ID: 1195749986

View in Genome Browser
Species Human (GRCh38)
Location X:108154550-108154572
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1494
Summary {0: 4, 1: 28, 2: 113, 3: 370, 4: 979}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900917403 1:5648491-5648513 TATTTACAAAAGCAGTCACAGGG + Intergenic
901219918 1:7577841-7577863 TATTTACAAAAATAGATGGCGGG + Intronic
901777110 1:11567636-11567658 TATTTACAAAAACAGGCAGTGGG - Intergenic
902063280 1:13663366-13663388 TATTTACAAAAACAGTTGAAGGG - Intergenic
902090096 1:13896308-13896330 TATTTGCAAAAGCAAATGGTGGG + Intergenic
902090220 1:13897105-13897127 TATTTACAAAAGCAAGTAGTGGG - Intergenic
902177436 1:14661552-14661574 TATTTACAAGAACAGGTGGTGGG + Intronic
902224887 1:14990522-14990544 TATTTATAAAAACAGGTGGTAGG - Intronic
903282901 1:22260158-22260180 TATTTACAAAAACAGGCAGTGGG + Intergenic
905045926 1:35000953-35000975 TATTTACAAAAACAGATGGTGGG - Intronic
905265337 1:36749748-36749770 TATTTACAAAAGCAGGTGGTGGG + Intergenic
905467054 1:38163018-38163040 TATTTACAAAAACAGGCAGTGGG - Intergenic
905473368 1:38209052-38209074 TATTTACAAATTCAGGAGGCAGG + Intergenic
905650769 1:39655252-39655274 TCTTTACAAAAACAGGTGATGGG + Intergenic
905708152 1:40078121-40078143 TTTATACAAAAGTTGGTGGAAGG + Intronic
905721912 1:40211005-40211027 TATTTATAAAAACAGGTAGCTGG - Intronic
905838699 1:41154080-41154102 TATTTACACAAACAGGCAGAGGG + Intronic
905935409 1:41820042-41820064 TATTGACAAAAACAGGTGGTGGG + Intronic
906155303 1:43610565-43610587 TATTTACAAAAACAGGTGGTGGG - Intronic
906359431 1:45140215-45140237 TATTCACAGAAACAGGTGGCAGG - Intronic
906676364 1:47696597-47696619 TATTTACAAAAGCAGGTGGCAGG + Intergenic
906773078 1:48502498-48502520 TATTTACAAAAACATGTGGCAGG - Intergenic
907155981 1:52334356-52334378 TATTTACAAAAGCAGGCTGGAGG + Intronic
907165122 1:52403924-52403946 GCTTTACAAATGCAGATGGAGGG + Intronic
907180487 1:52565447-52565469 TCGTTATAAAAGGAGGTGGAAGG + Intergenic
907382941 1:54106071-54106093 TATTTACAAAAACAGGTGGTGGG + Intronic
907398898 1:54212302-54212324 TATTTACAAAAATAGGTAGCAGG + Intronic
907408137 1:54266335-54266357 AATTTATAAAAACAGGTGGCAGG - Intronic
908018545 1:59874668-59874690 TATTTACAAAGACAGGCGGTAGG + Exonic
908062390 1:60365813-60365835 GCTATACAAAAGCGGGTGGAAGG - Intergenic
908408649 1:63841288-63841310 AATTTACAAAAGCAGGGTGGTGG - Intronic
908455000 1:64295003-64295025 TATTTACAAAAACAGGTGGTGGG + Intergenic
908507109 1:64815095-64815117 TATTTACAAAACCAGGTGGTGGG - Intronic
908649118 1:66312741-66312763 TATTTGCAAAAACATGTGGCTGG - Intronic
908684272 1:66697844-66697866 TATTTAATAAAGCATGTTGAAGG - Intronic
908872844 1:68634432-68634454 TATTTGCAAAAACAGGTGGTGGG + Intergenic
908941633 1:69441988-69442010 TATTTATAAAAACAGGCAGAGGG - Intergenic
909402611 1:75250955-75250977 TATTTATAAAAGTAAGTGGTTGG + Intronic
909800918 1:79806355-79806377 CATTTGCCAAAGCATGTGGATGG - Intergenic
909987699 1:82183131-82183153 TATTTACAAAATCAAGTAGCAGG + Intergenic
910169237 1:84359997-84360019 TATTTACAAAAACAAGTGGTGGG + Intronic
910297914 1:85670199-85670221 TATTTACAAAAACAGATAGTGGG - Intronic
910403709 1:86863247-86863269 TATCAACAAATGCAGGAGGATGG + Exonic
910603628 1:89058425-89058447 TATTTACAAAGACAGCTGGCAGG + Intronic
910640378 1:89454682-89454704 TATTTACAAAAGTAGGCAGTGGG + Intergenic
910816304 1:91294509-91294531 TATTTACAAAAATAGATGGTTGG - Intronic
911107591 1:94147797-94147819 ACTTTACAAAAACAGGTGGCAGG + Intergenic
911113197 1:94213604-94213626 TATTTACAAAAACAGGCAGCTGG + Intronic
911475968 1:98372810-98372832 TATTTACAAAAACAGGCAGTGGG - Intergenic
911572421 1:99534038-99534060 TATTTATAAAAACAGGAGGCGGG - Intergenic
911661300 1:100504552-100504574 TATTAACAAAAATAGGTGGTGGG + Intronic
911786312 1:101953298-101953320 TATTTACAAAAACAGGTGGAGGG - Intronic
912036968 1:105329315-105329337 AATTTACAAAAGCAGGGGCGGGG - Intergenic
912254311 1:108043820-108043842 TAATGACAAAAGCAGGGGAAGGG - Intergenic
912630689 1:111244124-111244146 TATTTACAAAAACAGGCAGTGGG - Intergenic
912872482 1:113322190-113322212 TATTTATAAAAACAGATGGTGGG + Intergenic
913259011 1:116981793-116981815 TATTTACAAAAGCAGGTGGTGGG + Intronic
913313365 1:117527315-117527337 TATTTACAAAAGCAGATGGAGGG + Exonic
913522200 1:119655319-119655341 TATTTCCCAAAGGAAGTGGAGGG + Intergenic
914229028 1:145747790-145747812 TATTTACAATAACAGGTGGCAGG + Intronic
914332092 1:146681641-146681663 TATTTACAAAAGCAGGCAGAGGG - Intergenic
915548509 1:156617785-156617807 TGTTTACAGGGGCAGGTGGAGGG + Intergenic
916988742 1:170219322-170219344 TATTTACAAAAACAGACGGTAGG - Intergenic
917095985 1:171399307-171399329 AATTTACAAAAAATGGTGGAAGG + Intergenic
917105539 1:171487350-171487372 TAATTTAAAAAGCAGGTTGAAGG - Intronic
917600007 1:176564455-176564477 TATTCACAAAAAGAGGTGGCAGG + Intronic
917641495 1:176987348-176987370 TATTTACAAAAACAGGTGACAGG + Intronic
917648424 1:177051353-177051375 TATTTACAAAAACAGGCAGTGGG - Intronic
918289304 1:183091383-183091405 TGTTTACAAAAATAGGTGGTGGG + Intronic
919043193 1:192419054-192419076 TATTTACAAACACAGGTGGTTGG - Intergenic
919299817 1:195745846-195745868 TATTTACAAAAGCAGACAGCTGG + Intergenic
919459493 1:197859316-197859338 TATTTTCAAAACTAGGTGGCAGG + Intergenic
919612380 1:199761109-199761131 TACTTACAAAAACAGGTAGTTGG + Intergenic
919964526 1:202509033-202509055 TATTTACAAAAGCAGGCCGGTGG + Intronic
920271338 1:204766797-204766819 TATTTACAAAAACAGGTATGCGG + Intergenic
920517426 1:206596469-206596491 TATTTACAAAAACAGGTGGCAGG + Intronic
920668562 1:207984973-207984995 TGATTGCAAAAGCAGGTGGTGGG - Intergenic
920880220 1:209872932-209872954 TATTTACAAAAACAGGCAGTGGG + Intergenic
920902405 1:210124044-210124066 TCTTTACAAAAACAGGTGGAAGG - Intronic
921258760 1:213366620-213366642 TATTTACAAAAGCAGACAGTGGG + Intergenic
921753707 1:218827453-218827475 TATTTACAAAAGCAAGGACATGG - Intergenic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
922055023 1:222033831-222033853 TATTTACAAAAACAGGTAGTAGG - Intergenic
922299878 1:224289201-224289223 AATTTACAAAAACACGTGGTGGG + Intronic
922330787 1:224573874-224573896 CATTTACAAAAAAAGATGGAAGG - Intronic
922421549 1:225463915-225463937 TATTCACAAAAACAGGTGTCAGG - Intergenic
922989195 1:229891429-229891451 TATTTACAATAACCGGTGGCAGG - Intergenic
923142275 1:231170691-231170713 TATTTACAAAAACAGGGAGTGGG - Intronic
923321107 1:232834387-232834409 TATTTACAAAAATAGATGGTGGG + Intergenic
923802866 1:237227431-237227453 TATTTACAAAAATAGGAGGAGGG + Intronic
924231265 1:241963859-241963881 TATTTACCAAAAGAGGTGGCAGG + Intergenic
924604945 1:245525673-245525695 TATTCACAGACGCAGCTGGATGG + Intronic
1063538118 10:6905123-6905145 TATTTACAAAAGCAGGTGCTAGG + Intergenic
1063544748 10:6969857-6969879 TATTTATAAAAACAGGTGGAGGG + Intergenic
1063696701 10:8342720-8342742 TATTTATAAAAATAGGTGGGGGG - Intergenic
1063778627 10:9294215-9294237 AATTTGCAAAAACAGGTGGTTGG + Intergenic
1063890096 10:10620155-10620177 TATTTACAAAAACAGGTAGTGGG - Intergenic
1064027702 10:11861663-11861685 TATTTACAAAAGCACGGAGTGGG - Intronic
1064069995 10:12220450-12220472 TATTTATAATAGCAGAAGGATGG - Intronic
1064117705 10:12593172-12593194 TATTTACAAAAACAGGTGGTGGG + Intronic
1064532789 10:16327180-16327202 TATCTACAAAACCAGGTAGTGGG - Intergenic
1064598480 10:16970030-16970052 TATTTAGAAAATCAGGTGCCTGG - Intronic
1065172194 10:23042623-23042645 TATCTACTAAAACAGGTGGGGGG + Intergenic
1065224655 10:23531447-23531469 TATTTCTAAAAAAAGGTGGAGGG - Intergenic
1065616526 10:27531652-27531674 TATTTAATAAAACAGGTGGTGGG + Intronic
1065863978 10:29897613-29897635 TATTTACAAAAACGGGTAGAGGG - Intergenic
1066076084 10:31878637-31878659 TATTTACAAAAGAAGGCAGCAGG - Intronic
1066124011 10:32321157-32321179 TATTTAGAAAAACAGGTGGTGGG - Intronic
1066482270 10:35808545-35808567 TATTTACAAGAACAGGTGACAGG + Intergenic
1066514636 10:36144115-36144137 TATTTACAAAAACAGCTGGTAGG - Intergenic
1066658006 10:37712793-37712815 CATGTACAAAAGCACATGGAGGG + Intergenic
1066660405 10:37734085-37734107 CATTTACAAAAACAAGTGGTGGG + Intergenic
1067075215 10:43175256-43175278 TATTTACTAAAGCAGGCAGCAGG + Intronic
1067129413 10:43548306-43548328 AACTTACAAAACCAGGTGGCAGG + Intergenic
1067359452 10:45564516-45564538 TAATCAGAAATGCAGGTGGAGGG + Intronic
1067930099 10:50552069-50552091 TATTTATAAAAACAGGCAGAAGG + Intronic
1067993835 10:51246405-51246427 CATTTACAAAAACAGGAGGTGGG - Intronic
1068044579 10:51870167-51870189 TATTTACAAAAGCCCCTGTAAGG - Intronic
1068139674 10:52990372-52990394 TATTTAGAAAAACAGGTGGTGGG + Intergenic
1068466303 10:57397457-57397479 TATTTCTAAAAACAGGTGGTGGG - Intergenic
1068513304 10:57993755-57993777 TATTTAAAAAAGTAAGTAGATGG - Intergenic
1068841253 10:61616793-61616815 TATTTATAAAAACAGATGGCAGG - Intergenic
1068875141 10:61987712-61987734 TATTTACAAAAACAGGTGTTGGG + Intronic
1069110805 10:64443766-64443788 TATTTACAAAAGCAGGCAGTGGG + Intergenic
1069143612 10:64860950-64860972 TACTTTCAAAAGCAGGTAGTGGG - Intergenic
1069242070 10:66155038-66155060 TATTTACAAAAATAGGTGGCAGG + Intronic
1069373673 10:67772360-67772382 TATTTACAAAAACAGTGGGCTGG + Intergenic
1070001506 10:72381434-72381456 TATTAACAAAAGCTCATGGAAGG - Intronic
1070086104 10:73238470-73238492 TATTTACAAAACAAGGCGGTAGG - Intronic
1070491096 10:76977277-76977299 GATGTACAAAAACAGGTGGCAGG - Intronic
1070505988 10:77113289-77113311 TATTTACAAAAACAGGCAGCCGG + Intronic
1070511853 10:77168977-77168999 TATTTACAAAAACAGGCAGTAGG + Intronic
1071009693 10:80923598-80923620 TATTTACAAAACCAGGTGGAAGG + Intergenic
1071297145 10:84229826-84229848 TTTTTACAAAAACAGGTGACAGG - Intergenic
1071348622 10:84716932-84716954 TATTTACAAAATAAGGTGGTGGG + Intergenic
1071440656 10:85689729-85689751 TATTTTTAAAAGGAGGAGGAAGG + Intronic
1071728787 10:88226998-88227020 TATTTACAAAACCAGGCAGTGGG - Intergenic
1071739668 10:88342884-88342906 TATTTACAAACACAAGTGGCAGG - Intronic
1071786355 10:88904471-88904493 TATTTATAAAAGCAAGTGGGTGG - Intronic
1071921121 10:90351840-90351862 AATTTACAAAAGCATGTTTATGG - Intergenic
1072028133 10:91485737-91485759 TATTTACAAAAACAGGTTGTAGG + Intronic
1072262675 10:93696007-93696029 TATGTACAAGAACAGGTGGTGGG + Intronic
1072587277 10:96793752-96793774 CATATACAAAAGCATGTGTATGG - Intergenic
1072978341 10:100078675-100078697 CATTTACCAAAACAGGTGGCTGG + Intronic
1073530119 10:104223078-104223100 ACTTTACAAAAACAGGTGGTGGG + Intronic
1073585058 10:104702080-104702102 TATTTACTGAAACAGATGGAGGG + Intronic
1073717609 10:106125563-106125585 TATGTACTGAAGCAGGTGGATGG - Intergenic
1073766409 10:106687590-106687612 TATTTAGAAAAACAAGTGGTGGG + Intronic
1074038639 10:109766146-109766168 TATTTATAAAAACAGGTGGTAGG + Intergenic
1074320370 10:112396473-112396495 TACTTACAAAGGCAGGTGGTAGG + Intronic
1074625082 10:115174725-115174747 TATTTACAAAAACAGGTGGTGGG + Intronic
1075032922 10:119038432-119038454 TTTTCAAAAAAACAGGTGGATGG - Exonic
1075059353 10:119244184-119244206 TATTTACAAGAACAGGTGTTGGG + Intronic
1075149454 10:119913853-119913875 TATTTATAAAAGCAGGTGGCTGG + Intronic
1075292715 10:121244043-121244065 TATTTACAAAAGCTGGCAGTGGG + Intergenic
1075438987 10:122464434-122464456 TATTTGCAAAAGAAGGAGGGAGG - Intronic
1075765858 10:124892309-124892331 TACTCACAAAAGAAGGAGGAAGG - Intergenic
1075952951 10:126497833-126497855 TATTTACAAAAACAGGCAGCAGG + Intronic
1076037015 10:127207811-127207833 TATTTACAAAACCAGGAGGTGGG + Intronic
1076066283 10:127450758-127450780 TATTCACAGAAACAGGTGGCTGG - Intronic
1076264573 10:129099619-129099641 CATTTACAAAAGCAGGTGGTGGG + Intergenic
1076333944 10:129692492-129692514 TATTTACAAAAACAGATGGTGGG + Intronic
1076343649 10:129766274-129766296 CATTTGCAAAAGCAGGTGGTGGG + Intronic
1077479230 11:2805513-2805535 TATTTACAAAAACAGGCAGCGGG - Intronic
1077578443 11:3401985-3402007 GATTTACAAAAGCAGGAGACTGG - Intergenic
1077693868 11:4375645-4375667 TATTTACAAAAGCAGGTAATGGG + Intergenic
1077952199 11:6972328-6972350 TATTTACAAAAACAGGTGACAGG + Intronic
1078524829 11:12092305-12092327 TGTTTCCAAAAAGAGGTGGAAGG + Intergenic
1078664169 11:13310683-13310705 TATTTACAGAAGCAGGTGGTGGG + Intronic
1078703767 11:13717808-13717830 TATTTACAAAAACAGGTGGTGGG + Intronic
1078722605 11:13898169-13898191 TCCTTGCCAAAGCAGGTGGAAGG + Intergenic
1078880581 11:15444996-15445018 TATTTACAAAAACAGGCAGCAGG - Intergenic
1079031159 11:16987364-16987386 TATTTACCAAAGGAGCTGGTTGG - Intronic
1079433731 11:20423402-20423424 TACTTACAAAAACAGGTAGCTGG - Intronic
1079614152 11:22470001-22470023 TATTTACAAAAACAGGTGAAAGG + Intergenic
