACCATCCTGG - Intergenic
1106317677 13:28609324-28609346 ACTCCCTCTCCTCACCCTGTAGG + Intergenic
1107132982 13:36916393-36916415 CCTCCTTCTCCTGAACATTGTGG - Intronic
1110060572 13:71033649-71033671 CGTCCTACTCTTCACCAGGCAGG + Intergenic
1110060615 13:71033927-71033949 CCTCCTGTTCTTCACCAAGCAGG + Intergenic
1110672756 13:78201027-78201049 CCTTTTTCTCCCCACCATTCTGG + Intergenic
1111253374 13:85635181-85635203 ACTCCTACTCCTCAACATGATGG - Intergenic
1111420117 13:88000332-88000354 CCCCCTGCTCTTCACCAGGCAGG - Intergenic
1113933436 13:113980813-113980835 CCTCCTTCCTTCCACCATGCGGG - Intronic
1114330773 14:21634680-21634702 GCTCATTCTGCTCACCATGTGGG - Exonic
1116028215 14:39538659-39538681 CCCCCTGCTCATCACCAAGCAGG + Intergenic
1117791999 14:59351038-59351060 TCACCTTCTCCTCCCCATCCCGG + Intronic
1117836607 14:59814255-59814277 CTTCCTGCTCTTGACCATGCTGG - Intronic
1118328939 14:64801102-64801124 CCTGCTTCTCTGCTCCATGCTGG - Intronic
1118492284 14:66272892-66272914 CCTCCTTCTCTTCTCCTGGCTGG + Intergenic
1121885971 14:97542952-97542974 CCTCCTTCTCCTCGAGCTGCTGG + Intergenic
1122416758 14:101553489-101553511 CCTCCCTTCCCTCACCAGGCAGG + Intergenic
1122838594 14:104443476-104443498 CCTCCTCCTCCCCACCCAGCAGG + Intergenic
1122935680 14:104954956-104954978 CCTCCTTCTCCTTGCCCTGTGGG + Exonic
1123466090 15:20517086-20517108 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1123652024 15:22483953-22483975 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123705357 15:22947313-22947335 CCTCCTTCTCCTCACAGAACAGG - Intronic
1123742444 15:23292813-23292835 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123760881 15:23431673-23431695 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1123888086 15:24747909-24747931 CTCCCTTCTGCTCACCAAGCTGG - Intergenic
1124179074 15:27456384-27456406 TCACCTTCTGCACACCATGCTGG - Intronic
1124276814 15:28333062-28333084 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1124305886 15:28578544-28578566 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1125067719 15:35510327-35510349 CCACCTTCTAATCACTATGCAGG + Intronic
1125502494 15:40248298-40248320 CTTCCTGCTCCTCACCCTGATGG - Intronic
1126683534 15:51226771-51226793 CCCCCTTAACCTCATCATGCTGG - Intronic
1126888301 15:53176044-53176066 CTTCCATCACCACACCATGCTGG - Intergenic
1127439103 15:58988132-58988154 CCTCTTTCTCCCCTCCAGGCCGG - Intronic
1128577241 15:68784403-68784425 CATCCTCCTCCTCATCATCCAGG + Exonic
1128757280 15:70191574-70191596 CCGCCTCCTCCTGGCCATGCTGG - Intergenic
1129624148 15:77179279-77179301 ACTTCTTCTCCTTACCATGCAGG - Exonic
1130950590 15:88583879-88583901 ACTCATTCTACTCACCAAGCTGG - Intergenic
1131035906 15:89221879-89221901 CCTCTTTCTCCTCAAGATCCCGG + Intergenic
1132317309 15:100899486-100899508 CCTCCTTCTCCTCATCAGGGCGG + Intronic
1132363719 15:101240270-101240292 CCTCCTCCTCCTCAGGATGGTGG - Intronic
1132518740 16:377843-377865 CCTCCTTCTCCTCACAGAGGTGG - Exonic
1132774492 16:1585012-1585034 CTTCCTTCACTTCACCAGGCTGG - Intronic
1133465082 16:6020397-6020419 CCTCCTCCTGCACACCCTGCGGG - Intronic
1136032750 16:27515488-27515510 CCTTCTTCTCCCCACCAAGTTGG + Intronic
