ID: 1195746150

View in Genome Browser
Species Human (GRCh38)
Location X:108120766-108120788
Sequence GACTTGCCCTGAAATTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195746149_1195746150 -4 Left 1195746149 X:108120747-108120769 CCAGACTGGTTACTTTGCTGACT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1195746147_1195746150 6 Left 1195746147 X:108120737-108120759 CCCTTGCTAACCAGACTGGTTAC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1195746148_1195746150 5 Left 1195746148 X:108120738-108120760 CCTTGCTAACCAGACTGGTTACT 0: 1
1: 0
2: 0
3: 4
4: 215
Right 1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG 0: 1
1: 0
2: 1
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195746150 Original CRISPR GACTTGCCCTGAAATTTATC AGG Intronic
900039965 1:451954-451976 GACTATCCATGAAATTCATCAGG + Intergenic
900061397 1:686930-686952 GACTATCCATGAAATTCATCAGG + Intergenic
903761248 1:25700354-25700376 CACTTGCCCAGAAATGCATCTGG + Intronic
910053013 1:82998428-82998450 GAGTTACTCTCAAATTTATCAGG - Intergenic
911666375 1:100557541-100557563 GACTTCCATTCAAATTTATCTGG + Intergenic
913711576 1:121489403-121489425 AACTTTCCCTTAAATTTAACTGG + Intergenic
916806966 1:168268954-168268976 ACCTTGCCCGGAAATTTATTCGG + Intergenic
917058941 1:171016095-171016117 GACTTGAGCTGACATTTATATGG - Intronic
918749435 1:188253982-188254004 GACATAACTTGAAATTTATCTGG + Intergenic
920088812 1:203437826-203437848 CACCTGCCCTGGAATTTTTCTGG + Intergenic
920609465 1:207423188-207423210 GCTTTGCCCGGAAACTTATCCGG + Intergenic
923132175 1:231085860-231085882 GCCTTTTCCTGAAATTTATAAGG - Intergenic
1066353234 10:34657350-34657372 GTATTGGCCTGAAATTCATCTGG + Intronic
1067129584 10:43550374-43550396 GGCTTACTCTGAAATTTATATGG - Intergenic
1069835994 10:71308481-71308503 GCCCTGCCCTGAATTTCATCAGG - Intergenic
1076144301 10:128104947-128104969 GACCTGCCAGGAAATTTACCTGG - Exonic
1076966189 11:87862-87884 GACTATCCATGAAATTCATCAGG + Intergenic
1077147715 11:1053415-1053437 GACTTCCCCAGAACCTTATCTGG + Intergenic
1078947969 11:16093035-16093057 AACTGGTCCTGAAATTTATACGG + Intronic
1080333204 11:31165892-31165914 GAAATTCCCTGAATTTTATCTGG - Intronic
1086947727 11:92859832-92859854 GACTTGCTCTAAAATAAATCTGG - Intronic
1088468078 11:110163498-110163520 GACGTTTTCTGAAATTTATCTGG - Intronic
1090584434 11:128195240-128195262 GCCTTGCCCTGAAATGCATTTGG + Intergenic
1090714283 11:129416425-129416447 AACTTTCCCAGAAATTTCTCAGG + Intronic
1091183059 11:133624815-133624837 GACTTGGCAGGAGATTTATCGGG + Intergenic
1092831228 12:12446407-12446429 GTCTAGATCTGAAATTTATCAGG + Intronic
1093324576 12:17758764-17758786 GACTGGCACTCAAATTTATTTGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1096945457 12:55402818-55402840 GACTAGACCTTAAATTTATAAGG + Intergenic
1103958228 12:124591637-124591659 GAGTTGCTCTGAGATTTTTCAGG - Intergenic
1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG + Intergenic
1105355340 13:19654505-19654527 GACTTGGCGTTAAATTTATGAGG - Intronic
1108778576 13:53798398-53798420 GACTTGCCCTGGAGTTTAGTTGG - Intergenic
1109184907 13:59256812-59256834 TCCTTGCCCTGAAGCTTATCAGG + Intergenic
1111470006 13:88668081-88668103 GACTTTCCCTGACCTTTCTCAGG + Intergenic
1111579903 13:90209336-90209358 TACTTCCTCTGAACTTTATCAGG - Intergenic
1114435763 14:22706567-22706589 GACTTGTCCTGGATTTCATCAGG + Intergenic
1115032225 14:28810565-28810587 GACTTGTACTTAAATTTATTTGG - Intronic
1116419039 14:44712109-44712131 GATTTACCCTGTAATTTATCTGG + Intergenic
1118382080 14:65225637-65225659 GACTTGCTCTAAATTTCATCTGG - Intergenic
1128188589 15:65667489-65667511 GACTTGCCCAGTAACTTACCTGG - Exonic