1079874720 11:25842505-25842527 TATTTTCAAAAACAGGTGGCAGG + Intergenic
1080435619 11:32239468-32239490 TATTTACAAAAACAGATTGTGGG + Intergenic
1080868878 11:36219056-36219078 TATTTACAAAAACAGGTAGCAGG - Intronic
1081335746 11:41864076-41864098 TTTTTACAAAATGTGGTGGATGG + Intergenic
1081586468 11:44388053-44388075 TATTTACAAAAACAAGTGATGGG + Intergenic
1081826901 11:46063510-46063532 ATTTTACAAAAACAGGTGGCAGG + Intronic
1081828410 11:46081766-46081788 TATTTGCAAAAACAGGTGGTGGG - Intronic
1082219948 11:49622742-49622764 CATTTTAAAAGGCAGGTGGAAGG - Intergenic
1082816308 11:57512106-57512128 TATTTAAAAATGCAGGTGGAGGG + Intronic
1083100880 11:60304620-60304642 TATTTACAAAAACAGGTACAGGG - Intronic
1083221455 11:61255527-61255549 TATTTGCAGAGGCAGGTGGGGGG + Intergenic
1083770004 11:64861604-64861626 TATTTATACAAACAGGTGGTGGG - Intronic
1084020677 11:66415616-66415638 TATTTACAAAAGGAGGCAGCAGG + Intergenic
1084120842 11:67068108-67068130 TTTTTACCAGAGCAGCTGGAAGG + Intronic
1084331837 11:68435015-68435037 TATTTACAAAAGTAGGTGGCAGG - Intronic
1084782685 11:71420955-71420977 TATTTACTAAAGCAGTCGGTTGG - Intergenic
1085833629 11:79929576-79929598 TATTTCCAAAATCAGGTGGCGGG + Intergenic
1086382303 11:86268922-86268944 TATTTATAAAAACAGGTGGCTGG + Intronic
1086597812 11:88594502-88594524 TATTTACAAAGACAGGTAGTAGG + Intronic
1086883829 11:92180633-92180655 TACTTACAAAAGCAGGCAGTGGG + Intergenic
1087005337 11:93465313-93465335 TCTGTTCAAAAGCAGGTGGCAGG + Intergenic
1087415856 11:97854661-97854683 TATTTAAAAAAGCATTTTGAAGG - Intergenic
1087433643 11:98085143-98085165 TATTTACTAAAACAGGTAGCAGG - Intergenic
1087433651 11:98085272-98085294 TATTTACTAAAACAGGTAGCAGG - Intergenic
1087803261 11:102527275-102527297 TATTTACAAAAACAGAAGGTGGG + Intronic
1088071386 11:105790145-105790167 TGCTTACCAATGCAGGTGGAAGG - Intronic
1088205218 11:107384630-107384652 TATTTACAAAAACATATGGATGG - Intronic
1088758331 11:112905995-112906017 TCTTTACAAAAACAGGTGGCAGG + Intergenic
1088832850 11:113552463-113552485 TATACACAAAAACAGGTGGTGGG + Intergenic
1088927190 11:114314324-114314346 TATTTATAAAAACAGATGGATGG + Intergenic
1088932910 11:114370023-114370045 TATTTACAAAAGCAGGCAGTGGG + Intergenic
1089135803 11:116248031-116248053 TATCTATAGAAGCAGGTGGTTGG + Intergenic
1089403194 11:118176703-118176725 GATTTCAAAAAGCAGGTGGGAGG + Intergenic
1089425899 11:118374488-118374510 TATTTACAAAAACAGGTGGCAGG - Intronic
1089851456 11:121500463-121500485 CATTTACAAAAACAGGTGGTGGG - Intronic
1089951411 11:122531220-122531242 TATTTACAAAAACAGGTGGCAGG + Intergenic
1090965722 11:131596440-131596462 CATTTACAAAAGCAGGTGGCCGG + Intronic
1091345448 11:134849996-134850018 TATTTACAAACGCAGGTGGCAGG - Intergenic
1091404545 12:201070-201092 TATTTATACATGCAGGTTGATGG + Intronic
1091486311 12:892404-892426 TATTTACAAAAACAGGCAGTAGG + Intronic
1091642658 12:2249300-2249322 TATTTACAAAAGCAGATGGCAGG - Intronic
1091940078 12:4471504-4471526 TATTTACCAAAACAGGAAGAAGG - Intergenic
1092224418 12:6738227-6738249 TATTTACAAAAACAGGCAGTGGG - Intergenic
1092558867 12:9588362-9588384 TTGTAACAAAAGCAGCTGGAAGG + Intergenic
1093250313 12:16794676-16794698 TATTTACGAAAACAGGTGGTGGG - Intergenic
1093440743 12:19192906-19192928 TATTTACAAAAACAGGCAGCAGG - Intronic
1093631026 12:21409369-21409391 TAATTACAAAATCAGGTGGCAGG - Intronic
1094260274 12:28488932-28488954 TATTTATAAAAGCAGGCAGCAGG - Intronic
1094591446 12:31825128-31825150 TACTTACCAAAGCAGGTGAAAGG - Intergenic
1095459971 12:42433330-42433352 TATTTTCAAAAGCAACTGTAAGG + Intronic
1096089095 12:48886621-48886643 TATTTAGAAATGTAGGGGGAGGG + Intergenic
1096165086 12:49415828-49415850 TATTTACAAAAACAGGCAGCAGG + Intronic
1097048073 12:56202540-56202562 TTTTTACAAAAGCAGGCAGTGGG + Exonic
1097315074 12:58163318-58163340 TATGTACAAAAACAGGAGGCAGG + Intergenic
1097329811 12:58320747-58320769 TATTTACAAAAAGAGGTGACAGG - Intergenic
1097341488 12:58443456-58443478 TAATTACAAAATCAGGTAGCAGG - Intergenic
1097573679 12:61363884-61363906 TATTTACAAAAATATGTGGCAGG - Intergenic
1098135925 12:67401679-67401701 TATTGACAAAAACAGGTGGCAGG - Intergenic
1098513746 12:71349626-71349648 TATTTACTAAAACAGGTGACAGG + Intronic
1098571683 12:71994931-71994953 TATTTATAAAAGCTGGTGGTGGG + Intronic
1098647186 12:72918057-72918079 TATTTACAAAATTAGGTGGTGGG + Intergenic
1098664649 12:73147207-73147229 GATTTACAAAAGTAGGTCAAAGG + Intergenic
1098845629 12:75531730-75531752 TAATTTCAAAAGAATGTGGAAGG - Intergenic
1098909530 12:76194931-76194953 TATTTACAAAAGCAGGTGGTAGG + Intergenic
1099256678 12:80323183-80323205 GATTTAAAAAAGCAAGTGGTTGG - Intronic
1099346505 12:81506883-81506905 TATTTACAAAAACAGGTAGCAGG + Intronic
1099648354 12:85390541-85390563 TATTTGCAAAAACAGATGGTGGG + Intergenic
1099680819 12:85825467-85825489 TATTTACAAAAACAGGTGGTGGG - Intronic
1099853041 12:88128048-88128070 TATTTACAAAAGCAGATGGGAGG - Intronic
1100163978 12:91895096-91895118 TATTTATAAAAACAGGTGACAGG - Intergenic
1100244060 12:92738633-92738655 CATTTACAAAAACAGGTGGCAGG + Intronic
1100600159 12:96106021-96106043 TATATACAAAAACAGGTGTGGGG + Intergenic
1100665317 12:96745923-96745945 TATTTTCAATCCCAGGTGGATGG + Intronic
1101042835 12:100773920-100773942 TATTTACAAAACCAGGAAGTGGG - Intronic
1101052989 12:100883427-100883449 TATTTACAAAAACAGATGGTAGG + Intronic
1101073429 12:101100962-101100984 TATTTACAAAAACAGGCAGTGGG - Intronic
1101547883 12:105733765-105733787 TATTTACAAAAACAGGATGTAGG - Intergenic
1101574570 12:105985594-105985616 TATTTACAAAAACAGGCAGTGGG + Intergenic
1101750189 12:107577060-107577082 TACTTACAAATGCAGATGGTAGG - Intronic
1101814542 12:108135807-108135829 TATTTACAAAAACAGGCAGTGGG - Intronic
1101936873 12:109065328-109065350 TATTGACAAAAACAGGTGGTGGG - Intronic
1102033103 12:109754610-109754632 TATTTACAAAAGCAGCCAGCAGG + Intronic
1102175644 12:110872284-110872306 TATTGACAAAAACAGGTAGTGGG + Intronic
1102230609 12:111259426-111259448 TATTTACACAAACAGATGAAGGG + Intronic
1102493829 12:113305624-113305646 TATTTATAAAAGCAGTTAGTGGG - Intronic
1102620131 12:114187986-114188008 TATTTGCAAAAGCAGGCAGTAGG + Intergenic
1102630473 12:114274402-114274424 TATTTACAAAAACAGGTGGCAGG + Intergenic
1102709292 12:114911398-114911420 TATTTACAAAAACAGGCAGTGGG - Intergenic
1102782463 12:115577083-115577105 TATTTACAAAAACAGGTGATTGG - Intergenic
1102818894 12:115891353-115891375 TATTTTCAAAAACAGGTGGCAGG + Intergenic
1102825419 12:115944325-115944347 TATTCACAAAAACAGGTGGCGGG + Intergenic
1102828684 12:115974107-115974129 TATTTACAAAAACAAATGGGAGG - Intronic
1102872133 12:116422318-116422340 TATTAACAAAAACAAGTGGTGGG + Intergenic
1102926088 12:116827579-116827601 TATTTATAAAAACAAGTGGCAGG - Intronic
1103023141 12:117552813-117552835 TATTTACAAAAGTAGGTTGTGGG + Intronic
1103036158 12:117658437-117658459 GACTTACAATAGCAGGCGGAGGG - Intronic
1103040353 12:117690093-117690115 TATTTACAAAAACAGGCTGTGGG + Intronic
1103045171 12:117730147-117730169 TATTTACAAAAACAGGTGGTGGG + Intronic
1103045787 12:117733464-117733486 TATTTACAAAAACAGGTAGTGGG - Intronic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1103202839 12:119102652-119102674 TATTTATAAAAGCAGGAGGCAGG + Intronic
1103260627 12:119585444-119585466 TATTTACAAAAACAGGCAGCAGG + Intergenic
1103265773 12:119628954-119628976 TATTTACAAAAACAGGCAGCAGG + Intronic
1103428575 12:120861276-120861298 TATTTACAAAAACAGGTTGTAGG + Intronic
1103845005 12:123895619-123895641 TATTTACAAAAACAGGGGGCGGG + Intronic
1103849545 12:123923206-123923228 TATTTACAAAAGCAGGCAGTGGG - Intronic
1103873888 12:124112292-124112314 TATTTACAAAAACAGGTGGAGGG - Intronic
1103922497 12:124406237-124406259 TATTTACAAAAGCAGGTGGTGGG + Intronic
1104003566 12:124875903-124875925 TATTTACAAAAACAGGCTGGGGG - Intronic
1104003572 12:124875943-124875965 TATTTACAAAAACAGGCTGGGGG - Intronic
1104083673 12:125456056-125456078 TAGTTACAAAAACAAGTGGCAGG + Intronic
1104372559 12:128236827-128236849 TATTTACAAACACAGGTAGAGGG + Intergenic
1104583680 12:130030079-130030101 TATTTACAAAAGCACGCAGCTGG - Intergenic
1104666648 12:130652222-130652244 CATTTACAAAAACAGGTGGTGGG - Intronic
1104733842 12:131123887-131123909 GATCTACAAAAGCAGGTAGTGGG - Intronic
1105657301 13:22455245-22455267 TATTTCCAAGAGCATGTGCAGGG - Intergenic
1105801910 13:23912733-23912755 TAGTTACAAAAGCAGGTGATGGG + Intergenic
1106225900 13:27786977-27786999 TATTTAAGAAGGCAGGTGAAGGG - Intergenic
1106354750 13:28970397-28970419 TATTCACAAATACAGGTGGCAGG - Intronic
1106424004 13:29608476-29608498 TATTTACAGAAGCATTTGGAGGG - Intergenic
1106777791 13:33025414-33025436 TATTTACAAAAATAGGTAGTGGG + Intronic
1107106765 13:36651781-36651803 TATTTACAAAAGCAGATGGTGGG - Intergenic
1107236556 13:38177408-38177430 TATTTACAAAAGTAGGCAGTGGG + Intergenic
1107665480 13:42684806-42684828 TATTTACAAAAACAGATGGTGGG + Intergenic
1107904005 13:45045638-45045660 GATTCACAAAAGCAGGTAGTGGG + Intergenic
1107972580 13:45657962-45657984 TATTTACAAAGACAGATGGCTGG + Intergenic
1108196715 13:48002199-48002221 TAGTTACCAAAGCTGGTGGCAGG + Intergenic
1108524266 13:51272535-51272557 TATTTACAAAAATAGGTGGCAGG - Intronic
1108525584 13:51283351-51283373 TATTTACAAGAACAGCTGGTGGG + Intronic
1108534233 13:51356999-51357021 ACTTCACAAAAGCAGGTGGTAGG - Intronic
1108629102 13:52263578-52263600 TATTCCCAAACTCAGGTGGAAGG - Intergenic
1108656954 13:52542898-52542920 TATTCCCAAACTCAGGTGGAAGG + Intergenic
1108753327 13:53471392-53471414 TATTTACAAAAGCAGGCAGTGGG + Intergenic
1108812338 13:54243298-54243320 TATTGACAAAAACATGTGGTGGG + Intergenic
1108843518 13:54650807-54650829 TATTTACCAAAGCAGTAGTAAGG - Intergenic
1109286428 13:60414300-60414322 TATTTACAAAAACTGGTAGCAGG - Intronic
1109581553 13:64345584-64345606 TATTTACAAAAACATGTGCTAGG - Intergenic
1109649016 13:65300364-65300386 TATTTAAAGAAACAGGTTGAAGG + Intergenic
1109807460 13:67462289-67462311 TATTTACAAAAACAGGTGGTGGG + Intergenic
1109868078 13:68292759-68292781 TATTTACAAAAACAGGCAGCAGG + Intergenic
1110191998 13:72740749-72740771 TATTTAAAAAAATAGGTGAAAGG + Intronic
1110511050 13:76350838-76350860 TATTTACAAAAACAGATGGTGGG - Intergenic
1110666263 13:78120757-78120779 TATAGACAAAAGCAGATAGAAGG + Intergenic
1111053076 13:82911890-82911912 TATCAACAAATGCAGCTGGATGG + Intergenic
1111925127 13:94455506-94455528 TATTTACAAAAACAGGTTGTAGG - Intronic
1112064032 13:95772144-95772166 TATTTTGAAAAACAGGTGGTGGG + Intronic
1112345655 13:98586971-98586993 TATTTACACAAACAGGTGGCAGG + Intergenic
1112558248 13:100488994-100489016 TATTTTCAAAAACAGTTGGTGGG - Intronic
1113058126 13:106291083-106291105 TATTCACAAAAACAGGTGCCCGG + Intergenic
1113303404 13:109048557-109048579 TATTTACAAAAACAGGCAGTGGG + Intronic
1113303948 13:109056012-109056034 TATTTACAAAAACAGGTGGTAGG - Intronic
1114336804 14:21698700-21698722 TATTTATAAAACCATGTGGCAGG - Intergenic
1114898118 14:27019554-27019576 TATTTACAACTGCACATGGATGG - Intergenic
1115253207 14:31371048-31371070 TATTTACAAAAACAGGCAGTGGG - Intronic
1115591309 14:34868133-34868155 AATCTACAAAAACAGGTGGAGGG - Intronic
1115836535 14:37411591-37411613 TATTTACAAAAACAGGCAGCTGG - Intronic
1116040271 14:39678003-39678025 TATTTACCAAAACAGGTGATGGG + Intergenic
1116171250 14:41405965-41405987 TATTTACAAAAGCAGATGTTGGG + Intergenic
1116388572 14:44362857-44362879 TATTTACAAAAGCAAATGGCAGG - Intergenic
1116574784 14:46558874-46558896 TATTTACAAAAGCAGGAGCCAGG - Intergenic
1116883360 14:50194151-50194173 TATTTACAAAAACAGGCTGCAGG - Intronic
1117437987 14:55735583-55735605 TATTTACAAAATCAGGCAGCTGG - Intergenic
1117720549 14:58624759-58624781 TATTTATAAAAATAGGTAGAAGG - Intergenic
1117854416 14:60012637-60012659 TATTTACTAAAATAGGTGGCAGG - Intronic
1118228541 14:63926578-63926600 TATTTACAAAAGCAAGCAGCAGG + Intronic
1118427285 14:65679864-65679886 TATTTACAAAAATAGGTAGGGGG - Intronic
1119056989 14:71432507-71432529 TATTTACACAGAAAGGTGGAGGG + Intronic
1119134165 14:72201741-72201763 TATTTATAGAAACAGGTGGCAGG - Intronic
1119284930 14:73445590-73445612 TTTTTACCGAAGCAGGTGGGAGG - Intronic
1119496930 14:75087839-75087861 TATTTACAAAAACAGGCAGTGGG - Intronic
1119914964 14:78390245-78390267 TATTTACAAAAATAGGTAGTGGG - Intronic
1119958605 14:78828563-78828585 TATTTACTAAAACAAGTGGTAGG + Intronic
1120108468 14:80524010-80524032 TATTTACAAAAACAGTTGGCAGG + Intronic
1120156857 14:81102702-81102724 TATTTACAAAAACAAGGGCAAGG + Intronic
1120226506 14:81796446-81796468 TATTTACAAAATCAGGTTGTGGG + Intergenic