1136136027 16:28257471-28257493 CCTCCTCCTCCTCCTCCTGCAGG + Intergenic
1136143727 16:28303126-28303148 CCTCCCTCTGCTCAACACGCTGG - Intronic
1136157348 16:28392033-28392055 CCTCCTCCTCCTCCTCATCCAGG + Exonic
1137436100 16:48455448-48455470 CCTCCTTCTCCTTCTCAAGCAGG - Intergenic
1137462790 16:48680533-48680555 CTTCCTTCTGCTCCCAATGCTGG + Intergenic
1137504487 16:49041282-49041304 CCTCCTTCCCCTCACTATTCTGG - Intergenic
1137601074 16:49756684-49756706 CCACCTCCTCCTTTCCATGCAGG - Intronic
1137617504 16:49856246-49856268 CCTCCTCCTCCGCCCCTTGCCGG + Intronic
1137770774 16:51014244-51014266 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770805 16:51014361-51014383 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770816 16:51014401-51014423 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770836 16:51014478-51014500 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770866 16:51014595-51014617 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770896 16:51014712-51014734 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770936 16:51014869-51014891 CCTCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770955 16:51014949-51014971 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1137770966 16:51014989-51015011 CCCCCTTCTCCTCCCTAGGCAGG + Intergenic
1138343978 16:56308800-56308822 CCTCCCTCTCCACTCCATGAGGG - Intronic
1139216978 16:65135617-65135639 CCTCCATCTTTTCCCCATGCTGG + Intergenic
1139410724 16:66758251-66758273 CCTCCTGCTCCTTCCCCTGCTGG + Intronic
1139480484 16:67227771-67227793 CCTCATTCTCCCCACCAGCCTGG - Intronic
1140754635 16:78056377-78056399 CCTGGTTCTCCTCAGCAAGCTGG - Intronic
1141430776 16:83969218-83969240 CCGCCTCCTCCTCTCCATCCCGG + Intronic
1141484056 16:84327024-84327046 CCTCCTGCTCCTCAACCTGGTGG - Intronic
1142415163 16:89937141-89937163 CCTTCTGCTCCTCACAATGTTGG + Intergenic
1203116079 16_KI270728v1_random:1491847-1491869 CCTCCTGGTGCTCACCCTGCAGG - Intergenic
1143515441 17:7417346-7417368 CCTCCTCTTCCTCAACATCCTGG + Exonic
1143640005 17:8190343-8190365 CCTCCTTCTCTCCACCCTGCCGG - Exonic
1143719792 17:8801441-8801463 CCTCCCTCACTGCACCATGCTGG + Intergenic
1144088232 17:11830021-11830043 CCTCCTTCTCCTCTCTGTGGTGG + Intronic
1144409464 17:14986509-14986531 CCTCCTGCCCCTCATGATGCTGG + Intergenic
1144453090 17:15397405-15397427 CCTCAGTCTCCTGACCAAGCTGG - Intergenic
1146543518 17:33718554-33718576 CCTCCATCTCTGCACCATGTGGG - Intronic
1147998428 17:44374371-44374393 CCTGCTGCTGCTCACCATCCTGG - Exonic
1148150525 17:45394352-45394374 CCTCCTTCCCCACACCCTGCAGG + Exonic
1148213987 17:45824601-45824623 CTTCCTTGTCCTAACCCTGCTGG - Intronic
1148325293 17:46779730-46779752 CTGCCTTGTGCTCACCATGCAGG - Intronic
1149761885 17:59239065-59239087 CTTCTTTCTCCTTACCATTCCGG - Intronic
1149992062 17:61388822-61388844 CCTTCTGCTCCTCCCCCTGCAGG - Intronic
1151605132 17:75131098-75131120 CGTCCTTCTCCGCAGCACGCAGG - Exonic
1152222649 17:79077490-79077512 CCTCTGTCTCCTCACCTGGCAGG - Exonic
1154283243 18:13027289-13027311 CCCCTTTCTCCTCCCCATACTGG + Intronic
1154399245 18:14019713-14019735 CCTCCTTCACTTCAACTTGCCGG - Intergenic