1129876001 15:78976161-78976183 GACTTCCCCTGGTATTTATGGGG + Intronic
1130451573 15:84059075-84059097 GACTTGTCATGAGATTTTTCTGG + Intergenic
1132441942 15:101875663-101875685 GACTATCCATGAAATTCATCAGG - Intergenic
1133092275 16:3413849-3413871 GGCTTGCCCTCAAACCTATCGGG - Intronic
1133372991 16:5259732-5259754 GTCTTGCCCTGAAATGGAGCCGG + Intergenic
1141861969 16:86723516-86723538 GACCTTACCTGAAATTTAACAGG - Intergenic
1143844936 17:9766881-9766903 GACTGGCTCTGTAAGTTATCAGG - Intergenic
1145100372 17:20071470-20071492 AAATTGTCCTGAAATTCATCTGG - Intronic
1147540449 17:41352799-41352821 GCCTTGACCAGAAATTTACCAGG + Intergenic
1148133356 17:45275611-45275633 AAATTGCCCAGAAATTTAGCTGG - Intronic
1154099790 18:11461516-11461538 GACTTACCCTAAAATTTATAAGG - Intergenic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1156997564 18:43485832-43485854 GTCTTGCCAGGAAACTTATCTGG - Intergenic
1158111301 18:53943717-53943739 GCCTTGCCTGGAAACTTATCTGG + Intergenic
1159113579 18:64088365-64088387 GAATGGCCCTGAAACTGATCAGG + Intergenic
1159352846 18:67298287-67298309 GCCTTGCCTGGAAACTTATCTGG - Intergenic
1160132690 18:76242553-76242575 GCCTTGCCCTCAATTTTAGCAGG - Intergenic
1160642990 19:157489-157511 GACTATCCATGAAATTCATCAGG + Intergenic
928426877 2:31186558-31186580 GACTGGCCATGAAATTAAACTGG + Intronic
928919943 2:36516427-36516449 GAGTTGCCCTGAAGTTTTGCTGG - Intronic
930884420 2:56308647-56308669 GACATTCCCTGAAATTTAAGAGG + Intronic
932003040 2:67902076-67902098 GACTTTCTCTAAAAATTATCAGG - Intergenic
934724660 2:96608066-96608088 GACTTTCAGTGAAGTTTATCAGG - Intronic
938753269 2:134355700-134355722 GACTTGCACTGTAAATTTTCCGG + Intronic
939688278 2:145226513-145226535 ATCTTGCCCTGGACTTTATCTGG + Intergenic
939792237 2:146592273-146592295 AACTTGCCCTTAAATTTAAAAGG - Intergenic
942713108 2:178860678-178860700 GTCTTGTCCTGAAATCTCTCTGG - Intronic
943319887 2:186433371-186433393 GGTTTGCCCAGAAACTTATCTGG - Intergenic
943594535 2:189840196-189840218 GACTTGCTCTGAAATTACTCTGG - Intronic
945134478 2:206612521-206612543 GACATGCCCTCAAATTGTTCAGG - Intronic
946617119 2:221522176-221522198 CACTGGGCCTCAAATTTATCTGG - Intronic
948009657 2:234641272-234641294 GACTTTCCCTGAGATTGCTCTGG - Intergenic
1168831504 20:847566-847588 GACTAGCCCTGAATTCTAGCAGG - Intronic
1169903351 20:10575154-10575176 CACTTGCCCTTAAATTGATGTGG + Intronic
1173419126 20:42884985-42885007 TACTTCCCCTGAAACATATCAGG + Intronic
1176809333 21:13520869-13520891 GCCTGCCACTGAAATTTATCTGG + Intergenic
1177107565 21:16978848-16978870 GACTTTCCCTGGAACTTTTCTGG + Intergenic
1178019687 21:28394593-28394615 GCCTTGCCTGGAAACTTATCTGG - Intergenic
1178235008 21:30831572-30831594 AACCAGCCCTGGAATTTATCAGG - Intergenic
1181590472 22:23881664-23881686 TCCTTGCCCTGACATTTCTCAGG - Intronic
1184899369 22:47434704-47434726 GCTTTGCTCTGGAATTTATCAGG + Intergenic
950271084 3:11615757-11615779 GACTTGTGCTGAATTGTATCTGG - Intronic
955094819 3:55786966-55786988 TCCTTGCCCTGAAATATATATGG + Intronic
959717884 3:109453343-109453365 GAATTGTCCGGAAATTTCTCAGG - Intergenic
959969611 3:112394626-112394648 GATTTGCCCTGAATTCTTTCTGG - Intergenic
963459245 3:145586797-145586819 AACTTCCTCTCAAATTTATCTGG - Intergenic
963840581 3:150101297-150101319 AATTTGCCCTAAAATTTATATGG - Intergenic
964432518 3:156621835-156621857 GGTTAGCCCTGAAATTTATTTGG - Intergenic
966676898 3:182599482-182599504 GAGTTGCCCTCAAATATATTGGG + Intergenic
967668887 3:192207949-192207971 TAATTACCCTGTAATTTATCTGG - Intronic
967888043 3:194346386-194346408 GTCTTGCCCTGAACTTTAGAGGG - Intronic
969729613 4:8946498-8946520 AACTTTCCCTCAAATTTAGCAGG - Intergenic