1120376547 14:83715360-83715382 TATTTTAAAAAACAGGTGGCAGG + Intergenic
1120456013 14:84731459-84731481 TATGTCCAAAGGCAGGTGAAGGG - Intergenic
1120520114 14:85517484-85517506 TATTTACAAAACAAGGTGGGTGG - Intergenic
1120740862 14:88107184-88107206 AATTTACAAGAACAGGTGGCAGG + Intergenic
1120980130 14:90281906-90281928 CATTTACAAGAGCTGGTGGGAGG - Intronic
1121005617 14:90489028-90489050 TATTTACAAAAACAAGTGGTGGG + Intergenic
1121276228 14:92669730-92669752 TATTTGCAAAATCAGGTGGTAGG - Intronic
1121282042 14:92705940-92705962 TATTTACAAAAACAGGTTATGGG + Intronic
1121314899 14:92955152-92955174 TATTTACAAGTGCAGGTGGCCGG - Intronic
1121478669 14:94239595-94239617 TATTCACAAAAACAGGCGGTGGG - Intronic
1121662386 14:95645192-95645214 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1121831897 14:97059963-97059985 GCTATACAAAAGCAGGTGGCAGG + Intergenic
1121864563 14:97350585-97350607 TATTTATAAAAACAGGTGGCAGG - Intergenic
1121875893 14:97452514-97452536 TATTTACAAAAACCAGTGGTGGG + Intergenic
1121962433 14:98273857-98273879 TATTTACATAAACAGATGGAGGG - Intergenic
1122393313 14:101405696-101405718 TATTTACAAAAACAGGCTGTGGG + Intergenic
1122806182 14:104259824-104259846 AATTCACAAAAGCTGGGGGAAGG - Intergenic
1123456694 15:20432775-20432797 AATTTACAAAAACAGGTGCACGG + Intergenic
1123661368 15:22567585-22567607 AATTTACAAAAACAGGTGCATGG - Intergenic
1123915538 15:25022101-25022123 TATTTACAAAAACATGTGTTAGG + Intergenic
1124161388 15:27273040-27273062 TATTTACCAAAATAGGTGGTGGG + Intronic
1124262840 15:28207917-28207939 AATTTACAAAAACAGGTGCACGG + Intronic
1124315168 15:28661817-28661839 AACTTACAAAAACAGGTGCACGG - Intergenic
1124388700 15:29232804-29232826 TATTTAAAAAAGCAGATAGCTGG - Intronic
1124879735 15:33630920-33630942 TATTTACAAAAATAGGTAGCTGG - Intronic
1125284652 15:38079369-38079391 TATTTACAAAAACAGGTGGAAGG - Intergenic
1125829980 15:42708325-42708347 TATTTACAAAAACAGGAAGCAGG - Intronic
1126251890 15:46577058-46577080 GATTTACAAAAACAAGTGGCAGG + Intergenic
1126336092 15:47587717-47587739 TATTTATAAAAACAGGTGGTGGG + Intronic
1126384877 15:48084002-48084024 TATTTATAAAAGCAGGAGATTGG - Intergenic
1126393091 15:48180105-48180127 TATTTACAAAAACAGGAGACTGG + Intergenic
1126576489 15:50202172-50202194 TATTTACAAAAACAGGTGGGAGG - Intronic
1126928175 15:53614761-53614783 CATTTACAAAATGAGGTGGGTGG - Intronic
1127167076 15:56255237-56255259 ACTTTACAAAAGCAGGGGGCAGG + Intronic
1127167333 15:56259180-56259202 TATTTACAAAAACAAATGGCAGG - Intronic
1127244185 15:57153399-57153421 TATTTACAAAAACAGGAAGCAGG + Intronic
1127670306 15:61188347-61188369 TATTTACAAAACCAGGCTGTGGG + Intronic
1127723916 15:61728736-61728758 TATTTACAAAAGCATGAGTAAGG - Intergenic
1127929914 15:63587728-63587750 TATTTACAAAACCAGGTGGCTGG + Intronic
1128231962 15:66041564-66041586 TATTTACAAAAACAAATGGCAGG - Intronic
1128589227 15:68879962-68879984 TTTTTAAAAAAGCAGGGGAAGGG - Intronic
1128626462 15:69210771-69210793 TATTTACCAAAATAGGTGGCTGG - Intronic
1128928991 15:71686851-71686873 TATTTACAAAAGCAGGTGGCAGG + Intronic
1128940383 15:71783135-71783157 TTATTACATAAGCAGGTGAAAGG + Exonic
1129173698 15:73823916-73823938 TATTTACAAAAACAGGTGGCAGG - Intergenic
1129915073 15:79262050-79262072 TATTTACAAAAACAGGTTGCAGG + Intergenic
1129930626 15:79407616-79407638 TATTTAGAAAAACAGGTGGTGGG - Intronic
1129957619 15:79653961-79653983 TATTTACAAAAACAGACCGAGGG + Intergenic
1129979143 15:79850532-79850554 TATTTACAAAAACAGGTGGAGGG + Intronic
1130134211 15:81168355-81168377 TATTTACAAAAACAGCCAGAAGG - Intronic
1130602309 15:85284623-85284645 TATTTACAAAAACAGGCAGTGGG - Intergenic
1130625204 15:85507295-85507317 TATTTACAAAAACAGGCAGCAGG - Intronic
1130766524 15:86876754-86876776 TATTTACAAAAACAGGCAGTGGG + Intronic
1130808602 15:87353221-87353243 TATTTACAGAAGCAAGGGCAAGG + Intergenic
1130918833 15:88327103-88327125 TATTTACAAAAACAAGTGGAAGG - Intergenic
1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG + Intronic
1130985351 15:88841347-88841369 TATTTACAGAAGCAAGGGGTGGG - Intronic
1131374085 15:91909280-91909302 TATTTACAAAAACAGGCAGCAGG - Intronic
1131521717 15:93121273-93121295 TATTCACAAAAACAGATGGTGGG - Intergenic
1131613237 15:93986964-93986986 TATTTACAAAAAGAGGTGGTGGG + Intergenic
1131677347 15:94684111-94684133 TATTTACACAAACATGTGGTGGG + Intergenic
1131711996 15:95065924-95065946 TATTTACAATAGCAAGGGTATGG + Intergenic
1131883102 15:96879535-96879557 TATTTACAAAAACAGGTAGAAGG - Intergenic
1133436141 16:5781672-5781694 TATTTACAAGAACTGGTGGCAGG + Intergenic
1133441707 16:5826579-5826601 TATTTACAAAAGCAAGAGCTGGG + Intergenic
1133524818 16:6594416-6594438 GAGATACAAAAGCAGGTGGTGGG + Intronic
1133610929 16:7432674-7432696 TATTTACCAAAACAGATGGTTGG + Intronic
1133616918 16:7485862-7485884 TATTTACAAAAATAGGTGATGGG - Intronic
1133851845 16:9512188-9512210 GATTTATAAAAGCAGGTGGTAGG + Intergenic
1133920177 16:10145836-10145858 TATTTACAAAGACAGGTGGCAGG + Intronic
1133964945 16:10524105-10524127 AATTTACAAAATCAGGTGGTGGG + Intergenic
1133966205 16:10533671-10533693 TATTTACAAAAACATGTGGCAGG + Intronic
1133984920 16:10661164-10661186 TATTTACAAAAACAGGCGGAGGG + Intronic
1133987955 16:10682794-10682816 TATTTACAAAAACAGATGGCGGG + Intronic
1133997005 16:10756018-10756040 TATTTACAAACACAGATGGTGGG + Intronic
1134098130 16:11433035-11433057 TATTTATAAAAACAAGTGGTGGG - Intronic
1134264129 16:12678003-12678025 TATTTACAAAAATAGGAGGAAGG + Intronic
1134266540 16:12697628-12697650 TATTTCCAGAAACAGGTGGTAGG - Intronic
1134296565 16:12951508-12951530 TATTTGCAAAAACAGGTGTTGGG + Intronic
1134349080 16:13419807-13419829 TATTTACAAAGCCAGGTGGCAGG + Intergenic
1134397732 16:13880648-13880670 TATTTACGAAAACAGGCAGAGGG - Intergenic
1134666200 16:16020465-16020487 TATTTACAAAAACAGGCAGCAGG - Intronic
1134756160 16:16669482-16669504 TATTTACAAAAACAGGTAGTGGG + Intergenic
1134768236 16:16781271-16781293 TAATAACAAAAGAAGGGGGAAGG - Intergenic
1134804037 16:17109604-17109626 TATTTACAAACACAAGTGGTGGG - Intronic
1134805032 16:17117130-17117152 TATTTACAAAAACAGGTAGTGGG + Intronic
1134824110 16:17270738-17270760 TATTGACAAAAGCAGGTGGTAGG - Intronic
1134826566 16:17289234-17289256 TATTTCTAAAAACAGGTGGAGGG + Intronic
1134843315 16:17418999-17419021 TATTTACAAAAACAGGCAGTGGG + Intronic
1134843371 16:17419489-17419511 TATTTACAAAAACAGGCAGTGGG + Intronic
1134989908 16:18689682-18689704 TATTTACAAAAACAGGTAGTGGG - Intergenic
1135035967 16:19077052-19077074 TATTTAAAGAAACAGGTGGCTGG - Intronic
1135058738 16:19253095-19253117 TATTTACAAAATCAGGAAGTGGG - Intronic
1135104570 16:19637045-19637067 TATTCACAAAAACAAGTGGCAGG - Intronic
1135121936 16:19773680-19773702 TATTCACAAAAACAGGTGGTGGG + Intronic
1135143363 16:19940386-19940408 TATTTACAAAAACAGGTAGTGGG - Intergenic
1135468725 16:22710212-22710234 TATTTAAAAAACCATTTGGAGGG + Intergenic
1135599877 16:23773691-23773713 TTTTTAAAAAAGCAGGATGAGGG + Intergenic
1135633332 16:24053439-24053461 TATTTACAAAAACAGGCAGGAGG + Intronic
1135760632 16:25135368-25135390 TATTTACAAAAACAGGCTGTGGG - Intronic
1135815247 16:25626740-25626762 TATTTACAAAAACAGGTGGCAGG + Intergenic
1135863975 16:26083624-26083646 TATTTATAAAAGCAGATGCTGGG + Intronic
1135932803 16:26753520-26753542 TATTTACAAAAACAGATGTGGGG - Intergenic
1136038376 16:27558605-27558627 TATTTACAATAGCAGGCAGTGGG - Intronic
1137278006 16:46950003-46950025 TATTTACAGAAGCAGGGGGTAGG + Intergenic
1137361157 16:47816723-47816745 TATTTACAAAAACAGGTGGCAGG + Intergenic
1137449111 16:48554348-48554370 CATTTACAAAAACAGGTGGGCGG + Intronic
1137719202 16:50618038-50618060 TATTTACAAAAACAGGAGGTGGG + Intronic
1137771371 16:51018179-51018201 TATTTACAAAAGCAGGCAGCTGG + Intergenic
1137853371 16:51768402-51768424 TATTTACAAGAACAGGTAGAGGG + Intergenic
1137950663 16:52780658-52780680 CATTTACAAAAACAGGTGGTGGG - Intergenic
1138068240 16:53964332-53964354 TATTTACTAAAAGAGGTGGCAGG + Intronic
1138187923 16:54990563-54990585 TATTTACAAAAGCAAATGGCTGG + Intergenic
1138760325 16:59535407-59535429 TATTTATAAAGGCAGCTGTAGGG + Intergenic
1138843803 16:60540253-60540275 TAAATTCAAAAGCAGATGGAAGG + Intergenic
1139286382 16:65818085-65818107 TATTTACAAACACAGGTGGTGGG - Intergenic
1139321217 16:66115990-66116012 TATTTACAAAAACAAGTAGTGGG + Intergenic
1139681947 16:68571935-68571957 TATTTGCAAGAGTTGGTGGAAGG + Intronic
1139782703 16:69364985-69365007 TATTTACAAAAACAGGCAGTAGG + Intronic
1139787882 16:69408565-69408587 TACTTACAACAGCAGGTGAGAGG + Intronic
1139844458 16:69909927-69909949 TATTTACAAAAACAGTCAGAGGG - Intronic
1140001458 16:71029277-71029299 TATTTACAAAAGCAGGCAGAGGG + Intronic
1140193822 16:72840230-72840252 TATATACAAATGAAGGTGTATGG + Intronic
1140200492 16:72890766-72890788 TATTTACAAAAACAGGCAGTGGG - Intronic
1140856725 16:78984505-78984527 TATTTACAAAAACAGGCAGCAGG + Intronic
1140864598 16:79049248-79049270 TATTTACAAAAACAAGAGGAGGG + Intronic
1140981579 16:80115005-80115027 TTTTTACAAGAACAGGTGGCAGG + Intergenic
1141092020 16:81136940-81136962 TATTTACAAAAACAGGCAGCAGG + Intergenic
1141162023 16:81635722-81635744 TATTTATAAAAACAGGTGCTGGG - Intronic
1141203978 16:81919136-81919158 TATTTATAAAAGCAGGTGGTGGG + Intronic
1141237685 16:82233912-82233934 TAGGTACAAAATCAGGGGGATGG - Intergenic
1141328801 16:83088887-83088909 TATTGACAAAAACAGGTAGTGGG - Intronic
1141373631 16:83509518-83509540 TATTTACAAAAGCAGATGGTGGG + Intronic
1141536606 16:84685555-84685577 TATTTATAATAACAGGTAGAGGG + Intergenic
1141562067 16:84876048-84876070 TATTTACAAAAGCAGGCAATAGG - Intronic
1141821389 16:86448546-86448568 TATTTACAGAAACAGGTGGTAGG + Intergenic
1141848566 16:86628224-86628246 TATTTACAAAAACAGGAGGTGGG + Intergenic
1141885163 16:86886703-86886725 TATTTACAAAAACAGGCAGCAGG - Intergenic
1141907264 16:87035232-87035254 TATTTATAAAAACACGTGGAGGG - Intergenic
1142375329 16:89703757-89703779 TATTTACAGCAGCATGGGGACGG + Intergenic
1142914894 17:3128270-3128292 TATTTAGAACAGCAGGTGGCAGG - Intergenic
1143005294 17:3828217-3828239 TATTTACAAAAACAGGCGGTAGG - Intronic
1143301290 17:5912414-5912436 TATTTGCAAAAGCAGGGGACAGG + Intronic
1143354961 17:6320582-6320604 TATTGACAAAAACAAGTGGTGGG - Intergenic
1143379276 17:6485837-6485859 TATTTACAAAAACAGGCAGTGGG - Intronic
1143823040 17:9580156-9580178 TATTTACAAAAACAGGCAGTGGG - Intronic
1143849048 17:9795699-9795721 TGTTTATAAAAGCATGTGTAGGG - Intronic
1143965985 17:10756804-10756826 TATTTATAAAAACAGGTGGCTGG - Intergenic
1143973080 17:10809819-10809841 TATTTACAAAACCAGGCAGCAGG + Intergenic
1144054548 17:11527650-11527672 TATTTACAAAAACAGATAGCAGG - Intronic
1144095453 17:11896412-11896434 TATTGACAAAAACAGATGGTGGG + Intronic
1144177939 17:12726357-12726379 TATTTACAAAAACAGGCTGCAGG + Intronic
1144352191 17:14407913-14407935 TTTTAATAAAAGCAGGGGGATGG - Intergenic
1144510386 17:15870032-15870054 TATTTACAAAAACATGTGGTGGG - Intergenic
1144511822 17:15883539-15883561 TATTCAGAGAAGAAGGTGGATGG + Intergenic
1144657590 17:17047216-17047238 TATTTACAAAAACAGGCAGCTGG + Intronic
1144712111 17:17408437-17408459 TATTTACAAGAGCTGGCAGAGGG + Intergenic
1144816003 17:18035744-18035766 TATTTACAAAAACAGGTGGCAGG + Intronic
1145174544 17:20687757-20687779 TATTTACAAAAACATGTGGTGGG - Intergenic
1145917112 17:28581102-28581124 TATTTACAAAAATAGTTGGCAGG - Intronic
1146147380 17:30432213-30432235 TATTTACAAAAACAGGTGGTGGG - Intronic
1146240801 17:31223040-31223062 TATTTACAATAGCAAGTGATAGG + Intronic
1146469770 17:33114879-33114901 CACTTACAAAAAGAGGTGGAGGG + Intronic
1146516032 17:33490080-33490102 TATTTACAGAAACAGGTAGTAGG - Intronic
1146640818 17:34540090-34540112 TATTGACAAAAACAGGTGGCAGG + Intergenic
1146898441 17:36563468-36563490 TATTTAGAGATGCATGTGGAAGG - Intronic
1147045705 17:37750508-37750530 TATTTACAAAAACAAGTAGCTGG + Intergenic
1147417524 17:40304103-40304125 TATTTCCAAAACCAGGGGAAAGG - Exonic
1147468279 17:40630425-40630447 TATTTACAAAAACAAGTGGTGGG + Intronic
1147547200 17:41411259-41411281 TATTTGCAAAAGCAGGTGGTGGG + Intergenic
1147774998 17:42894511-42894533 TGTTGAGAAAAACAGGTGGAGGG - Intergenic
1148357559 17:46985816-46985838 TATTTACAAGAACAGGTAGTGGG + Intronic
1148474530 17:47918827-47918849 TATTTACAAAAACAGGCAGGTGG - Intronic
1148705189 17:49624080-49624102 TATTTAGAAAGGCTGTTGGAGGG - Intronic
1149007072 17:51817238-51817260 TATTTACAAAAACATGTGGATGG - Intronic
1149171853 17:53821707-53821729 GATTTTGAAAAGAAGGTGGAAGG - Intergenic
1149396155 17:56246429-56246451 TAGTTACAAAAGCGGGTCAATGG - Intronic
1149479729 17:56993401-56993423 TATTTACCAGAGCAGGCGGCAGG - Intronic