1155237632 18:23836831-23836853 CCTTCTTCAACTCATCATGCAGG + Intronic
1156193904 18:34751364-34751386 CTTCCTTCCACTCACCATGCTGG + Intronic
1156922978 18:42545188-42545210 CCTCCTCCTCCTGAAAATGCTGG + Intergenic
1157286895 18:46383067-46383089 CTGCCTTCTTCTCAGCATGCTGG + Intronic
1157697423 18:49733885-49733907 CCTGGTTCTCCACCCCATGCAGG - Intergenic
1158170028 18:54587210-54587232 CCTCCTTATTCTCATCGTGCTGG - Intergenic
1158208407 18:55020069-55020091 CCTCCTTTTTCTCCCCATGGAGG - Intergenic
1160184017 18:76660702-76660724 CCTGCTCCTCCTCCCCATTCTGG - Intergenic
1160251990 18:77210696-77210718 CCTTCTTCTTCACACCCTGCAGG + Intergenic
1160255962 18:77249553-77249575 CCTCCTCCTCCTCCCCAGGGTGG - Intergenic
1160396422 18:78575669-78575691 CTTCCTTCTCTCCAGCATGCTGG - Intergenic
1161433724 19:4249471-4249493 CCTCCTTCGCCTCACCACTTGGG + Intronic
1163366296 19:16877822-16877844 CCTCCTACACCTCACCGTCCTGG - Intronic
1163772026 19:19197066-19197088 CCTCCTACTCCTCTCCTTGTTGG - Intronic
1164719162 19:30419686-30419708 CCTCCTGCTCCTCACACTGCTGG - Intronic
1165399386 19:35588209-35588231 CCACCTTCTTCTCACTAGGCTGG - Intergenic
1168046199 19:53796025-53796047 ACTCCTTATCTTCACCAGGCTGG - Exonic
1168099411 19:54133356-54133378 GCTCCTTCTGCTCACCTGGCAGG - Intergenic
1168567189 19:57435143-57435165 CCTGCCTCGCCTCACAATGCTGG - Intronic
924960335 2:29013-29035 CTTCCTTCTCCTCACAGTGAGGG - Intergenic
925051119 2:816439-816461 CACCCTCCTCCTCACCATGCAGG - Intergenic
927096380 2:19750498-19750520 CCTCCTTCTCCTCTGCATCCCGG - Intergenic
927845576 2:26470706-26470728 CCTTCTCCTCCTCAGCCTGCAGG + Exonic
928076443 2:28269279-28269301 CCCCCTTCTCCTCTCCATCTTGG + Intronic
928432022 2:31228050-31228072 CTTCCTGCTCCTCACCACGCGGG - Intronic
929961233 2:46497802-46497824 CTTCCCTCTCCTCACCAGCCAGG - Intronic
930051299 2:47218201-47218223 CCTCCAGCTCCTCCTCATGCAGG + Intergenic
930839178 2:55826301-55826323 CCTCCTGCTCATCACCAGGGAGG + Intergenic
932486218 2:72085836-72085858 TCTCCTGCTCCTGACCATGTGGG - Intergenic
932501152 2:72183719-72183741 CCTCATTCTGTTCACCAGGCTGG + Intronic
933051857 2:77611042-77611064 CCTGCTGCTCATCACCAGGCAGG + Intergenic
933353714 2:81189576-81189598 CCTCCTCCTACTCACCTTGTGGG - Intergenic
935814832 2:106837917-106837939 CCTCCCTGCCCTCTCCATGCAGG - Intronic
936118129 2:109718789-109718811 TCTCAATCTCCTCACCATGTTGG - Intergenic
937032510 2:118752607-118752629 CCTCCTCCTCCTCCACATGCTGG - Intergenic
937397225 2:121547394-121547416 CCCCCTACTCTTCACCAGGCAGG + Intronic
937669089 2:124519481-124519503 GCTCCTTTTGCTCATCATGCTGG - Intronic
939410889 2:141823356-141823378 CCTCCTCATCCTCACTGTGCTGG - Intronic
940089659 2:149901268-149901290 CCTCCTTCTCCTCCCCAACTGGG - Intergenic
940496214 2:154432426-154432448 CCTCCTTTTCCTCCTCATGCTGG - Intronic
940635273 2:156291696-156291718 CCTCCTTCTCTCCACCATCAAGG + Intergenic
940718867 2:157259423-157259445 CCTCCTTCTCCTTTCCATGGGGG - Exonic
940855893 2:158728512-158728534 GCTCTGTCTCCTCCCCATGCCGG - Intergenic
941209642 2:162621429-162621451 CCTCTTTCTCTTCCCCATGTTGG - Intronic
942023842 2:171894005-171894027 CCTCCTTCCCCTCCCCCAGCCGG + Intronic
944432268 2:199646084-199646106 CCTCCACCTCCTCCCCAAGCAGG + Intergenic