976342805 4:83964146-83964168 GCCTTGTCCAGAAACTTATCTGG + Intergenic
980311295 4:131132818-131132840 GACTGGTCCTGGAATTTATTTGG - Intergenic
981110084 4:140925285-140925307 GACTTTCCCAGAACTGTATCAGG - Intronic
984316602 4:178138416-178138438 GCCTTGCCCAGAAACTTATCCGG - Intergenic
990256096 5:53971379-53971401 AACTTGCCAAGAACTTTATCTGG + Intronic
991016539 5:61939176-61939198 GACTCCCCCTGAATTTTAGCAGG - Intergenic
994981004 5:106875244-106875266 ACCTTGCCCAGAAACTTATCCGG + Intergenic
1001025111 5:168217506-168217528 AACTTGAGCTGAAATTTATGAGG - Intronic
1002733882 5:181366989-181367011 GACTATCCATGAAATTCATCAGG - Intergenic
1002750661 6:107132-107154 GACTATCCATGAAATTCATCAGG + Intergenic
1003993947 6:11519418-11519440 GACTTGCCCTAAATTTCATCAGG - Intergenic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1007242361 6:40435940-40435962 GGCTTGCCCTGTATTTTTTCTGG + Intronic
1010746597 6:79569640-79569662 GTCTTGGCCTGAACTTTTTCAGG + Intergenic
1012373104 6:98530406-98530428 GGTTTGCCCAGAAATTTATCCGG - Intergenic
1014506442 6:122265342-122265364 CACTTCCACTGAAATTTGTCAGG - Intergenic
1014541809 6:122685305-122685327 AACTTGCCTTGAGATTTATCTGG - Intronic
1015397082 6:132746872-132746894 GACTTTCACTGAAGTTCATCAGG - Intronic
1016211201 6:141535893-141535915 GAGTTACTCTGAAATTTATATGG - Intergenic
1019238129 6:170639308-170639330 GACTATCCATGAAATTCATCAGG - Intergenic
1021157360 7:17227342-17227364 GAATTGCCATTAAATTCATCGGG - Intergenic
1023627945 7:42135426-42135448 GATTTGACCTGAGATATATCTGG - Intronic
1026184743 7:68073876-68073898 GACTTGCCCTGCAATCAGTCCGG + Intergenic
1026198914 7:68197073-68197095 GAATTGCCTTGAAATATATTAGG - Intergenic
1026222164 7:68409752-68409774 GACTTGCCCTGAATTCTTTCTGG + Intergenic
1027167219 7:75843447-75843469 AACTTGCCCTGAATTCTTTCTGG - Intronic
1031515294 7:122691958-122691980 GCTCTGCCCGGAAATTTATCCGG + Intronic
1035509638 8:167300-167322 GACTATCCATGAAATTCATCAGG + Intergenic
1037488126 8:19368696-19368718 CAATTTCCCTGAATTTTATCAGG + Intronic
1039945163 8:42122606-42122628 GACTTGCCCTGAATTCTTTTTGG - Intergenic
1041004424 8:53484967-53484989 GCTTTGCCTAGAAATTTATCTGG - Intergenic
1041300435 8:56406016-56406038 AACTTGCACTGAAATTTTTTGGG + Intergenic
1042861159 8:73315456-73315478 TTCTTGCCCTGAAATGAATCTGG - Intronic
1043004941 8:74807823-74807845 GACTAGCCCTGAATTCTTTCTGG + Intronic
1043836115 8:85048869-85048891 ATGTTGCCCAGAAATTTATCTGG - Intergenic
1045023945 8:98068432-98068454 GACGTGCCCTGAAATGTGTGAGG + Intronic
1045594510 8:103636631-103636653 TACTTGCACTGAAATTAATCAGG - Intronic
1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG + Intergenic
1050652491 9:7789456-7789478 GCTTTGCCCAGAAACTTATCCGG + Intergenic
1050952373 9:11614186-11614208 GACTTGACCTGAAAATCATATGG + Intergenic
1052045376 9:23787948-23787970 GACTTTCCCTGAAGTTAGTCTGG - Intronic
1052221717 9:26032172-26032194 GGCTTGCCCTTAACTTTGTCAGG - Intergenic
1056391500 9:86145533-86145555 GACTTGCCCTGAATTCTTTCTGG + Intergenic
1058631418 9:106991536-106991558 AACTGGCCCTAAAATTTATATGG + Intronic
1062758336 9:138319603-138319625 GACTATCCATGAAATTCATCAGG - Intergenic
1185502892 X:612147-612169 GACTTGCCTTGGATATTATCTGG - Intergenic
1188768374 X:34124875-34124897 GTGTTGTCCTGAAATTTTTCTGG + Intergenic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1190463923 X:50707080-50707102 GATTTGCTCTTAAATTTTTCAGG - Intronic
1193508528 X:82372009-82372031 GCCTTGCCCAGAAATTTATCCGG + Intergenic
1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG + Intronic
1197869201 X:131049873-131049895 GAGATGCCCTGAAAGTTATGGGG - Intergenic
1200307332 X:155040814-155040836 GACTTGAGTTGACATTTATCTGG - Intronic