1149510182 17:57234440-57234462 TATTTACAAAAACAGGTGATGGG + Intergenic
1149534026 17:57418178-57418200 TATTTACAAAAACAGGCAGCAGG + Intronic
1149577075 17:57721711-57721733 TATTTACAGAAGCAAGTGGTGGG + Intergenic
1149626970 17:58086357-58086379 ATTTTACAAAAACAGGTGGTAGG + Intronic
1150026864 17:61685232-61685254 TATTTACAAAAACAGGCAGCAGG + Intronic
1150038697 17:61834052-61834074 TATTTATAAAAGCAGGCAGCAGG + Intronic
1150107586 17:62473705-62473727 TATTTGCAAAAACAGGTTGCTGG - Intronic
1150164179 17:62925623-62925645 TATTTACAAAAACAGGCTGTAGG - Intergenic
1150192745 17:63260415-63260437 TATTAACAAAAACAGGTAGCAGG + Intronic
1150463999 17:65376287-65376309 GATTTAAAAATGCAGGTGGCTGG - Intergenic
1150473153 17:65454497-65454519 TATTTACAAAAATAGTTGGCAGG - Intergenic
1150607433 17:66706304-66706326 TATATACAAAAGCAGGTGGTTGG - Intronic
1150896770 17:69220790-69220812 TATATACAAAAACAGGTGGTGGG - Intronic
1150917712 17:69453367-69453389 TATTTACCAAAAGAGGTGGTGGG + Intronic
1150959988 17:69902336-69902358 TATTTACAAACACAGGTGTGGGG - Intergenic
1151094833 17:71485018-71485040 GCTTTACACAAGCAGCTGGAAGG + Intergenic
1151103938 17:71589977-71589999 TATTTACAATAGCAGATTCATGG - Intergenic
1151280653 17:73071798-73071820 TATTTACAAAAACAGGCAGCAGG + Intronic
1151371891 17:73652635-73652657 TATTTACAAAAACAGCTGGTGGG - Intergenic
1152017793 17:77763159-77763181 TATTTACAAAAGCAAATGATGGG - Intergenic
1152051438 17:77981718-77981740 TATTTACTAAAATAGGTGGCAGG - Intergenic
1152428786 17:80235885-80235907 TATTTACAAAATCAAGTGGTGGG - Intronic
1153197166 18:2613152-2613174 TATTTACAAAAGCCGGCTGTAGG - Intronic
1153540721 18:6151210-6151232 TATTTACAAAAATAAGTGGGTGG - Intronic
1153682142 18:7510909-7510931 TATTTACAAAACCTGGGGGTGGG - Intergenic
1153740408 18:8120167-8120189 TATTTGCAAAAGCAGGTGGTAGG + Intronic
1154046346 18:10908985-10909007 TATTTACAAAAACAGGCAGCAGG - Intronic
1155106957 18:22676553-22676575 TATTTACAAAAGTAGGCAGCAGG - Intergenic
1155110354 18:22708443-22708465 TATTTACAAACATAGGTGGTAGG - Intergenic
1155258564 18:24019700-24019722 TATTTACAAAAGCTGGTGTCAGG - Intronic
1155340109 18:24805262-24805284 TTTTTACACAGACAGGTGGAGGG - Intergenic
1155566582 18:27142066-27142088 TATTTACAAAAACAGCTGGTGGG - Intronic
1155637280 18:27970911-27970933 TATTTATAAAAATAGGTGGGAGG + Intronic
1155912581 18:31521560-31521582 CATTTACAAAAACAGGTGGCTGG + Intronic
1155992769 18:32297009-32297031 TATTTACAGAACCAAGTGGTGGG - Intronic
1156403466 18:36761076-36761098 TATTTCTAAAAGCAGGGGGAAGG - Intronic
1156409429 18:36813497-36813519 TTTTTACAAAAACAGGTGACAGG - Intronic
1156541384 18:37914863-37914885 TATTTGGAAAAGAAGGAGGAGGG - Intergenic
1156693987 18:39744363-39744385 TATTTACAAAAACAGGTAGCAGG + Intergenic
1156942247 18:42782516-42782538 TATATAGATAAGTAGGTGGAAGG + Intronic
1157005768 18:43582174-43582196 TATTCAGAAAAACAGGTGGTAGG + Intergenic
1157010031 18:43636196-43636218 TCATTACAAAAACAGATGGAGGG - Intergenic
1157665174 18:49479928-49479950 AATTTACAAAAGCACTTGGGAGG + Intronic
1157782408 18:50451318-50451340 TATTTACAAAAACAGGGGGTGGG + Intergenic
1157806149 18:50658981-50659003 TATTTACAAAAATAGGTGCTGGG - Intronic
1157964263 18:52190369-52190391 TCTTTACAAAAACAGGTGGTTGG + Intergenic
1157993431 18:52525441-52525463 TATTTACAAAAGCATGTGAGTGG - Intronic
1158179794 18:54701245-54701267 GGTTTACAAAAGCAGGTGGCAGG + Intergenic
1158383740 18:56965580-56965602 TATTTACTAAAACAAGTGGCAGG - Intronic
1158421197 18:57296169-57296191 TATTTCCAAAAGCAGACGGTGGG + Intergenic
1158452231 18:57577250-57577272 TATTTACAAAAACAGGCAGTAGG - Intronic
1158614259 18:58971439-58971461 TATTTACAAAAACAGGTGGCAGG - Intronic
1158746061 18:60201350-60201372 TAAGAACAAAAGGAGGTGGAGGG + Intergenic
1158887478 18:61841984-61842006 TATTTACAAAAACATGAGGTGGG + Intronic
1159063711 18:63544220-63544242 TATTTACAAAAACAGGCAGAGGG + Intergenic
1159350870 18:67270865-67270887 TATTTACAAAAGCAAATTTATGG + Intergenic
1159401423 18:67940821-67940843 CATTTAGAAAAGAAGATGGATGG + Intergenic
1159447751 18:68560889-68560911 TATTTACAAAATCAGGCAGAGGG + Intergenic
1159520216 18:69510379-69510401 TATTTACAAAAGCAAATTTATGG - Intronic
1159729501 18:72007716-72007738 TATTTTAAGAATCAGGTGGAGGG + Intergenic
1160012830 18:75119594-75119616 TATTTACAAAAACAAGTGATGGG + Intergenic
1160702585 19:515162-515184 TATTTACAAAAGCAGGCAGCAGG + Intronic
1160745038 19:707417-707439 TATTTACAAAAACAGGCAGAGGG - Intergenic
1160745053 19:707500-707522 TATTTACAAAAACAGGCAGTGGG - Intergenic
1161020221 19:2006666-2006688 AATTTACAAAAACAAGTGGTGGG - Intronic
1161144496 19:2669553-2669575 TATTGACGAAAGCAAGTGGTGGG - Intronic
1161202396 19:3022949-3022971 TATTTGCAAAAACAAGTGGAGGG + Intronic
1161235792 19:3197408-3197430 TATTTACAAAAGCAGGTAGAGGG - Intronic
1161536539 19:4822537-4822559 TATTTATAAAAGCAATTGGCTGG - Intronic
1161585983 19:5105891-5105913 TATTCACAAAAACAAGTGGCAGG + Intronic
1161597019 19:5155762-5155784 TATTGACAAAAACAGGTGGCGGG - Intergenic
1161634750 19:5380711-5380733 TATTTACAAAAACAAGTAGGGGG - Intergenic
1161652349 19:5493049-5493071 TATTGACAAAGGCTGGTGGGGGG + Intergenic
1161743993 19:6043532-6043554 TATTTACAAAAACAGGCAGTGGG - Intronic
1161862158 19:6806068-6806090 CATTTACAAAAACAGGTGGCAGG - Intronic
1161882911 19:6969697-6969719 TATTTACAAAAACAGAAGGTGGG + Intergenic
1161883701 19:6976356-6976378 TATTTACAAAAGCAGGTGGCAGG - Intergenic
1161910447 19:7189584-7189606 TATTTATAAAAGCAAGTGATGGG + Intronic
1161921142 19:7267025-7267047 TATTTACAAAAACAAGTCGTGGG - Intronic
1162794796 19:13081413-13081435 TATTTACAAAAACAAATGGCTGG + Intronic
1162846245 19:13394942-13394964 TTTTTACAAAGAAAGGTGGAGGG - Intronic
1162991553 19:14305939-14305961 TATTTACAAAAACAGGTGGTGGG - Intergenic
1163084535 19:14969772-14969794 TATTTACAAAAGCAGGCAGAGGG - Intronic
1163401727 19:17097959-17097981 TATTTATAAAAACAGGTGGTGGG + Intronic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1163472173 19:17504100-17504122 TATTTACAAAAACAGGTGGAGGG + Intronic
1163649445 19:18508813-18508835 TATTTACAAAGACAGGTGGCAGG + Intronic
1164680755 19:30132276-30132298 TATTTAACAAGGAAGGTGGAGGG + Intergenic
1164956167 19:32387793-32387815 TATTTGCCAAAACAGGTGGCAGG - Intergenic
1165587400 19:36930976-36930998 TATTCACAAAAGCAGCAGAAAGG - Intronic
1165662912 19:37597884-37597906 TATTTACAAAAACATATGGGCGG + Intronic
1165663330 19:37602412-37602434 TATTTACAAAAACAGGTAGTAGG - Intronic
1166322759 19:42028792-42028814 TATGTACAAAGGCAGGCAGATGG - Intronic
1167114634 19:47481627-47481649 TATTTACAAAAACAGATGGTGGG - Intronic
1167261414 19:48461018-48461040 AATTTAAAAAAGAAGGTGGCTGG + Intronic
1167355643 19:49002362-49002384 TATTTGCAAAAACAGGTGGCTGG + Intronic
1167565198 19:50251893-50251915 TATTTGCAAAAAGAGGTGGCAGG + Intronic
1168275423 19:55275247-55275269 TATTTACAAAAACAGGAGGTGGG - Intronic
925321265 2:2971088-2971110 CATTAACAAAAGCATGTGCACGG + Intergenic
925354943 2:3234059-3234081 TATTTACACAAGCAGGCAGCAGG + Intronic
925363868 2:3297731-3297753 TATTCACAAAACCAGGTAGTGGG + Intronic
925671626 2:6316006-6316028 TATTTACAAAAACAGGTAGAGGG + Intergenic
926444629 2:12927197-12927219 TATTTATAAAAGCAGGTAGGAGG - Intergenic
926588548 2:14715795-14715817 TATTTACAAAGACAGATGGCTGG + Intergenic
926665821 2:15521805-15521827 TATTTACAAAAATAGATGGTGGG - Intronic
926736820 2:16079802-16079824 TATTTACAGAACCTGGTGGTGGG + Intergenic
926802968 2:16677855-16677877 TATTTATAAAAACAGGTTGTGGG - Intergenic
926986299 2:18628144-18628166 TGTTTACAAAAACAGGTGATAGG + Intergenic
927173505 2:20389653-20389675 TATTTACAAAACTAGGTGGTGGG + Intergenic
927364625 2:22279696-22279718 TATTTACAAAAGCAGGCTGTGGG - Intergenic
927612148 2:24551563-24551585 TATTTACAAAAACAAGTAGTGGG - Intronic
928190357 2:29159827-29159849 TATTTACAAAAACAAGTGGTAGG - Intronic
928223859 2:29430555-29430577 TATTTATAAAACCAGGTGGCTGG + Intronic
928224215 2:29433670-29433692 AATTTACAAAACCAGGTGGCTGG + Intronic
928406881 2:31021600-31021622 TATTTATAAAAGCAGCTGGCTGG - Intronic
928450413 2:31373327-31373349 TATTTACAAAAACAGGCAGTGGG - Intronic
928501107 2:31896505-31896527 TATTTACAAAAGTAGGCTGTGGG + Intronic
928649865 2:33392605-33392627 TATTTACAAAAATAGGTAGCAGG + Intronic
928868985 2:35952329-35952351 CATTTACAGAAGCAGGTTGTGGG - Intergenic
928909105 2:36400691-36400713 AATTTACACAAGAAGGTGAAGGG + Intronic
929063193 2:37944455-37944477 TATTTACAAAAACAGGTGGCTGG + Intronic
929095068 2:38255404-38255426 TTTATACAAAAACAGGTGGTGGG + Intergenic
929260109 2:39857121-39857143 TATTTACAAAAACAAGTGGCAGG + Intergenic
929413635 2:41725214-41725236 TATTTACAAAAACAGGTGGTGGG - Intergenic
929849387 2:45570019-45570041 TATTCACAAAAACAGGTGGCAGG - Intronic
929984538 2:46714649-46714671 TATTTACATAAACAGGTGGCAGG - Intronic
930022567 2:47010334-47010356 TATTTACAAAAATAGGCAGAGGG + Intronic
930772864 2:55145076-55145098 TATTTACAAAAACAGGCAGCAGG - Intergenic
931029140 2:58151825-58151847 TATTTACAAAAATAGGTGGTTGG - Intronic
931106623 2:59063726-59063748 TATTTACAAAAACAGGCAGTGGG - Intergenic
931626885 2:64264333-64264355 TATTTAAAACAGCAGGAGGTGGG + Intergenic
931800133 2:65750086-65750108 TATTTAGAAAACCAGGCGGTGGG + Intergenic
931817273 2:65916963-65916985 TATTTACAAAAACAGGCAGAAGG - Intergenic
931878272 2:66538547-66538569 TACTCACAAATGCAGGTTGAGGG + Intronic
932097818 2:68867121-68867143 TATTTCCAAAAGCAGGTAGCAGG - Intronic
932114168 2:69030964-69030986 TATTTACAAAAACAGGCTGCAGG - Intronic
932417417 2:71581834-71581856 TATTTACAAAAGCAGGCAGAGGG - Intronic
932818609 2:74881044-74881066 TATGTACAAAAACAGGTGGTGGG - Intronic
932844863 2:75124729-75124751 TATTTACAAAAACAGGAGGTAGG + Intronic
932858427 2:75263469-75263491 TATTTGCAAAAACAGGTGGCAGG - Intergenic
932881989 2:75510900-75510922 TATTTACAAAAACATATGGCTGG - Intronic
932901498 2:75705957-75705979 TGTTTACAAAAACAGGTGGTGGG + Intronic
932923708 2:75945543-75945565 TATTTATAAAACCAGGTGGCAGG + Intergenic
933147643 2:78874537-78874559 TATTTGCAAAATCAGGTAGTGGG + Intergenic
933150122 2:78904337-78904359 TATTTACAAAAGCAGGTGGTAGG - Intergenic
933216175 2:79632973-79632995 TATTTACAAAAGCAAGTGCTGGG + Intronic
933259245 2:80113531-80113553 TATTTACTAAAACAGGTGGTGGG - Intronic
933555772 2:83828198-83828220 CATTTGCAAAAGTAGGTGGGAGG - Intergenic
933612205 2:84448259-84448281 AATTTACAAAACCAGGTAGTGGG - Intronic
933627563 2:84618952-84618974 TATTTACAAAAACAGGTGGTGGG + Intronic
934648805 2:96075566-96075588 TATTTACAATAGCAGGCAGCAGG + Intergenic
934724930 2:96610202-96610224 CATTTAGAAAATCAGGTGAAGGG + Intronic
935016485 2:99187493-99187515 TATTTACAAAAATAGGTGGGAGG - Intronic
935043338 2:99455890-99455912 TTTGTGAAAAAGCAGGTGGAGGG - Intronic
935205545 2:100893730-100893752 TATTTACGAAAACAGGTTGTGGG - Intronic
935451344 2:103213288-103213310 TATTTACAAAAGCAGGCAACAGG - Intergenic
935787533 2:106562434-106562456 TGTTTACAAAAGCACTTGGCAGG - Intergenic
935811321 2:106800360-106800382 TATTTACAAAAGTAGGCTGTGGG + Intergenic
936069396 2:109355418-109355440 TATTTACAAAAACAGTTGGCAGG - Intronic
936603903 2:113928711-113928733 TTTTTACCAAAACAGGTGGTGGG + Intronic
936755230 2:115700833-115700855 TATTTACAATAGCATGAAGAAGG + Intronic
936866497 2:117080708-117080730 TCTTTACAAAAACAGTTGGTGGG - Intergenic
936933787 2:117818292-117818314 TATTTACAAAAACAGGTAGAAGG - Intronic
936960471 2:118068651-118068673 TATTTATAAAAATAGGTGGTAGG + Intergenic
936986716 2:118318074-118318096 TATTTACAAAAACAGGAAGAGGG + Intergenic
937146612 2:119651287-119651309 TATTTACAAATACAGGTGGTGGG - Intronic
937178590 2:119968143-119968165 TATTTACAAAAACAAGTGGCAGG - Intronic
937289623 2:120774266-120774288 TATTTACAAAAACAGCAGGGAGG - Intronic
937636341 2:124159444-124159466 TATTTACAAAAATAGGTGGCAGG + Intronic
938241585 2:129746462-129746484 GATTTCCAAAAGCAGGAGGGAGG + Intergenic
938748260 2:134302186-134302208 TATTTACAAAAACAGGCAGTGGG + Intronic
938835293 2:135096394-135096416 TATTTGCAAATGCAGGTAAACGG + Intronic
939159675 2:138572616-138572638 TTCTTACAAAAGAAGGTGGGTGG + Exonic
939191245 2:138918842-138918864 TATTTATAAAAGCAGATGGTGGG + Intergenic
939442604 2:142269088-142269110 TCTTGACAAAAGCAGTTGAAAGG + Intergenic
939558939 2:143711039-143711061 TATTGACAAAAACAGGAGGCAGG - Intronic
939815336 2:146889028-146889050 TATTTACAAAAATAGGTGACTGG + Intergenic
940153133 2:150624915-150624937 TATTTACAAAAACAGGAAGCTGG - Intergenic
940368381 2:152874320-152874342 TATTTACAAAACCAGGCTGTGGG + Intergenic
941841261 2:170087261-170087283 AATTTACAAAAGCAGGCCGTAGG + Intergenic