944811144 2:203328481-203328503 CCTCCTCCTCCTCCTCATACAGG - Exonic
945347238 2:208732535-208732557 CCTCCTTCTCTTCAGCAATCTGG - Intronic
945347861 2:208739758-208739780 CCACATTCTCCTCACCAAGTTGG + Intronic
945823986 2:214698080-214698102 CCTCCTACTCCTCACCCCACTGG + Intergenic
946011218 2:216565139-216565161 ACCCCTTCCCCTCCCCATGCAGG - Intronic
946156213 2:217808333-217808355 TCTGCTTCTCCTCTCCATGATGG - Intronic
946182963 2:217959994-217960016 CCTCCTCCTCCTCCTCCTGCCGG - Intronic
946227621 2:218272597-218272619 CCTCTTCATCCTCACCAAGCGGG + Intronic
1168980275 20:1997950-1997972 CCTCTTTGTCCTCACAATCCAGG + Intergenic
1169130554 20:3164501-3164523 CCTTCTTCTCCTCGCCATGCTGG + Exonic
1169382187 20:5117864-5117886 CCTCCTCCTCCTCATCCTCCAGG + Intronic
1169414114 20:5401245-5401267 CCTCCTGCTCCATTCCATGCTGG + Intergenic
1170027120 20:11901165-11901187 CCTCCTTCTGCTCAGGATGCAGG + Intronic
1170282483 20:14666118-14666140 CCTCCTGCTCCTCCCCTTGAGGG + Intronic
1170538233 20:17362888-17362910 TGTCCTTGTCCTCACCATGTGGG - Intronic
1170624981 20:18023463-18023485 CCTCCATCTCCTCACCTTGGAGG - Intronic
1171267239 20:23781797-23781819 GCTCCTACTCCTCACCTTTCAGG - Intergenic
1171274904 20:23848199-23848221 GCTCCTACTCCTCACCTTTCTGG - Intergenic
1171401086 20:24873357-24873379 CCTCCTTCCCCGCAGCCTGCGGG - Intergenic
1172511388 20:35503559-35503581 CCTCCTTCTCCTTATCACGCAGG - Exonic
1172776369 20:37409543-37409565 CATCCTGATCCCCACCATGCAGG + Intergenic
1173294936 20:41748053-41748075 CTTACTGCTCCTCACCAGGCAGG - Intergenic
1173522423 20:43709822-43709844 CATCCCTCTCCCCACCCTGCAGG - Intronic
1173581965 20:44153523-44153545 CCTCCATCTCCTCCCCATGCTGG - Intronic
1173780077 20:45748582-45748604 CCTCCTTCTCCACTCCATAGAGG - Intronic
1173821541 20:46022935-46022957 CCTCCTCCTCCTCCCCTCGCTGG - Intronic
1174340539 20:49892463-49892485 TCAGCTTCTCCTCACGATGCTGG + Intergenic
1174357873 20:50010232-50010254 CCTCCTGCTCCTCCACCTGCCGG - Intergenic
1175615290 20:60393179-60393201 CCACCTTCCTCTCACCTTGCTGG + Intergenic
1177393772 21:20507983-20508005 CTTGCTGCTCCTCACCAGGCAGG - Intergenic
1178259673 21:31087485-31087507 CCTCCTCCTCCTCTCATTGCTGG + Intergenic
1178814276 21:35913161-35913183 GCTCCTTCTCCTCTCCCTTCAGG - Intronic
1179142732 21:38741205-38741227 CCTCCTTCTTTCCACCCTGCTGG + Intergenic
1179239640 21:39578745-39578767 CATCCTTCCTCTCAACATGCAGG - Intronic
1181090555 22:20469596-20469618 ACTCCATCTACTCACCATGCAGG + Intronic
1181150724 22:20881357-20881379 CCTTGTTCTCCTCTCCATGGAGG - Intronic
1181596895 22:23921440-23921462 CCTCCTTCTCCTAAAGGTGCTGG + Intergenic
1181966426 22:26659140-26659162 CCTCCTCATCCTCATCCTGCAGG + Intergenic
1182055632 22:27352411-27352433 CCTCTCCCTCCACACCATGCTGG + Intergenic
1182263447 22:29093082-29093104 CCTCCTTCCTCTGACCATCCAGG - Intronic
1182336218 22:29585313-29585335 CCTCATTCTCCTCACCTGGGAGG - Intergenic
1183279850 22:36926170-36926192 CCCCCAGCCCCTCACCATGCTGG - Exonic
1183283836 22:36950514-36950536 CCCCCTGTCCCTCACCATGCTGG + Intergenic
1184150013 22:42632254-42632276 ACTCCCTCTCCTGGCCATGCTGG - Intronic
1184776305 22:46625221-46625243 CTCCCCTCCCCTCACCATGCTGG + Intronic
1184960924 22:47927895-47927917 CGTCATTCTCCTCACCACGGTGG + Intergenic
1185017099 22:48351220-48351242 CCTCCTGGTCCACGCCATGCTGG + Intergenic
1185282563 22:49981134-49981156 CCTCTTTATCAACACCATGCTGG + Intergenic
949394113 3:3596612-3596634 CCTCCTTCTCTTCTTCAGGCTGG + Intergenic
950187942 3:10956922-10956944 CCTCCCTCTCCTCATCTTTCAGG + Intergenic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
950618092 3:14178466-14178488 CCTCCTCCTCCTCCTCACGCCGG + Exonic
950798493 3:15530657-15530679 CCTCCTTCTCCCCAGCCTCCAGG + Intergenic
952378394 3:32785586-32785608 TCTCCCTCTCTTCACCAGGCTGG - Intergenic
953371343 3:42391094-42391116 CTTCTTTATCCTCACAATGCTGG - Intergenic
953607007 3:44418855-44418877 CCTCCATCTCCTCATCTTTCAGG + Intergenic
953664749 3:44917729-44917751 CCTCCTTCTTCTCTCCATGTTGG - Intronic
953886705 3:46718081-46718103 CCTCCCTCTCCTCACTCCGCTGG + Exonic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954445416 3:50543742-50543764 CCTCCTTTTCCTCAACCTCCAGG + Intergenic
954563543 3:51579127-51579149 CCTGCTTCTCCTCTCTCTGCAGG + Intronic
954615396 3:51966742-51966764 CCTCCCTCTCCTGGCCAGGCAGG + Intronic
954943015 3:54392594-54392616 CCTCCTGGTCCTCACCAAGCTGG + Intronic
955864451 3:63368093-63368115 CCTCCTTCTAAACATCATGCAGG - Intronic
956114514 3:65904753-65904775 CCTCCCTCTCCTCACTAGACTGG + Intronic
956122056 3:65976377-65976399 CCTCCGTCTCCCCACAGTGCTGG - Intronic
958097922 3:88971602-88971624 ACTCCTACTCCACACCATTCAGG + Intergenic
960341996 3:116486020-116486042 CCTGCTTCTCCTCACTAGGTAGG + Intronic
961413555 3:126741214-126741236 CCGCCTGCCCCTCACCTTGCAGG - Intronic
961486005 3:127217000-127217022 CCGCCTTCTCTCCACCATCCCGG + Intergenic
962084199 3:132173525-132173547 TCTGCTGCTCCTCACCAGGCAGG + Intronic
962640129 3:137377144-137377166 CCTCCCTCCCCCCACCAAGCTGG + Intergenic
963069849 3:141294241-141294263 CCTCCTTCTAACCACCAAGCAGG - Exonic
963121437 3:141780188-141780210 ACTCCTTCACCTCACTAGGCAGG - Intronic
964336097 3:155655712-155655734 CCCCCTTCTCTTTTCCATGCAGG - Intronic
968426814 4:529119-529141 CCTCCTCCTCCTCCCCTGGCCGG - Intronic
968876325 4:3269647-3269669 CCTCCTGCTCCTCCTCCTGCAGG + Intronic
969500474 4:7549530-7549552 CCTCCTTCCCCTTAACCTGCTGG + Intronic
969890633 4:10256711-10256733 CCTCCTTCTCCCCAATATGGTGG - Intergenic
970263149 4:14250923-14250945 CCTCATTGTTCTCACCATGTTGG - Intergenic
970346902 4:15161052-15161074 CCATCTTCTCCTCACAAAGCAGG - Intergenic
970821079 4:20214930-20214952 CCTCATGCTCCTTAACATGCAGG - Intergenic
973802611 4:54493938-54493960 CTTCCTTCTCCTCACCAAGAAGG + Intergenic
974094717 4:57350903-57350925 CCTTCTGCTCATCACCAGGCAGG - Intergenic
975124995 4:70771988-70772010 CCTCCTCCTCCTCATCAATCTGG - Intronic
975362953 4:73493179-73493201 CCACCTACCTCTCACCATGCTGG - Intronic
976017019 4:80568687-80568709 CTTCTTTCTCCTCTCCATACAGG - Intronic
977791951 4:101115265-101115287 CCTCTTTGTCCTCAATATGCTGG - Intronic
978414261 4:108458963-108458985 CATCCTTCTACACTCCATGCTGG - Intergenic
980135797 4:128857491-128857513 CATCCTGCTCCCCACCACGCAGG - Intronic
981102641 4:140846941-140846963 CCTCTTACTCCACACAATGCTGG - Intergenic