942546718 2:177072830-177072852 TATTTACAAAAGCAGCATGCTGG - Intergenic
942624186 2:177881691-177881713 TATTAATAAAAACAGGTGGTAGG - Intronic
942649547 2:178152176-178152198 TATTTACAAAAGCAGGCGACAGG - Intergenic
942751681 2:179294918-179294940 TATTTACAAAAGCAGGCCCTGGG - Intergenic
942866444 2:180681300-180681322 TATTTACAAAAACAGATAGCAGG - Intergenic
943228818 2:185217122-185217144 TATTTCTAAAAGCAAGTGAAAGG + Intergenic
943519982 2:188936826-188936848 TATTTACAAAAAAAGGTTGCTGG + Intergenic
943824470 2:192371726-192371748 TATTCACAAAAACAAGTTGACGG - Intergenic
943908780 2:193535389-193535411 TACTTACAAAAACAGATGAAGGG - Intergenic
944238289 2:197460875-197460897 TATTTACAAAAACAGGCGATGGG + Intronic
944268778 2:197758602-197758624 TATTTACAAAAACAGGCTGCTGG + Intronic
944495361 2:200302391-200302413 TATTTACAAAAACAGGCAGTGGG - Intergenic
944615593 2:201456210-201456232 TACTCACAAAAACAGGTGGTGGG + Intronic
944643763 2:201756547-201756569 TATTTACAAAAACATATGGTAGG - Intronic
944657707 2:201892407-201892429 TATTTTCTTAAGCAGCTGGAAGG + Intronic
944689275 2:202145270-202145292 TATTTACAAAACCAGAGGGGTGG - Intronic
944854329 2:203752004-203752026 TGTTTTCAAAAGCAGTTGTAAGG + Intergenic
945396206 2:209321897-209321919 TATTTACAAAAACAGGTAGCTGG - Intergenic
945541043 2:211087159-211087181 TTGTTACAAAAACAGGTGGAAGG + Intergenic
946041825 2:216789308-216789330 TATTTACAAAAACAGGTGGTGGG + Intergenic
946476646 2:220012408-220012430 TATTTACAAAAATAGATGGTGGG - Intergenic
946842101 2:223829299-223829321 TATTTACAACAACAGGCAGAAGG - Intronic
947111891 2:226727445-226727467 TATTTACAAAAACAGGCAGCAGG + Intergenic
947199413 2:227601194-227601216 TGTGTACAAAAGCAGGTGGCAGG + Intergenic
947923378 2:233899166-233899188 TGGTCACAAAAGCATGTGGAGGG - Intergenic
947997055 2:234536807-234536829 TATTTACAAAATCAGGCAGTGGG + Intergenic
948134537 2:235626861-235626883 TATTTACAAAAACACATGGTGGG + Intronic
948241813 2:236444306-236444328 TATTTTTAAAGGCAGGTGTATGG + Intronic
1168857323 20:1017836-1017858 TATTTATAAAAACAGATGGTGGG - Intergenic
1169034089 20:2435613-2435635 TACTTACAAAAACAGGTGGCAGG + Intergenic
1169104017 20:2978834-2978856 TATTTACAAAAACAGGCAGTGGG + Intronic
1169113586 20:3048210-3048232 TATTTACAAAAACAGGAAGCAGG - Exonic
1169634793 20:7677468-7677490 TATTTACAAAAGGAGGAAGGGGG - Intergenic
1169649951 20:7855856-7855878 TATTTACAAAGACAGGTGATTGG - Intergenic
1169672869 20:8123617-8123639 TATTTACAAAAACAGGTAGCAGG - Intergenic
1169776163 20:9255827-9255849 TATTTGCAAAAATAGGTGGCAGG + Intronic
1169809031 20:9590397-9590419 TATTTACAAAAACAGGCAGAGGG - Intronic
1169839382 20:9918164-9918186 CATTTACAAAAATAGGTGGTGGG - Intergenic
1169921464 20:10738864-10738886 CATTTACAAAAACAGGTGGGGGG + Intergenic
1170175265 20:13461685-13461707 TGTTTACAAAATCAGTTGGTAGG + Intronic
1170231677 20:14054299-14054321 GAATTCCAAAAGCAGGTGGATGG + Intronic
1170415172 20:16132079-16132101 TATTTACAAAATCAGGTGGTAGG - Intergenic
1170420748 20:16190442-16190464 TATTTACAAAAACTGGTGGTAGG + Intergenic
1170594558 20:17795202-17795224 TATTTACACAAACAGGCAGAGGG + Intergenic
1170819621 20:19745295-19745317 TATTGACAAAAACAGGTGGCAGG + Intergenic
1170853346 20:20023992-20024014 TATTTACAAAAACAGGCAGTGGG - Intronic
1172421361 20:34821318-34821340 TATTTACAAAAACAGATCGTGGG + Exonic
1173003178 20:39120112-39120134 TATTTACAAAAACAGATGGTGGG - Intergenic
1173042818 20:39480493-39480515 TATTTACAAAAACAGGCACATGG + Intergenic
1173150673 20:40564149-40564171 TATTTACAAAAACAGGCAGTGGG + Intergenic
1173319334 20:41973444-41973466 TATTTACAAAAACAGGCAGCAGG + Intergenic
1173325366 20:42027969-42027991 TATTTACAAAATCAGGCAGAGGG + Intergenic
1173340058 20:42145198-42145220 TATTTACAAAAATAGGTGTTGGG + Intronic
1173373376 20:42460306-42460328 TATTTACAAAAACAGGCAGCTGG - Intronic
1173403841 20:42748038-42748060 TATTTACAGAAACAGGCAGAGGG - Intronic
1173408351 20:42786975-42786997 TATGTGCAAAAACAGGTGGTGGG - Intronic
1173421109 20:42901852-42901874 TATTTACACAAACAGGAGGCAGG - Intronic
1173434123 20:43017180-43017202 TATTGACAAGAACAGGTGGCTGG + Intronic
1173447958 20:43137323-43137345 TATTTACAAAAAAAGGCAGAGGG - Intronic
1173622403 20:44446534-44446556 TATTTACAAAAGTAGGCAGTAGG + Intergenic
1173636760 20:44566169-44566191 TATTTACAAAAACAAGTGGCAGG - Intronic
1173899425 20:46576312-46576334 TATTTACAAAAGCAGGTGGTGGG + Intronic
1173945637 20:46948340-46948362 TATTTATAAAAGCAGGCGGTGGG + Intronic
1173955580 20:47030084-47030106 TATTTACAAAAGCAGGTGGTGGG + Intronic
1174041969 20:47706531-47706553 TATTTACTAAAACAAATGGAGGG + Intronic
1174190054 20:48734227-48734249 TATTTACAAAAACAGGCAGAGGG - Intronic
1174307681 20:49626005-49626027 TATTTACAAAAACAGGTGGGTGG - Intergenic
1174409397 20:50324108-50324130 TATTTACAAAAACAGGTGGTGGG + Intergenic
1174529300 20:51198437-51198459 TATTTGCAAAATCAGGTAGTAGG + Intergenic
1174542356 20:51299606-51299628 TATTTATAAAAACAGGTGGTAGG - Intergenic
1174645602 20:52082723-52082745 ACTTTACAAAAACAGGTGGCAGG - Intronic
1174670898 20:52306708-52306730 TATTTAGAAAAATAGGTGGTGGG + Intergenic
1174677154 20:52369596-52369618 TATATTCAAAAGGAGGTGGTGGG + Intergenic
1174681348 20:52411758-52411780 TACTGACAAAAACAGGTGGCTGG - Intergenic
1174733483 20:52941115-52941137 TATTTATAAAAACAGGTTGTAGG + Intergenic
1174749071 20:53094052-53094074 TACTTACAAAAAAAGGCGGAGGG - Intronic
1174770019 20:53290845-53290867 TATTTACAGAAACAGGTGGTAGG - Intronic
1174781250 20:53391034-53391056 TATTTACAAAAACAGGCAGCTGG + Intronic
1174823409 20:53746908-53746930 TATTTATAAAAACAGATGGTGGG + Intergenic
1174891564 20:54400617-54400639 TATTTACAAAAGCAGGTGCGAGG + Intergenic
1174997909 20:55591449-55591471 TACTTAAAAAATCAGGAGGACGG + Intergenic
1174999846 20:55615429-55615451 TATTTACAAAAACAGGCAGTGGG - Intergenic
1175003883 20:55661644-55661666 TTGTTAAAAATGCAGGTGGAAGG - Intergenic
1175049493 20:56141281-56141303 TGTTTACAAAACCAGGTGACAGG - Intergenic
1175095261 20:56536007-56536029 TATTTACAAAAACAGGTGGAGGG + Intronic
1175143720 20:56880324-56880346 GATTTATAAAAGCAGGAGGAAGG - Intergenic
1175148533 20:56914722-56914744 TATTTACAAAAGCAGACAGCTGG + Intergenic
1175178926 20:57131240-57131262 TATTTACAAAAACAGGCAGTGGG - Intergenic
1175255816 20:57646589-57646611 TATTTACAAAAACAGGCAGCTGG + Intergenic
1175348902 20:58303733-58303755 TATTTACAAATACAAGTGGTGGG - Intergenic
1175350377 20:58313783-58313805 TATTTACAAAAGCAGGAGGCGGG - Intronic
1175354081 20:58348629-58348651 TATTTACAAAAACTGGTGGCAGG - Intronic
1175376628 20:58530972-58530994 TATTTACAAAAACAGGCGGTGGG + Intergenic
1175763279 20:61575613-61575635 TATTTACAAATACAGGCAGAGGG - Intronic
1175796673 20:61775564-61775586 TATTTACAAAAACAGGGAGTGGG + Intronic
1175803775 20:61815942-61815964 AATTTACAAAAGAAGGTTTAAGG + Intronic
1176859958 21:14006389-14006411 TATTTACAATAGCAAGTGATAGG + Intergenic
1177146770 21:17415134-17415156 TGGTTAGAAAAGCAGGGGGAGGG - Intergenic
1178269951 21:31180463-31180485 TATTTACAAAAACAGGTGGTGGG + Intronic
1178296122 21:31411787-31411809 TATTTACAAAAACAGATGACAGG + Intronic
1178302153 21:31462275-31462297 TATTTACAAAAACAGGCCCATGG + Intronic
1178337562 21:31757417-31757439 TATTTATGAAAGCAGATGGTGGG - Intergenic
1178430687 21:32516382-32516404 TATTTACAAAAACAGGTTACAGG - Intergenic
1178537435 21:33421905-33421927 TATTTACAAAAACAAGTGGTGGG - Intronic
1178576772 21:33799784-33799806 TGTTTACAAAAAAAGGTGGGGGG - Intronic
1179415491 21:41195091-41195113 TATTTATAAAAACAGGTAGCTGG - Intronic
1179472980 21:41624114-41624136 TATTTACAAAAATAGGCGGCAGG - Intergenic
1179515255 21:41901996-41902018 TATTTACAAAAACAAGTGACGGG + Intronic
1179589100 21:42393820-42393842 TATTTACAAAAGAAGGGGGTGGG + Intronic
1179987464 21:44929667-44929689 TATTGACAAAAACAGGTGGAGGG + Intronic
1180653880 22:17402526-17402548 TATTTATAAAAACAGGTGGTAGG + Intronic
1181336133 22:22131171-22131193 TATTTACAGAAACAAGTGGTGGG + Intergenic
1181729514 22:24834371-24834393 TATTCACAAAAACCAGTGGAAGG - Intronic
1181734626 22:24871976-24871998 TATTTACAAAAACAGGTGAGTGG - Intronic
1181955005 22:26581963-26581985 TATTTACAAATACAGGTAGCGGG + Intronic
1181983788 22:26784972-26784994 TATTTACAAACACAGGTGGTTGG + Intergenic
1182040039 22:27231125-27231147 TATTTACAAAAACAGGCAGCTGG + Intergenic
1182117403 22:27764897-27764919 TATTTACAAAAACAGGGAGTGGG - Intronic
1182527639 22:30931243-30931265 TATTTACAAAAACACTTGGCAGG - Intronic
1182541299 22:31044109-31044131 TAATTACAAAAGAAGGTGCTGGG - Intergenic
1182677593 22:32051892-32051914 TATTTGCAAAAATAGGTGGAGGG + Intronic
1182720300 22:32392916-32392938 TATTTTAAAAAGCAGGTGGTGGG - Intronic
1182742549 22:32578954-32578976 TATTAACAAAATCAGGTTGTGGG + Intronic
1183502200 22:38187523-38187545 TGTTTACAGAAACAGGTGGCAGG - Intronic
1184619639 22:45666580-45666602 TATTTACGAAAATAGGTGGCGGG + Intergenic
1184818038 22:46886894-46886916 TATTTACACAAATAGGTGGTGGG + Intronic
1185191736 22:49441894-49441916 TATTTACAAAAATAGAGGGAAGG - Intronic
949326832 3:2875490-2875512 TATTTACAAAAATAGGTGGTGGG - Intronic
949519280 3:4835010-4835032 TATTAATAAAAGCTTGTGGAAGG - Intronic
949840723 3:8316790-8316812 TATCTACAGAAACAGGTGGTGGG - Intergenic
949864553 3:8536813-8536835 TATTTACAAGAGCAGATTGTGGG + Intronic
949867217 3:8555935-8555957 TATTTACATAAACAGGCGGTGGG + Intronic
949869647 3:8577209-8577231 TATTTACAAAATCAGGAGGTGGG + Intergenic
950159379 3:10748239-10748261 TATTTACAAAAACAGGCAGTGGG + Intergenic
950461325 3:13123920-13123942 TATTTACAAAAGCAAGCCGCAGG - Intergenic
950775538 3:15346694-15346716 TATTTACAAAAACAGGCAGTGGG - Intergenic
950871875 3:16236450-16236472 TATTTACAAACACAGGTGGTTGG + Intergenic
950897281 3:16464666-16464688 TATTTACAAAACCAGGCAGTGGG - Intronic
950985819 3:17365272-17365294 TATCTAGAAAGGCATGTGGATGG + Intronic
951041417 3:17992608-17992630 TATTAACAAAACAAGGTGGTGGG + Intronic
951099414 3:18669398-18669420 TAGATATGAAAGCAGGTGGAGGG - Intergenic
951106911 3:18755065-18755087 TATTTACAAAAACAGGCAGTAGG - Intergenic
951142936 3:19188463-19188485 TATTAACAAAAACATGTGGTGGG + Intronic
951366736 3:21792385-21792407 TATTTAGAAAAACAGGTGGCAGG - Intronic
951409161 3:22341283-22341305 TATTTACAAAAGCAGGTGGCAGG - Intronic
951569915 3:24051020-24051042 TATTTACAAAAGCAGGTTGCAGG + Intergenic
951590327 3:24257696-24257718 TATTTACAAAAACAGGCAGTGGG + Intronic
951682336 3:25307839-25307861 TATTTAGAAAAGCAGGTTTGGGG - Intronic
951702052 3:25506729-25506751 TATTTACAAAAGCAGATGAAGGG + Intronic
952027787 3:29104028-29104050 TATTTACAAAAACAGGTGGCAGG + Intergenic
952033103 3:29168241-29168263 TATTTACAAAAGCAGGCAGTGGG - Intergenic
952037388 3:29219443-29219465 TATTTGCAAAAACAGGTGGCAGG + Intergenic
952286172 3:31971746-31971768 TATTTATAAAAGCTGGCGGTGGG - Intronic
952337076 3:32413052-32413074 TATTTACAAAAACAGGTGGCAGG - Intronic
952606487 3:35153518-35153540 TATTTAAAAACTCATGTGGAAGG - Intergenic
953332176 3:42063114-42063136 TATTTATAACAGCAGGCGGTGGG - Intronic
953454979 3:43033676-43033698 AAATTACAAAAGCAGGTGCTTGG - Intronic
953516708 3:43600130-43600152 TATTTATAAAACCATGTGGCAGG - Intronic
954535569 3:51357040-51357062 TATCAACACAAGCAGGTGCATGG + Exonic
954593349 3:51803128-51803150 TATTTCTAAAAACAGGTGGTGGG - Intergenic
954857010 3:53652745-53652767 TATTTATAAAAATAGGTGGCAGG - Intronic
954939676 3:54360089-54360111 TATTTACAAAAAAAGGTGGGGGG - Intronic
954963989 3:54594328-54594350 TATTTAAAAAAATAGGTGGCAGG + Intronic
954997334 3:54893720-54893742 TACTTCCAAATGCAGGTGGCGGG - Intronic
955028886 3:55197452-55197474 AATTTACAAAAGCAGGCTGCAGG - Intergenic
955029636 3:55203847-55203869 TTTTTAAAAAAGCAGAGGGAGGG + Intergenic
955120392 3:56052416-56052438 TGTTTACAAAAACAGGTGGTGGG - Intronic
955121556 3:56064821-56064843 TATTTACAAAAACAGGCAGTGGG - Intronic
955128343 3:56137653-56137675 TATTTACAAAAGCAGGCTCAGGG + Intronic
955144734 3:56305777-56305799 TATTTACAAAAGCAGGCAAAAGG - Intronic
955198889 3:56831580-56831602 TATTTACAAAAGCAGACAGTGGG + Intronic
955423746 3:58766252-58766274 TATTTACAAAAACAGGCAGTGGG + Intronic
955459557 3:59166084-59166106 TATTTGCAAAAGTAGGCTGAAGG - Intergenic
955486279 3:59438060-59438082 TATTTACAAAAGCAGGTGGCAGG - Intergenic
955543245 3:60000320-60000342 TATTTGTAAAAGCAGATGGTGGG - Intronic
955746334 3:62144026-62144048 TATTTACAAAAGCAAGCAGTGGG - Intronic
955806666 3:62743287-62743309 TATTTACAAAAGCAGGCAGCTGG - Intronic
955844932 3:63152475-63152497 TATTTATAAAAACAGATGGCAGG + Intergenic
955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG + Intronic