981135542 4:141206990-141207012 CTGCCTTCTTCTTACCATGCTGG - Intronic
983547629 4:168979689-168979711 CCGCCTACTCTTCACCATGTAGG + Intronic
983907740 4:173202448-173202470 CCTCCTCCTCCTCCCCATTTCGG - Intronic
984934578 4:184879029-184879051 CCAGCTCCTCCTCACCTTGCAGG + Intergenic
985639185 5:1055600-1055622 CCACCTTCTCCTGACCCTACAGG + Intronic
986480415 5:8181029-8181051 CTTCCTCCTCCTCACCAGGTGGG + Intergenic
988494372 5:31732494-31732516 CCTCCTTCTGCTCAGCCTTCTGG - Intronic
988919767 5:35929536-35929558 CCACCTTGGCCTCACAATGCTGG + Intronic
989176618 5:38533808-38533830 CCTCCTTCTGCACACAAGGCTGG - Intronic
993739897 5:91525644-91525666 ACTCCTTTTCCTCACAATGTTGG - Intergenic
994090820 5:95808291-95808313 CCTAGTTCTCCTCTCCATCCAGG - Intronic
995319066 5:110810996-110811018 CCTCCCCCTGCCCACCATGCTGG - Intergenic
995486181 5:112642202-112642224 CCCTCTTCTCTTCACCATGTAGG - Intergenic
995774833 5:115713586-115713608 CCTCCCTCTTCATACCATGCTGG + Intergenic
997666403 5:135632935-135632957 GCTCATTTTCCTCACCCTGCCGG - Intergenic
998199424 5:140107860-140107882 CCTCCTCCTCCTTCCCCTGCGGG - Intronic
999315703 5:150582562-150582584 CCTCCTTCTCCTCAGCAGCTGGG + Intergenic
999536555 5:152523736-152523758 CCTCCTGCTCCTCTCCAACCGGG - Intergenic
999684264 5:154088426-154088448 CCTCCTTCTCCACACCAGAAGGG + Intronic
999710278 5:154312306-154312328 CCTCCTTCTCCACACCTTTCAGG + Intronic
999775008 5:154805140-154805162 CCTCCCTCTCCCCACCAAGTAGG - Intronic
999931646 5:156439522-156439544 CCCCCTACTCCCCACCATGGTGG + Intronic
1000225483 5:159257044-159257066 CCTCTTTCTCCTCTCCTTCCAGG - Intergenic
1000505062 5:162106333-162106355 TCTCCCACTCCTCACCCTGCTGG + Intronic
1001479973 5:172081897-172081919 CCTCCTCCTCCTCCCCATGTTGG - Intronic
1002386936 5:178875405-178875427 CCTCCTGCTCCTCACCAGGCAGG - Intronic
1002451267 5:179320122-179320144 CCTCCCTTCCCTCACCAGGCAGG - Intronic
1002804978 6:564630-564652 CCTGCTTCCCCTCAGCATCCGGG - Exonic
1007286805 6:40753720-40753742 CCTCCCTCTCTCCACCATCCTGG - Intergenic
1007429602 6:41769081-41769103 CCTCCTCCTCCTCCTCTTGCTGG - Intergenic
1007777253 6:44230658-44230680 CCTCCATTTACTCACCAGGCGGG - Exonic
1008786589 6:55175345-55175367 CCTCCGTCTCCACTCCCTGCTGG - Intronic
1009888845 6:69656308-69656330 CCCCTATCTCCTCACCAGGCAGG + Intergenic
1009946581 6:70347696-70347718 CCTGCTTCTCCTCACTGGGCAGG - Intergenic
1011277362 6:85643519-85643541 CCTCCCTCTCCCCTCCAGGCGGG + Intronic
1012510560 6:99996388-99996410 CCTCATTCTCATCAGCATGAGGG - Intergenic
1014892257 6:126856873-126856895 CCTGCTTCTCCCCTCCATACAGG + Intergenic
1015341103 6:132101836-132101858 CCTCCTCCTCCTCTCCCTGCAGG + Intergenic
1016288387 6:142500336-142500358 CCTCCTTCCCATCACCTGGCCGG + Intergenic
1016289012 6:142507122-142507144 CCCCCTACTCCTCACCAGGCTGG - Intergenic
1016918877 6:149271735-149271757 CCTCCATTTCCTCTCTATGCTGG - Intronic
1016941081 6:149483100-149483122 CAACTTTCTCCTCACCATGGTGG - Intronic
1017587436 6:155942754-155942776 CCTCCTTCTTCTTACCATTTGGG - Intergenic
1018095820 6:160386286-160386308 CTTCCTTCACCTAACCATGAAGG - Intronic
1018146914 6:160900223-160900245 CCTGCTACTCTTCACCAGGCAGG + Intergenic