955973079 3:64455364-64455386 TGTTTACAAAAGCAGGCAGTAGG + Intergenic
956001346 3:64733233-64733255 TATTTACAAAAACAGATGGTAGG + Intergenic
956184451 3:66549313-66549335 TATTTACTAAAGAAGGCAGAGGG + Intergenic
956507783 3:69961083-69961105 TATTTATAAAAGCAGCTTGTGGG + Intronic
956518587 3:70078953-70078975 TATTTACAAAAACAGGCAGTGGG - Intergenic
956732927 3:72213464-72213486 TATTTACAAAAACAGGCTGCAGG - Intergenic
956887340 3:73573459-73573481 TATTTAATAAAACAGGTGGTGGG - Intronic
956893680 3:73638239-73638261 TATTTACATAAACAGGTAGTGGG - Intergenic
956991231 3:74768205-74768227 TATTTACAAAAACAGGCAGCAGG + Intergenic
957051450 3:75415298-75415320 GATTTACAAAAGCAGGAGACTGG - Intergenic
957321994 3:78643297-78643319 TATTTACAAAAACAGGTGGCAGG + Intronic
957472958 3:80683157-80683179 TATTTACAAAAACAGGAAGTGGG + Intergenic
957541739 3:81579955-81579977 TATTTACAAAAACAGGCAGCAGG + Intronic
958065489 3:88540442-88540464 TATTTAAAAAACAAAGTGGAGGG - Intergenic
958118557 3:89255418-89255440 TATTTACAAAAACAAGTGGCAGG - Intronic
958911682 3:100001244-100001266 TATTTACAAAAACAGATTAAGGG - Intronic
959066874 3:101666441-101666463 TCTTTACAAAAGCGGAAGGAGGG + Intronic
959381436 3:105645498-105645520 AATTTACAAAATCAGGAAGATGG + Intergenic
959410330 3:106013300-106013322 TATTTACAAAAACAGGTGATTGG + Intergenic
959465590 3:106682309-106682331 TATTTACAAGACTAGTTGGAGGG - Intergenic
959782683 3:110255124-110255146 TATTTAGAAAAAAAGGTTGAGGG - Intergenic
959822091 3:110747750-110747772 CATTGAGAAAAGCAGGTGAACGG + Intergenic
960032504 3:113069103-113069125 TATTTACAATAGCAAATGCATGG + Intergenic
960135860 3:114104054-114104076 TATTTACCAAAACAGGCAGAGGG - Intergenic
960508893 3:118525125-118525147 TAGTTACAAAAACAGGAGGCTGG + Intergenic
960651569 3:119957017-119957039 TATTTACAAACACAGGTGGCTGG + Intronic
960799175 3:121520728-121520750 TATTTACAAAAACAGATGGTAGG + Intronic
960981896 3:123237133-123237155 TATTTACAAAAATAGATGGTGGG + Intronic
961014993 3:123460907-123460929 TATTTACAAAAATAGGTAGTGGG - Intergenic
961065517 3:123872080-123872102 TATTTACAAAAACAGGCTGCAGG - Intronic
961104375 3:124228623-124228645 TATTTATAAAAACTGGTGGATGG - Intronic
961303029 3:125934296-125934318 GATTTACAAAAGCAGGAGACTGG + Intronic
961332789 3:126152969-126152991 TAATAACAAGAGCAGGTGGCCGG + Intronic
961409662 3:126710082-126710104 TATTTACAAAATCAATTGGTGGG + Intronic
961435603 3:126914396-126914418 TATTCACAAAAACAGGTGGCAGG + Intronic
961633754 3:128320077-128320099 TATTTATCAAAACAGGTGGCAGG - Intronic
961885043 3:130091489-130091511 GATTTACAAAAGCAGGAGACTGG - Intronic
962056792 3:131880532-131880554 TCTTTAAAAAGGCAGTTGGATGG - Intronic
962101559 3:132347988-132348010 TATTTACAAAACCAGGTAGTGGG - Intronic
962118155 3:132533903-132533925 TAGTTACTAAAGCATGTGGATGG - Intronic
962425957 3:135269687-135269709 TATTGATAAAAACAGGTGGAGGG + Intergenic
962485068 3:135834332-135834354 TATTTACAAAAGCAGGGAGCAGG - Intergenic
963127160 3:141826926-141826948 TATTTACAAAAACAGGCAGTAGG + Intergenic
963568008 3:146954888-146954910 TATTTACAACAGCAGGTGGTGGG - Intergenic
963836093 3:150059508-150059530 TCTTTATAAAATCAGGTGGCAGG + Intergenic
964097891 3:152954557-152954579 TATTTACAAAAACAGGCAGTGGG + Intergenic
964397552 3:156261759-156261781 TTTTTACAAAAGCAGTTGCTGGG + Intronic
964531866 3:157677054-157677076 TACTGACAAAAGCAGGAGGAAGG + Intronic
964624374 3:158745354-158745376 TATTGACAAAAGCATGTCGTAGG + Intronic
964842387 3:161008164-161008186 TTTTTACACAAAAAGGTGGAGGG - Intronic
964864383 3:161239904-161239926 TATTTACAAAAACAGATGGTGGG + Intronic
964896255 3:161599933-161599955 TATTTACAAAAACAGGCAGCAGG - Intergenic
964997965 3:162910974-162910996 TATTCACAAAAATAGGTGGCAGG - Intergenic
965375684 3:167920950-167920972 TATTTACAAAATGATGTGGCAGG + Intergenic
966005990 3:175012636-175012658 TACTTACAAAAACAGGTGGTGGG - Intronic
966294570 3:178404401-178404423 TACTTACAAAAACAAGTGGCAGG - Intergenic
966554611 3:181244921-181244943 TATTTACAACAGCAAGGGCATGG + Intergenic
967249897 3:187526631-187526653 TGTTTACAAAAACAGGTGATGGG - Intergenic
967267220 3:187701407-187701429 TATTTACAAAATGAGGGGGTTGG - Intronic
967404770 3:189103165-189103187 TATTTACAAAAACAAGTGGCAGG - Intronic
967549186 3:190769905-190769927 TATTTACAAAAACAAGTGGCGGG - Intergenic
967822842 3:193854137-193854159 TATTTACAAAAACAGGCAGTGGG - Intergenic
968143893 3:196281456-196281478 TAATTACAAAAACAGGTAGTGGG - Intronic
968248006 3:197174102-197174124 TATTTACAAAAACAGGTGGCAGG + Intronic
968250536 3:197206984-197207006 TCATTACAAAAACAGGTGGCAGG - Intronic
968526000 4:1057506-1057528 TATTTACAAAAACAGGTGGCAGG - Intronic
968708723 4:2096600-2096622 TGTTTACAAAAGCAGCAGGCAGG - Intronic
968994232 4:3935677-3935699 GATTTACAAAAGCAGGAGACTGG - Intergenic
969324851 4:6436815-6436837 TATTCACAAAAACAGGAGGTGGG + Intronic
969640037 4:8392211-8392233 TATTTGCAAAAACAGGTGGCAGG + Intronic
969826818 4:9764322-9764344 TATTTATAAAAATAGGTGGTGGG + Intergenic
969841440 4:9885771-9885793 TATTTACAAAAGCAGGCAGTGGG - Intronic
970090695 4:12404208-12404230 TATTTACAAAACCAGGCAGTGGG - Intergenic
970273897 4:14376491-14376513 TATATATAAAAACAGGTGGTGGG + Intergenic
970430948 4:15988525-15988547 TATTTACAAAAACTGCTGGTAGG + Intronic
970475546 4:16418573-16418595 TATTTACAAAACCAGGCAGTGGG - Intergenic
970639940 4:18052611-18052633 CATTCACAAAAGTGGGTGGAAGG + Intergenic
970708535 4:18834349-18834371 AACATACAAAAGCAGGTGGTAGG - Intergenic
970801844 4:19981409-19981431 TATTTACAAAATCAAGTGGGGGG + Intergenic
971178661 4:24306716-24306738 TATTTACAGAAACAGGTGGCAGG + Intergenic
971262782 4:25072000-25072022 AATATACAAAAGCTGGTGGATGG - Intergenic
971354583 4:25883778-25883800 TATTGACAAAAATAGGTGGTGGG + Intronic
971383607 4:26122884-26122906 TATTTACAAAAGCAGATGGTGGG + Intergenic
971454491 4:26831488-26831510 CATTTGCAAAACCAGGTGGAAGG + Intergenic
971493545 4:27239777-27239799 TACTTACAAAAGCAGGCTGCAGG + Intergenic
971497853 4:27286835-27286857 TATTTACAAAAACAGGTGGTGGG + Intergenic
972052929 4:34763657-34763679 TATTTGCAAAAACATGTGTAAGG - Intergenic
972328859 4:38044916-38044938 TATTTACAAAAATAGGAGGTGGG - Intronic
972482387 4:39509444-39509466 TATTTACAAAAACAAGTTGTGGG + Intronic
972573541 4:40331433-40331455 TATTTACGAAAATAGGTGGCAGG - Intergenic
972619266 4:40731220-40731242 AATTTACAAAAACAGGTGGTGGG + Intergenic
973105126 4:46326154-46326176 TTTTTACAAAAGAATGGGGAGGG + Intronic
973248441 4:48035995-48036017 TATTTTTAAAAGCATGTAGAAGG - Exonic
973582757 4:52360355-52360377 TATTTACAAAGCCAGGTGGCAGG - Intergenic
973990357 4:56399906-56399928 TATTTTCATAACCAGGTAGATGG - Intronic
974059077 4:57013792-57013814 TGTTTACAAAAACAGCTGGTGGG + Intronic
974071142 4:57125365-57125387 TATTTACAAAAACTGGTGATGGG + Intergenic
974164796 4:58187679-58187701 TATTAACAAAAGAATGTGGAAGG - Intergenic
974757134 4:66224780-66224802 TATTTAAAAGAGCCGGTGGGAGG - Intergenic
975455806 4:74588556-74588578 TATTTACAAAAACAGGCAGTGGG + Intergenic
975696897 4:77022584-77022606 CATTTACAAAAACAGATGGGGGG + Intronic
975820202 4:78262996-78263018 TATTTACAAAAACAGGCAGTGGG + Intronic
976084145 4:81389916-81389938 TATTTACAAAAACAGGCAGCAGG + Intergenic
976121327 4:81785584-81785606 TATTTACAAAAACAGGAAGCTGG + Intronic
976311363 4:83616361-83616383 TATTTACAAAAACAGACAGAGGG - Intergenic
976599703 4:86926923-86926945 TATTTACAAAAGTGGGTGTTAGG - Intronic
976611005 4:87030348-87030370 TATTTACAAAAATAGGTAGCTGG + Intronic
976678616 4:87730643-87730665 TATCTATAAAAGCAGGAGGGAGG - Intergenic
977408392 4:96630554-96630576 TAATTACAACAGAAAGTGGAAGG + Intergenic
978151215 4:105437727-105437749 TATTTATAAAAACAGGTGTTAGG + Intronic
978750263 4:112238077-112238099 TATTTACAAAAATAGGCAGAGGG + Intronic
979357814 4:119726127-119726149 TATTTGCAGAAGCAGGTGTTGGG + Intergenic
979407582 4:120332138-120332160 TATTCACAAAAACAGGTGGCAGG + Intergenic
979471080 4:121097537-121097559 TATCTCTAAAAGCAGGTTGAAGG + Intergenic
979934704 4:126677021-126677043 TATTTACAAAAACAGGTAGCAGG + Intergenic
980027883 4:127787937-127787959 TATTTACAAAAATAGGTTGCAGG + Intronic
980319162 4:131245625-131245647 TATTTTAAAAAGCATGTGGAAGG - Intergenic
980810563 4:137873237-137873259 GATTTAGAAAGCCAGGTGGATGG - Intergenic
980967411 4:139535995-139536017 TATTTACAAAAGCAGTCAGCAGG - Intronic
981178627 4:141713335-141713357 TATTTATCAAAGCAGGTGGTTGG + Intronic
981509972 4:145545135-145545157 TATTTACAAAAACAGATAGCAGG - Intronic
981690065 4:147498484-147498506 CATTTACAAAAACAGGTGGTGGG - Intronic
982568813 4:157022262-157022284 CATTGACAAAAGCAGGTGAGTGG - Intergenic
982817300 4:159902375-159902397 TATATATAAAACCAGATGGATGG + Intergenic
982829148 4:160039207-160039229 TATTTACAAAAATAGGTGGTGGG + Intergenic
983247207 4:165301543-165301565 TACTTATAAAAGCAGGTGTAAGG - Intronic
983280266 4:165671987-165672009 TATTGACAAAATCAAGTGGAGGG - Intergenic
984000739 4:174239991-174240013 TATTTACAAAAGCAGGCAGCAGG - Intronic
984160177 4:176242959-176242981 TATTTACAAAAACAGATGATAGG - Intronic
984636680 4:182118587-182118609 AATCTACAAAAAAAGGTGGAGGG - Intergenic
984834149 4:184003609-184003631 TATTTACAAAAACAGGTGGTGGG - Intronic
984916448 4:184729598-184729620 GATATACAAAAACAGGTGGCAGG + Intronic
985140621 4:186836886-186836908 TATTTGCTAAAGCAATTGGAAGG + Intergenic
985359107 4:189153587-189153609 TATTTACTAAAGCAGGTGGTGGG - Intergenic
985526827 5:408165-408187 TGTTTACAAAAGCAAGTGGCAGG + Intronic
985858652 5:2451308-2451330 TATTTACAAAAGCAGGCAGCTGG + Intergenic
986053494 5:4112387-4112409 TATTTACAAAATCAGGTGACAGG - Intergenic
986589324 5:9352764-9352786 TATTAACAAAAACAGGTGATGGG - Intronic
986627199 5:9733228-9733250 TATTCACAAAAACAGATGGAAGG - Intergenic
987040742 5:14060000-14060022 TATTTATAAAAACAGGAGGTGGG - Intergenic
987308668 5:16661925-16661947 TATTCACAAAAACAGGTGGCAGG + Intronic
987316228 5:16726851-16726873 TATTTACAAGAACAGGTGGCAGG - Intronic
987812417 5:22855119-22855141 TATTTACAAAAGCAGGTGGCTGG - Intergenic
988266752 5:28961729-28961751 TATTTATAAAAACAGGTAGTGGG - Intergenic
988307291 5:29508911-29508933 TATTTAGAAAGATAGGTGGATGG + Intergenic
988409213 5:30864606-30864628 GGTTTGAAAAAGCAGGTGGATGG + Intergenic
988673124 5:33403363-33403385 TATTTACAAAAGTAGGCAGTCGG - Intergenic
988920071 5:35932967-35932989 TATTTACAAAACCAGGTGGAGGG - Intronic
989069404 5:37494934-37494956 TATTTACAAAAACAGGGTGGTGG - Intronic
990084584 5:51958488-51958510 TATCTACAAAATTAGGTGAAGGG + Intergenic
990151051 5:52818018-52818040 TATTTACATAAGCAGGTAGTGGG + Intronic
990495357 5:56342352-56342374 TATTTACAAAAGCAGGCAGTGGG - Intergenic
990611901 5:57466034-57466056 TATTTACAAAAACAGGTGACAGG - Intergenic
990777553 5:59319872-59319894 TTTTTCCAAATGCAGGTGGGAGG + Intronic
990933316 5:61117886-61117908 TATTTACAGAAACAGTTGGCAGG + Intronic
991235247 5:64387044-64387066 TATTTACAATAACAGATGGCAGG + Intergenic
992035636 5:72772531-72772553 TATTTACAAAAACAGGTGGCAGG + Intergenic
992243911 5:74797968-74797990 TATTCACAAAACCAGGTGGCAGG + Intronic
992267236 5:75031525-75031547 TATTTACAAAAACAGGCAGCTGG + Intergenic
992443931 5:76818226-76818248 TAAATACAAAAGCAGATAGAAGG - Intergenic
992885833 5:81159393-81159415 TATTTACAAAAACAGGCAGCAGG + Intronic
993007978 5:82448601-82448623 ATTTTACAAAGGCAGGGGGAGGG + Intergenic
993109754 5:83642858-83642880 CATTTACAAAAACAGGTAGGAGG - Intronic
993620131 5:90158375-90158397 TATTTATAGAAGCAAGTGGTAGG + Intergenic
993817735 5:92573120-92573142 TATTTACAAAAATAGATGGTAGG - Intergenic
993971118 5:94421253-94421275 TATTTACAAAAACAGGTGGCGGG + Intronic
994047130 5:95322738-95322760 TATTTACAAAAACAGGTGGTGGG - Intergenic
994331868 5:98515729-98515751 TATTTATAAAAGCATTTGGCCGG - Intergenic
994488845 5:100415885-100415907 TATTTACAAAAACAGGTGTTGGG - Intergenic
994578567 5:101611185-101611207 TGTTTGCCAAAGCATGTGGACGG - Intergenic
994595521 5:101828086-101828108 TATTTATAAAAATAGGTGGTAGG - Intergenic
995072719 5:107942854-107942876 TACTTAGAGAAGCAAGTGGAAGG - Intronic
995384163 5:111570262-111570284 TATTTACAAAAACAGGTTGAGGG + Intergenic
995419792 5:111951413-111951435 TATTTACAAAAACCGATGGTGGG - Intronic
995544465 5:113216058-113216080 TATTCACAAAAACAGGTAGAAGG - Intronic
995825782 5:116297458-116297480 TATTTACAAAGACAAGTGGTGGG - Intronic
995920770 5:117308389-117308411 TATTTACAAAAGCAAATGTTGGG + Intergenic
995980555 5:118097832-118097854 AATTTACAAAAACAGGTTGGAGG - Intergenic
996124916 5:119713347-119713369 CATTTACAAAAACAGGAGGCAGG + Intergenic