1018889892 6:167976233-167976255 CCTCCTTCCCCACACACTGCAGG - Intergenic
1019551840 7:1606931-1606953 CCTCCTCCTCCTCTTCGTGCCGG + Intergenic
1020269101 7:6581774-6581796 CCTTCTTTCCCTCACCATGCTGG - Intronic
1021202432 7:17741632-17741654 CCTGCTGCTCCTCGCCAGGCAGG + Intergenic
1022324928 7:29322494-29322516 CCTCCTCCTCCTCACCTAGTAGG + Intronic
1023759382 7:43449759-43449781 CCTCCTGCCTCACACCATGCTGG - Intronic
1024816352 7:53275951-53275973 CCAGCTTCTACACACCATGCAGG + Intergenic
1026135121 7:67653447-67653469 CCTCCTCCTCCTCATCATCAAGG + Intergenic
1026569917 7:71520573-71520595 CCTCCTTTGCCTGCCCATGCTGG - Intronic
1026845984 7:73699476-73699498 CCTCCTCCTCCTCACCACCTTGG - Exonic
1029493530 7:100885012-100885034 CCTCCTTCTCCTCCTCAGCCTGG - Exonic
1029859288 7:103552103-103552125 CATCCTTCTCCTCCCCACCCTGG + Intronic
1030374943 7:108744485-108744507 CCTCCTTTTCATCACCAGGCAGG - Intergenic
1032274065 7:130439526-130439548 CCTCCTTCCCCCCACCCTCCAGG + Intronic
1032614505 7:133452415-133452437 GCTGCTTCTCATCACCATGTGGG - Intronic
1034329556 7:150270561-150270583 CCTCATGCTCACCACCATGCAGG + Intronic
1034668500 7:152839300-152839322 CCTCATGCTCACCACCATGCAGG - Intronic
1035658803 8:1331437-1331459 CCTCCTTCCAGGCACCATGCCGG + Intergenic
1035756170 8:2034538-2034560 CCTCCTGCTCCTCACAAGACTGG + Intergenic
1035934175 8:3818556-3818578 CCTCCTTCACGTCTTCATGCTGG - Intronic
1037654802 8:20873690-20873712 CCTACTTCTCTTCACCTTGGAGG + Intergenic
1037734394 8:21555107-21555129 CCTCCTTCTCCTCTGTAAGCTGG - Intergenic
1037756024 8:21710539-21710561 CGTCCTTCTCCATGCCATGCTGG + Intronic
1037936001 8:22915414-22915436 CATCCCTCACCTCACCATCCTGG + Intronic
1039760939 8:40574664-40574686 CCTCATTCCCCTCTCTATGCTGG - Intronic
1041250604 8:55930757-55930779 CCTCTTCCTCCTCCCCCTGCTGG + Intronic
1041349603 8:56935345-56935367 CATCTTTCTCCTCACCTTACTGG - Intergenic
1041506406 8:58603288-58603310 CCTCCTTCACCTCAACAACCTGG - Exonic
1042018435 8:64343199-64343221 CCTGCTTCTGCTCACAAAGCAGG + Intergenic
1042081846 8:65062434-65062456 CCTCTTTCTCCTCTCCTTCCAGG - Intergenic
1043229897 8:77788450-77788472 CCCATGTCTCCTCACCATGCAGG - Intergenic
1046944254 8:119959776-119959798 CCTCCTTGGCCTCAAAATGCTGG + Intronic
1047175072 8:122532851-122532873 CCTCCTTGTTCTCACCACCCTGG - Intergenic
1048504264 8:135006575-135006597 CCTCCTCCTCCTCTCTCTGCAGG - Intergenic
1048681113 8:136842813-136842835 CCTGCCTCTCCTCACCAAGCAGG + Intergenic
1049071684 8:140360068-140360090 CTTCCTTCTACAGACCATGCTGG - Exonic
1049698416 8:143994840-143994862 CTTTCTCCTCCTCAGCATGCTGG - Intronic
1050453334 9:5807332-5807354 CCTCCTTGTCTTCACCACACTGG + Intronic
1051138386 9:13950401-13950423 CCTCCTACTCCCCACCTTCCAGG - Intergenic
1053487597 9:38471589-38471611 CCTCCCTCCCCTCACCATTCAGG - Intergenic
1053607851 9:39679172-39679194 CCTGCTACTCCTCACTGTGCAGG + Intergenic
1054245683 9:62663237-62663259 CCTGCTACTCCTCACTGTGCAGG - Intergenic
1054559809 9:66697768-66697790 CCTGCTACTCCTCACTGTGCAGG - Intergenic
1055693765 9:78860897-78860919 CCTGCTCCTCCTCACCCTGAGGG + Intergenic
1056809013 9:89750022-89750044 CCTCCTTGTCCTCAGCACACTGG - Intergenic
1057976037 9:99607442-99607464 CCTCTTTCTCATTAGCATGCAGG - Intergenic