996594023 5:125180903-125180925 TAATTACAAAAACAGGTGGTGGG + Intergenic
996640560 5:125747155-125747177 TATTCTCAAAAGCAGCTGGTGGG - Intergenic
996658099 5:125965895-125965917 TTTTTAGAAAAGGATGTGGATGG - Intergenic
996687270 5:126296676-126296698 TATTTACAGAAACAGGTGATGGG + Intergenic
996780190 5:127177288-127177310 TATTTACACAAACAGCTGGCAGG + Intergenic
997141295 5:131383694-131383716 TATTTACAAAAACAGGTGACAGG - Intronic
997360441 5:133291376-133291398 GATTTACAAAAACAGATGGAGGG - Intronic
997505433 5:134412806-134412828 TGTTTACAAAAGATGCTGGAAGG + Intergenic
997547578 5:134722111-134722133 TATTTACAAAAACAAGTAGCAGG - Intronic
997889955 5:137667097-137667119 TATTTACCAAAACAGGTGGCAGG - Intronic
998196881 5:140081247-140081269 TATTTGCAAAAACAGGTGGCAGG + Intergenic
998536400 5:142935486-142935508 TATTTACAAAAACAGATGGCTGG + Intronic
998566221 5:143218064-143218086 TATTTACAAAAACAGGTGGCGGG - Intronic
998985547 5:147752441-147752463 TATTTACAAAAGTAGGCTGCAGG - Intronic
999069869 5:148732893-148732915 TATTTACAAAAACAGGAAGTGGG - Intergenic
999094442 5:148965515-148965537 TATTTATAGAAACAGGTGGAGGG + Intronic
999235727 5:150092193-150092215 TATTTACAAAAACAGGAGGCAGG + Intronic
999572934 5:152941092-152941114 TATTTACAAAAATAGGTGGCAGG - Intergenic
999614063 5:153403645-153403667 TATTTACAAAAACAGGCAGTGGG - Intergenic
999916911 5:156272793-156272815 TATTTACAAAAACAGGCTGTGGG - Intronic
999934161 5:156467146-156467168 TATTTACAAAACCAAGTAGCAGG + Intronic
1000702335 5:164468326-164468348 TATTTACTAAAACAGGTAGTGGG + Intergenic
1000841815 5:166229602-166229624 TATTTAGAAAGACAGGTGGTAGG - Intergenic
1000903956 5:166940501-166940523 TATTTACAAAAACAGGCGGGTGG - Intergenic
1001022877 5:168198506-168198528 TATTTACCAAAACAGGTGGTGGG + Intronic
1001118980 5:168963118-168963140 TATTTACAAAAACAGGGAGTGGG - Intronic
1001149587 5:169215606-169215628 TATTTATAAAAGCAGGCAGTGGG + Intronic
1001225069 5:169937103-169937125 TATTTACAAAAACAGGCAGCTGG - Intronic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1001304810 5:170563993-170564015 TGTTTATAAAAGCAGAAGGAAGG - Intronic
1001429337 5:171647124-171647146 TATTTACAGAAACAGGTGGTGGG + Intergenic
1001475375 5:172046819-172046841 TATTTACAAATATAGGTGGTGGG + Intronic
1001643511 5:173262638-173262660 GATTTACAAAATCAGGTGGTGGG + Intergenic
1001923567 5:175619466-175619488 TATTTACAAAAACAGGCAGTAGG + Intergenic
1002086352 5:176778070-176778092 TATTTGTAAAAACAGGTGGTAGG - Intergenic
1002415332 5:179117499-179117521 TATTTACAAAACCAGGTGGAGGG - Intronic
1002429847 5:179196902-179196924 TATTTACAAAAACAGGTGAAGGG + Intronic
1002965867 6:1965968-1965990 TAATTACAAAAGCAGATGGTAGG - Intronic
1003005018 6:2373052-2373074 TATTTACAAAAACCGGTAGTAGG - Intergenic
1003128708 6:3377095-3377117 TATTTACAAAAACAGGCAGTGGG - Intronic
1003129426 6:3382630-3382652 TATTAACAAAAGCAGGCAGTGGG - Intronic
1003132580 6:3408012-3408034 TATTTACAGAAACAGATGGTGGG - Intronic
1003178995 6:3776011-3776033 TATTTGCAAATGCAGGTTTATGG + Intergenic
1003232016 6:4262709-4262731 TATGTACAAAAACAGGTGGTGGG - Intergenic
1003364823 6:5463077-5463099 TATTTACGAAAGCTGGAGGCCGG + Intronic
1003627155 6:7752259-7752281 TATTTATAAAACTAGGTGGCTGG + Intronic
1003901233 6:10657692-10657714 TATTTACAAGAACAGGTGGCAGG - Intergenic
1003943196 6:11048656-11048678 TATTTACAAAAGCAGGCAACTGG - Intergenic
1004206912 6:13599634-13599656 TATTTCCAAAAACAGGTAGCAGG - Intronic
1004207417 6:13605207-13605229 TATTTACAGATACAGGTGGTGGG - Intronic
1004470114 6:15921498-15921520 TATTTACAAAAACAGATGGAGGG + Intergenic
1004568711 6:16824147-16824169 TATTTACAAAAACAGGCAGCAGG - Intergenic
1004901453 6:20197928-20197950 TTTTTAAAAAAGCAGCTGGCTGG + Intronic
1004914210 6:20316704-20316726 TACTCACAAAAACAGGTGGTGGG + Intergenic
1004956779 6:20736188-20736210 TATTTACAAAAACAGGCAGCAGG - Intronic
1004963658 6:20821976-20821998 TATTTACAAAAGCAGGCAATGGG - Intronic
1005110400 6:22275118-22275140 TATTTACAATAGCAGAGGCATGG - Intergenic
1005197852 6:23309941-23309963 TATCTGCAAAACCAGGGGGATGG + Intergenic
1005206907 6:23415138-23415160 AACATACAAAAGGAGGTGGAGGG - Intergenic
1006482058 6:34303792-34303814 TATTTACAAAAACTGATGGCAGG - Intronic
1007242381 6:40436293-40436315 TATTTACAAAAACAGGTGACAGG - Intronic
1007356852 6:41326315-41326337 TATTTACAAAATCAGATGTCAGG + Intergenic
1007466579 6:42056344-42056366 TATTTACAAAAACAGGAGGCAGG - Intronic
1007509857 6:42366569-42366591 TGTCTACAAAAGCATGTGAAAGG - Intronic
1007941696 6:45787592-45787614 TATTTACAAAAACAGGCCGCTGG + Intergenic
1008000836 6:46358211-46358233 GATTTACAAAAGTAGGAGAAAGG - Intronic
1008319400 6:50089297-50089319 TATTTCTAAAGGCAGGTAGAAGG - Intergenic
1008342797 6:50388181-50388203 ATTTTACAAAAAGAGGTGGAAGG + Intergenic
1008434443 6:51458514-51458536 GATGTAAAAAAGCAGATGGATGG - Intergenic
1008438894 6:51509757-51509779 TATTTGCAAAAATAGGTGGTAGG + Intergenic
1008597404 6:53056473-53056495 TATTTACAAAAACAGGCAGCAGG + Intronic
1008605547 6:53136177-53136199 TATTTACAAAAGCAGGCAATGGG - Intronic
1008746960 6:54683600-54683622 TATTTACCAAAACAAGTGGTGGG - Intergenic
1008852666 6:56042707-56042729 TATTTACAAAAACACTTGGCAGG - Intergenic
1008869647 6:56257828-56257850 GCTTTACAAAAACAGGTGGCCGG + Intronic
1009466678 6:63979159-63979181 TATTTACCAAAATAGGTGGCTGG - Intronic
1009577475 6:65484849-65484871 TGTTTACAAAAATAGGTGGAAGG - Intronic
1009580761 6:65530358-65530380 TATTTACAAAGACAGGTGGTGGG - Intronic
1009959899 6:70506509-70506531 TATTTACAAAAACAGGTGTTGGG + Intronic
1010154267 6:72774330-72774352 TATTTATAAAAACAGGTGACAGG + Intronic
1010255547 6:73753087-73753109 TATTCACAAAAACAGGTGTCAGG - Intronic
1010543909 6:77126316-77126338 TTTTGACAACAGCAGATGGATGG - Intergenic
1010612825 6:77976008-77976030 ACTTTACAAACGCAGGTGGTAGG + Intergenic
1011104391 6:83763019-83763041 TATTTAAAAAAGCATTTAGAAGG - Intergenic
1011207671 6:84917769-84917791 TATTTACAAAAACAGGTGGTAGG - Intergenic
1011435982 6:87337285-87337307 TGTGAATAAAAGCAGGTGGAAGG + Intronic
1011496161 6:87938429-87938451 TATTTACAAAAGCGGGCAGTGGG - Intergenic
1011546979 6:88492043-88492065 TATTTACAAAAACAGGCTGTGGG - Intergenic
1011547314 6:88495215-88495237 TACTTATAAAAGCAAGTGGTGGG - Intergenic
1011573108 6:88761641-88761663 TATTTACAAAAACAGGTGTGAGG - Intronic
1011712133 6:90065568-90065590 TATTTATAAAAACAGGTGGCAGG + Intronic
1011904493 6:92346964-92346986 TATTTATTAAAGTAGGTGGTAGG + Intergenic
1011940281 6:92834425-92834447 TGTTTACAAAATCAGATGGCAGG + Intergenic
1012306602 6:97666518-97666540 CATGTACAAAAGAATGTGGATGG - Intergenic
1012405193 6:98888201-98888223 TATTTACAAAAACAGGCAGTAGG - Intronic
1012418624 6:99037212-99037234 CAAATACAAAAGCAGGTGGTGGG + Intergenic
1012566941 6:100668043-100668065 TATGTACAAAAACAGGTAGTTGG - Intronic
1012819817 6:104072186-104072208 TTTTTACACAAGCTGGAGGAGGG - Intergenic
1012877543 6:104745985-104746007 TATACACAAAAGCAGTTGTAAGG + Intronic
1012931570 6:105322764-105322786 TGTTTACTAAAACAGGTGGTGGG - Intronic
1012949996 6:105507510-105507532 TATTTACAAAAACAAGTGGTAGG + Intergenic
1013026256 6:106275971-106275993 TATTTACAAAAGCAGATGGCTGG + Intronic
1013045939 6:106484985-106485007 TATTTAAAAAAAAAGGTGGGGGG + Intergenic
1013200894 6:107894888-107894910 TGTTTTAAAAAGCAGGTGGCAGG - Intronic
1013478839 6:110534890-110534912 TATTCACAAAAGCAATTAGAAGG - Intergenic
1013639831 6:112062641-112062663 TATTTACAAAAACAGGCTGTTGG - Intronic
1013730990 6:113166974-113166996 CATCTGCAAAAGCAGGTGGTAGG - Intergenic
1013745247 6:113337637-113337659 TATTTACAAAACCAGGCAGCAGG + Intergenic
1013894449 6:115068996-115069018 TATTTACAAAAAGGGGTGGTGGG + Intergenic
1014057072 6:117028444-117028466 TATTGACAAAAGCATGTGCAGGG + Intergenic
1014407813 6:121072245-121072267 TATTTACAAAAACAGGCAGTGGG + Intergenic
1014486965 6:122010967-122010989 TATTTACAGAAACAGGTAGTAGG + Intergenic
1014611702 6:123556117-123556139 TCTTTACAAAAGCATCTGAAAGG - Intronic
1014647651 6:123994339-123994361 TATTTACAACTGTGGGTGGAAGG + Intronic
1015126435 6:129760381-129760403 TATTTACAAAAGCAGGTGTCCGG + Intergenic
1015140008 6:129920293-129920315 TATTTACAAAAACAGGGAGTGGG + Intergenic
1015170048 6:130242355-130242377 TATTTACAAAAACAGGCAGTAGG + Intronic
1015309287 6:131748220-131748242 TATTTACAAAAACAAGTGGAGGG + Intergenic
1015364773 6:132385344-132385366 TATACTCAAAAGAAGGTGGAGGG - Intronic
1015444579 6:133288239-133288261 TATTTACAAAAGCATGTGGCAGG + Intronic
1015509178 6:134020766-134020788 AATTTACAACTGCAGGTGCAAGG - Intronic
1015650136 6:135447845-135447867 TATTTACAAAAACAGGTAGTAGG - Intronic
1015726800 6:136307437-136307459 TATTTACAAAAACAGGCTGCAGG - Intergenic
1016025431 6:139282003-139282025 AGTTTACAGAAGCAGATGGAAGG - Intronic
1016025844 6:139286236-139286258 AGTTTACAGAAGCAGATGGAAGG - Intronic
1016094194 6:140015831-140015853 TATTTATAAAAACAGTTGGTGGG + Intergenic
1016355713 6:143215977-143215999 TAATTACAAAAACAGGTGGCTGG + Intronic
1016411646 6:143789421-143789443 TATCTACAAAAACAGATGGTGGG + Intronic
1016575041 6:145560514-145560536 TATTTACCAAAATAGGTGAAGGG + Intronic
1016712769 6:147192403-147192425 TATTTACAAAAACAGGTAGTGGG - Intergenic
1017526340 6:155244274-155244296 TGTTTACAAAGGCAGAGGGACGG + Intronic
1017708348 6:157145274-157145296 TATTTACAAAAACAGGTAGTGGG - Intronic
1017897702 6:158695063-158695085 TATTTACAAAAGCAGGGTGATGG - Intronic
1018437659 6:163777367-163777389 TATTTACAAAAACAGGCAGTGGG - Intergenic
1018655500 6:166031463-166031485 TATTTATACAACCAGGTGGCAGG + Intergenic
1018811446 6:167301064-167301086 TATTTTCAAAAGCAGGCAGTGGG + Intronic
1018896027 6:168017874-168017896 TGTTTACAAAAACAGGCGGCAGG + Intronic
1018929074 6:168228115-168228137 TAATTACAGAAGCCGGAGGAGGG + Intergenic
1019101372 6:169633257-169633279 TGTTGGCAAGAGCAGGTGGACGG + Intronic
1019597626 7:1865511-1865533 TATTTACAAGCGCAGGGCGACGG + Intronic
1019835774 7:3381645-3381667 TATTTTCCAACGGAGGTGGAAGG + Intronic
1019844761 7:3487123-3487145 TATTTACAAAAACATGTGGCAGG + Intronic
1019911635 7:4103991-4104013 TATTTACAAAAACAGGAAGTGGG + Intronic
1019960662 7:4456781-4456803 TATTTACAATAACAAGAGGAGGG + Intergenic
1020075237 7:5253439-5253461 TATTTGCATAAGCCGGGGGAGGG + Intergenic
1020352255 7:7233716-7233738 TATTTACAAAAACAGGTAGCAGG + Intronic
1020381693 7:7554816-7554838 TATTTACAGAAACAGGTGGCAGG - Intergenic
1020412948 7:7913502-7913524 TATTTATGAAAACAGGTGGTGGG - Intronic
1020896626 7:13948557-13948579 CATTTACAAAAACAGGTGGAAGG - Intronic
1021532778 7:21667459-21667481 TGTTTATAAAAACAGGTGGTGGG + Intronic
1021605000 7:22401338-22401360 TATTTACAAAAATAGGTGGCCGG - Intergenic
1021695889 7:23276101-23276123 TATTTACAAAAACAGGTGGTAGG + Intergenic
1021797537 7:24272176-24272198 TATTTACAAAAACAGGTGGTAGG + Intergenic
1021815010 7:24438352-24438374 TGTTTGCAAAAACAGGTGGAAGG + Intergenic
1021922027 7:25495160-25495182 TTTTGGCAAAAGCAGGAGGAAGG + Intergenic
1021952514 7:25789294-25789316 TATTTACAAAAACAGGTTGTAGG + Intergenic
1022182137 7:27931283-27931305 TATTTACAAAAACAGGTGGAGGG + Intronic
1022349019 7:29549095-29549117 TATTAACAACAGCAGGTAGCAGG + Intergenic
1022455819 7:30557413-30557435 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1022607182 7:31826977-31826999 TATTTACAAGAACAGGTGGTGGG + Intronic
1022782320 7:33598922-33598944 TATTTACTAAAACAGGTGTTGGG - Intronic
1022792950 7:33706881-33706903 TAGTTACAAAAGCAGTTCTATGG - Intergenic
1023201295 7:37699609-37699631 TATTTATAAAATCAGGTGGCAGG + Intronic
1023246958 7:38215373-38215395 TATTTGCAAAATGAGGTAGAGGG - Intronic
1023512794 7:40970953-40970975 TTTTTAAAAAATCAGGTGGCAGG + Intergenic
1023640149 7:42249430-42249452 ACCTTACAAAAACAGGTGGAAGG + Intergenic
1023670783 7:42574408-42574430 TATTTACCAAAACAGGTGGCAGG - Intergenic
1024937834 7:54729624-54729646 TATTTACAAAACCAGGTGATGGG + Intergenic
1024977791 7:55129939-55129961 TATTTGCAAAAACAGGTGGCAGG - Intronic
1025925090 7:65952385-65952407 TATTTACAAAAGCAGGTAGCTGG + Intronic
1026124196 7:67565160-67565182 TATTTACAAAAGCAGGCAGTGGG + Intergenic
1026474360 7:70721541-70721563 AATTGACAAAAGAAGGTGGGTGG - Intronic
1027454210 7:78367453-78367475 TATTTACAAAAACAGGCAGCTGG - Intronic
1027562451 7:79748942-79748964 TATTTATAAAAACATGTGGCTGG + Intergenic
1027579919 7:79979667-79979689 TATTTACAAAATCAGGGAGGGGG + Intergenic
1027674122 7:81138532-81138554 TGTTTAAAAAAACTGGTGGAGGG - Intergenic
1028115725 7:86995359-86995381 TATTTATAAGAACAGGTAGAAGG + Intronic
1028248694 7:88514050-88514072 GAGTTTCAAAAGCAGGAGGAGGG + Intergenic