1060355737 9:122905322-122905344 CCTCCTCCTCCTCACCACGGAGG + Intronic
1060477073 9:123994829-123994851 CCTCCCTCTCCTCACTCAGCTGG + Intergenic
1060781215 9:126414660-126414682 TCTCCTTCTCCTCAGTCTGCTGG + Intronic
1060825744 9:126686978-126687000 CCTCCTTCTCACCACCACCCCGG - Intronic
1060952580 9:127613045-127613067 CCTCCTCCTCCCCACCCTCCTGG + Intronic
1061551344 9:131336557-131336579 CCTCCTTCGCCGTACCATGCTGG - Intergenic
1062485648 9:136773974-136773996 TCCCCTTCTCCTCTCCCTGCTGG + Intergenic
1062572615 9:137192583-137192605 CCTCCTCCTCCTCCTCCTGCTGG + Exonic
1185830099 X:3293283-3293305 CCTCCTCCTCCTCTTCTTGCAGG - Intergenic
1186417590 X:9397357-9397379 CCTCCTTCTGCTGCCCAGGCTGG + Intergenic
1187203051 X:17154525-17154547 TCTCATTCACCTCACCATCCAGG + Intergenic
1187284248 X:17887814-17887836 CCTCTTTCTCCTCTCCTTCCAGG - Intergenic
1187827837 X:23350427-23350449 CCTCTTTCTACTCACCCAGCTGG - Intronic
1188589594 X:31817722-31817744 CTTCCTTCTCCCCAACATGAGGG - Intronic
1188714986 X:33449497-33449519 CCCATATCTCCTCACCATGCAGG + Intergenic
1188717360 X:33476655-33476677 CCCCCTCCTCTTCACCAGGCAGG + Intergenic
1189251006 X:39600718-39600740 CCTCCTTCCCCTGCCCAGGCCGG - Intergenic
1189497266 X:41520596-41520618 CCTCCATCTCATCACCATTTAGG - Exonic
1190373135 X:49762485-49762507 CCTCCTTCTGGTCACAATGTAGG - Intergenic
1192310957 X:70013621-70013643 CCCCCTGCTCTTCACCAAGCAGG + Intronic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1192630847 X:72777045-72777067 CCTCCTTCTCCTCCTCCTCCCGG + Intronic
1192650862 X:72943756-72943778 CCTCCTTCTCCTCCTCCTCCCGG - Intronic
1192760223 X:74088622-74088644 CCTGCTTCTCCTCACTGGGCAGG + Intergenic
1192760273 X:74088893-74088915 CCTGCTTCTCCTTACTAGGCAGG + Intergenic
1192911776 X:75612375-75612397 CCTCCTTCTCCTCCAGATGTGGG - Intergenic
1192912845 X:75623573-75623595 CCTCTTTCTCCTCTACATCCTGG - Intergenic
1192941775 X:75920377-75920399 CTTCCTACTCCTCACTGTGCAGG + Intergenic
1193399052 X:81020820-81020842 CCACCTCCTCTTCACCAGGCAGG - Intergenic
1193443927 X:81577079-81577101 TCTGCTGCTCCTTACCATGCAGG + Intergenic
1194010323 X:88553703-88553725 CCTCCTGCTCTTCACCAGTCAGG - Intergenic
1194486483 X:94492751-94492773 CCTCCCTCCCCCCACCATGCAGG - Intergenic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic
1196245076 X:113391085-113391107 CCTCCTGCTCGTCACCAGACAGG - Intergenic
1196534719 X:116829623-116829645 CTTCCTTCTCCTCAGCTTGCAGG + Intergenic
1196618606 X:117796365-117796387 CCTCATTTTCCTCACTATGGGGG - Intergenic
1197633272 X:128886609-128886631 CCTGCTTTTTCTAACCATGCTGG + Intergenic
1198184842 X:134243785-134243807 CCTTCTTCTCCTCACCCTTTAGG + Intronic
1198979642 X:142380307-142380329 CCTCCTTCTGCTGCCCATGCTGG - Intergenic
1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG + Intergenic
1199559836 X:149150946-149150968 CCTCTTGCTCTTCACCAGGCAGG - Intergenic
1200292154 X:154885045-154885067 TCTCCTCCTCCTCGGCATGCTGG - Exonic
1200338992 X:155380782-155380804 TCTCCTCCTCCTCGGCATGCTGG - Exonic
1200347477 X:155459910-155459932 TCTCCTCCTCCTCGGCATGCTGG + Exonic
1201247874 Y:12024226-12024248 CCTCCTCCTCCTCTTCTTGCAGG + Intergenic