1028309163 7:89308854-89308876 TATTTACAAAAGGAGGCTGAAGG + Intronic
1028431038 7:90747223-90747245 GATATACAAAAACAGGTGGTGGG + Intronic
1028505932 7:91570135-91570157 TATTTATCAAAACAAGTGGAGGG + Intergenic
1028707709 7:93869795-93869817 TATTTACAGAAGCAGGTGTCTGG - Intronic
1030135917 7:106247853-106247875 TATTTACAAAAACAGATGGTGGG + Intergenic
1030264928 7:107610475-107610497 CAGTTGCAAAAGGAGGTGGAAGG + Intronic
1030525100 7:110643229-110643251 TATTTACAAAAACAGGTGGTGGG - Intergenic
1030818220 7:114063150-114063172 TAATTACAAAAGCAAGTTAATGG - Intronic
1030911173 7:115251375-115251397 TATTTACAAAAGCAGGCTATGGG + Intergenic
1031136288 7:117887729-117887751 TATTTACAAAAACAGGTGTTGGG + Intergenic
1031136559 7:117890721-117890743 TATTTACAAAAACAGGCAGCAGG - Intergenic
1031221470 7:118971951-118971973 TATTTACAAAAGCAGGGAGCTGG - Intergenic
1031242352 7:119262645-119262667 AATTTGCACAAGCAGGAGGATGG - Intergenic
1031375514 7:121020322-121020344 TATTTACAAAAACAGGCGGTGGG - Intronic
1031496900 7:122460928-122460950 TATTGACAAAAGCAGATGAAAGG - Intronic
1031605018 7:123758230-123758252 TATTTACAAAAGCAGGCAACAGG - Intergenic
1031683037 7:124697923-124697945 AATTTACAGAAACAGGTAGAAGG + Intergenic
1031750586 7:125567880-125567902 TATTTACAAAAACAGGCAGAGGG - Intergenic
1032036637 7:128526261-128526283 TATTTGCAAAAACAGGTTGCTGG - Intergenic
1032210791 7:129912116-129912138 TATTTACAAAAACAGGGGGTGGG - Intronic
1032647955 7:133846754-133846776 TATTTACAAAAGTGGGTGGCAGG + Intronic
1032902483 7:136325111-136325133 TTTTTTCAAAAGCAGTTGTAAGG - Intergenic
1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG + Intronic
1033811883 7:145023861-145023883 CACTTGCAAAAGCAGGTGGTGGG - Intergenic
1033826672 7:145199558-145199580 TATTTAAAAGAGCGGGAGGAAGG - Intergenic
1033965022 7:146964873-146964895 TATTTACTAAAACAGGTGACTGG + Intronic
1034041000 7:147876623-147876645 TATTTAAAAAAAAATGTGGAGGG - Intronic
1034111079 7:148538011-148538033 TACTTATAAAAACAGGTGGTGGG - Intergenic
1034123806 7:148652942-148652964 TATTTACAAAAGCAGGTGGTGGG - Intergenic
1034181688 7:149143972-149143994 TATTTTCAGAAGCAGATGTAAGG - Intronic
1034247383 7:149657364-149657386 TATTTACAAATCCAGGTAGAAGG + Intergenic
1034526146 7:151664041-151664063 TAATCACAAAACCAGGTGGTGGG + Intronic
1034913534 7:155018020-155018042 TATGTACAAAACCAGGTAGCAGG + Intergenic
1036127518 8:6076535-6076557 TTCTTTCAGAAGCAGGTGGAGGG - Intergenic
1036381905 8:8241150-8241172 GATTTACAAAAGCAGGAGACTGG + Intergenic
1036545863 8:9769222-9769244 TATTTACAAAACCAGATTGCAGG + Intronic
1036552376 8:9826738-9826760 TATTTACAAAAGCATGCGGAGGG - Intergenic
1036738336 8:11339484-11339506 TATTTACAAAAACAGGCAGCGGG - Intergenic
1036966324 8:13302068-13302090 TATTTAAAAAAGAAGTTGGTTGG + Intronic
1037549468 8:19956435-19956457 TATTTACAAAAGCAGGAAGTAGG - Intronic
1038299788 8:26333266-26333288 TATTTACAAAAACAGGTTGTGGG + Intronic
1038966013 8:32573378-32573400 TATTTACAAAAACAGATGGTAGG + Intronic
1038979612 8:32743981-32744003 TATTTACAAAAGCAGACAGTGGG + Intronic
1039206844 8:35165520-35165542 TATTTACAAAAACAGGCAGTGGG - Intergenic
1039345594 8:36701784-36701806 AATTTACAAAAGCAGGAAGATGG - Intergenic
1039419558 8:37424730-37424752 TATTTACAAAAACAGGTGGCAGG + Intergenic
1039444111 8:37617011-37617033 TATTTACTAAAACAGGTGCCAGG + Intergenic
1040407483 8:47120355-47120377 TATTTACAAAAACAGGCAGTGGG - Intergenic
1040738249 8:50537869-50537891 TTTTCACAAAAACAGGTGGCAGG + Intronic
1040764338 8:50888769-50888791 TATTCACAAGAGCAAGGGGATGG - Intergenic
1040824843 8:51609626-51609648 GATGGACAAATGCAGGTGGAAGG + Intronic
1041137916 8:54780222-54780244 TAATTACAAAAACAGGTGGCAGG + Intergenic
1041718699 8:60956501-60956523 TATTTACAAAAACAGGTGGTTGG + Intergenic
1042521825 8:69720954-69720976 TATTTACAAAAACAGGAAGCAGG + Intronic
1042869125 8:73381354-73381376 TTATTACAAAAGCAGGTAGCAGG - Intergenic
1042939749 8:74095780-74095802 GATTTCCAAGAGCATGTGGAAGG - Intergenic
1043349162 8:79339498-79339520 TATTCACAAAAACAGATGGTGGG - Intergenic
1043540151 8:81253232-81253254 TATTTACAAAAACAGGGAGTGGG - Intergenic
1043884566 8:85583636-85583658 TGGTTACAAGAGCAGGAGGAGGG + Intergenic
1043910177 8:85854935-85854957 TATTTACAAAAACATATGGTGGG - Intergenic
1043931179 8:86093270-86093292 TATTTACAAAAACAGTTCGTGGG - Intronic
1044245354 8:89937885-89937907 TATGAACAAAAGCAGATAGAGGG - Intronic
1044387998 8:91612747-91612769 TATTGACAAAAGCAGGCAGTGGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044571781 8:93727116-93727138 TATTTACAAAAGCAGGAGGCTGG + Intronic
1044662087 8:94601319-94601341 TATTTTCAAAAGCTAGTGAAAGG - Intergenic
1044881019 8:96722370-96722392 TATTTACAAAAGCAGAGAGCAGG - Intronic
1045140528 8:99276612-99276634 TATTTATAAAAGCAGGAAGTGGG + Intronic
1045154042 8:99446034-99446056 TATTTACAGAATCTGGTGGTTGG + Intronic
1045178402 8:99752392-99752414 TATTTACAAAAACAGGTGGTGGG - Intronic
1045564941 8:103304669-103304691 TATTTACAAAAACAGGCAGTGGG + Intronic
1045576588 8:103428320-103428342 TATTTACAAAAACAGGCAGTGGG - Intronic
1045598073 8:103679889-103679911 TATTTACAAAAGCAGATAGCAGG - Intronic
1045751338 8:105487632-105487654 TATTTACAAAAGCAGATGGAGGG + Intronic
1045763823 8:105643901-105643923 TATTTACAAAAACAGGTCATGGG - Intronic
1045917595 8:107490866-107490888 TATTTACAAACAGAGGTGGCAGG + Intronic
1046333074 8:112747677-112747699 TATTTATAAAAACAGGCGGCCGG + Intronic
1046514598 8:115241912-115241934 AAATTACAAAAGCAGGAAGAAGG - Intergenic
1046570984 8:115965833-115965855 TATTTACAAAAACAAATGGCAGG + Intergenic
1046682012 8:117181079-117181101 TTTTTAAAAAAGCAGGTAGGTGG + Intergenic
1046721704 8:117627436-117627458 TATTTCAAAAAGCAGGTGGCAGG + Intergenic
1046763444 8:118044821-118044843 TGTTTACAAAAGCATGCGGTGGG - Intronic
1046800466 8:118420891-118420913 TATTTACAAAAACAGGTGGCAGG - Intronic
1047178403 8:122564216-122564238 TATTTGCAAAAACAAGTGGTGGG - Intergenic
1047221124 8:122918967-122918989 TATTTACAAAAACAGGAGACAGG + Intronic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1047302445 8:123625419-123625441 TACTTACAAAATCAGGAGGCCGG - Intergenic
1047425853 8:124745885-124745907 TATTTACAAAAGCATGCGGTAGG - Intergenic
1047426668 8:124752723-124752745 TATTTACAAAAGCAGGCGGTGGG - Intergenic
1047515449 8:125550647-125550669 TATTTACAAAAACAAGTAGTTGG + Intergenic
1047523119 8:125610806-125610828 TATATACAAAAACAGGTGGCTGG - Intergenic
1047659254 8:127014576-127014598 TATTTACAAAAGCAGGTACCAGG + Intergenic
1047676780 8:127211226-127211248 TATTTACAAAAACAGGTGGCAGG + Intergenic
1047778852 8:128095530-128095552 TATTTACAAAAACAGGCTGTGGG - Intergenic
1047796775 8:128265253-128265275 TATTTACAAAAACAAGTGGTGGG + Intergenic
1047805018 8:128350497-128350519 TATTTACAAAATCAGGTGGCAGG - Intergenic
1047896809 8:129375243-129375265 TATATGCAATAGCAGGTAGAGGG - Intergenic
1048047271 8:130784645-130784667 TATTTATAAAAACAGATGGTGGG + Intronic
1048574798 8:135682077-135682099 CATTGACAAAAACAGGTGGAGGG + Intergenic
1048588148 8:135794803-135794825 TATTTACAAAAACAAGTGGTGGG - Intergenic
1048766866 8:137854293-137854315 TATTTACAAAAACAGGCAGCTGG - Intergenic
1048938642 8:139377624-139377646 TATTTACAAAAGAATAGGGACGG - Intergenic
1049550135 8:143253578-143253600 TATTTACAAACGTAGGAGGTGGG + Intronic
1050062499 9:1724683-1724705 GATATACAAAAACAGGTGGTGGG + Intergenic
1050628787 9:7536992-7537014 CATTTACAAAAGGTGGTGGTAGG - Intergenic
1050707067 9:8413270-8413292 TAGTTTCAGATGCAGGTGGAGGG + Intronic
1050758706 9:9039489-9039511 TATTTACAAAAGCAGGATGGTGG - Intronic
1051402501 9:16698040-16698062 TATTTACAAAAGTAGGCAGCAGG - Intronic
1051632821 9:19156123-19156145 TATTTGCAAAAGCAGGTGGCAGG - Intergenic
1051782993 9:20710922-20710944 TATTTACAAAAAGAAGTGGGTGG - Intronic
1051848963 9:21486648-21486670 TATTTACAAAAGTAGGTGGTAGG - Intergenic
1052276104 9:26678481-26678503 TATTTATAAGGGCAGGAGGAGGG + Intergenic
1052449216 9:28605758-28605780 TATTTATAAAAGCAGGTGCTAGG - Intronic
1053017941 9:34674572-34674594 TATTTACAGAAACAGGTGGCAGG + Intergenic
1053049408 9:34946751-34946773 TATTGACACAAGCAGGTGCAAGG + Intergenic
1053106459 9:35413260-35413282 TATTTACAGAAGTGTGTGGAAGG - Intergenic
1053191848 9:36078122-36078144 TATTTCCAAAAACAGGTGGCAGG + Intronic
1053282841 9:36832182-36832204 TATTTAATAAAGCAGCTGCACGG - Intergenic
1053319689 9:37084992-37085014 TACTTACAAAAACAGGTGGCTGG + Intergenic
1053324208 9:37127966-37127988 TACTTACAAAAACAGGTGGCCGG + Intronic
1053433940 9:38062796-38062818 TATTTACAAAAACAGGCAGCTGG - Intronic
1055205048 9:73719092-73719114 TATTTTCAAAAGCAGCTGAAAGG + Intergenic
1055267543 9:74514455-74514477 TATTTACAAAAACAGGTGGCAGG + Intronic
1055582915 9:77727024-77727046 TATTCATAAAACCAGGTGGTGGG + Intronic
1055632921 9:78242197-78242219 TATTTACAAAAATAGGTGATAGG - Intronic
1055918124 9:81427978-81428000 AAATCACAAAAGCAGCTGGAGGG + Intergenic
1056004231 9:82250207-82250229 TATTCACAAAAACAGGTGGCAGG - Intergenic
1056285470 9:85083390-85083412 TATTTACAAAAATAGGTGGTGGG + Intergenic
1056410200 9:86318376-86318398 TATTTACAAAAACAGGCAGTGGG + Intronic
1056443030 9:86639275-86639297 TACTTGCAAAAGCAGATGGCAGG - Intergenic
1056554093 9:87675086-87675108 TATTTACAGAAGCAGGCAGTGGG - Intronic
1056901193 9:90601055-90601077 TTTTTAGCAAAACAGGTGGAGGG - Intergenic
1056939617 9:90944168-90944190 TATTTACAAAAATAGGCGGCAGG - Intergenic
1057017033 9:91661397-91661419 TATTTACAAAAACATGTAGTGGG + Intronic
1057049781 9:91914859-91914881 AATTTAGGAAAGCAGCTGGAAGG - Intronic
1057062941 9:92021561-92021583 GATTGACAAAACCAGCTGGAGGG - Intergenic
1057302192 9:93893381-93893403 TATTTACAAAAACAGGAAGCAGG - Intergenic
1057938586 9:99260878-99260900 TATTTATAAAAACAGGTGGTGGG + Intergenic
1057972948 9:99574776-99574798 TATTTATAAAAACAGGTGATGGG - Intergenic
1058463140 9:105201803-105201825 TATTCACAAAACCAGGTGGCTGG - Intergenic
1058478953 9:105371425-105371447 TATTTACAAAAGTAATTGGCAGG + Intronic
1058765710 9:108180897-108180919 TATTCACAAAACCTGGTAGAGGG - Intergenic
1058823176 9:108751619-108751641 TATTTACAAAAACAGATTGTGGG + Intergenic
1058982424 9:110182458-110182480 GATGTACAAAAGCAAGTGGCAGG + Intergenic
1058997799 9:110316955-110316977 TATTTACAAAAACAAGTGGAGGG + Intronic
1058999189 9:110330669-110330691 TATTTAAAAGAACAGGTAGAGGG - Intronic
1059522324 9:114955204-114955226 TATTTACAAAAGCAGGTGGTAGG + Intergenic
1059779487 9:117511235-117511257 TAGTGGCAAAAGCAGGTGAATGG - Intergenic
1059861638 9:118470021-118470043 TGTTTACAAAAACAGGTGACTGG + Intergenic
1059907666 9:119006326-119006348 TATTTTCAAAAACAGGCAGAGGG - Intergenic
1060010333 9:120038144-120038166 TATTTACAAAAGCAGACAGCAGG - Intergenic
1060033913 9:120238736-120238758 TATTTTCAAAAATAGGTGGTGGG - Intergenic
1060365572 9:123009090-123009112 TATTTACAAAAACAAGTGACAGG - Intronic
1060365730 9:123011385-123011407 CATTAACAAAAGCATGGGGATGG + Intronic
1060372861 9:123091123-123091145 TATTTACAAAAACAAGTGACAGG + Intronic
1060667726 9:125442792-125442814 AATTTAAAAGAGCAGCTGGAAGG - Intronic
1061563384 9:131421008-131421030 TATTTACAAAAACAGGAGGTGGG - Intronic
1062648051 9:137560049-137560071 TTTTTACAAAAGCAGTTAAAAGG + Intronic
1185814682 X:3143931-3143953 TACTTGGAAAGGCAGGTGGAGGG + Intergenic
1185856558 X:3541718-3541740 TATTTACAAAAACAGATGATGGG - Intergenic
1185970685 X:4659205-4659227 TACTTACAAAAACACATGGAGGG + Intergenic
1186040213 X:5468189-5468211 TATTTACAAAAACAGGCAGTGGG + Intergenic
1186119149 X:6339788-6339810 TCTTTACAAACACAAGTGGAGGG + Intergenic
1186127537 X:6430306-6430328 TTTACAGAAAAGCAGGTGGAGGG + Intergenic
1186221257 X:7351624-7351646 TAAATGCATAAGCAGGTGGATGG - Exonic
1186272636 X:7905793-7905815 TATTTACTGAAGCAGATGGTGGG - Intronic
1186310259 X:8309999-8310021 TATTTACAAAACTAGGTGGTGGG + Intergenic
1186335011 X:8577056-8577078 TATTTGCAAAACCAGGTTGCAGG + Intronic
1186339990 X:8634453-8634475 TATTTACAAAAACAAGAGGTGGG - Intronic
1186368092 X:8917028-8917050 TATTTAAATCAGCAGGAGGAGGG - Intergenic
1186370591 X:8942911-8942933 TATTTACAAAAACATGTAGCAGG + Intergenic
1186370993 X:8947236-8947258 TATTTACAAAAACAGGCAGCTGG + Intergenic
1186381736 X:9067872-9067894 CATTTACAAAAGCAGGTAGCAGG - Intronic
1186498285 X:10030090-10030112 TATTTACAAAGACAGGAGGCAGG + Intronic
1186519594 X:10193772-10193794 TATTTACAAAAACAGGCTGTGGG + Intronic
1186546415 X:10454519-10454541 TATTTACAAAACCAGGTAGCAGG + Intronic
1186547932 X:10470339-10470361 TATTTACAAATATAGGTAGAGGG + Intronic
1186547977 X:10470922-10470944 TATTTACAAAAACAGGCAGTGGG - Intronic
1186592561 X:10946659-10946681 TATTTACAAAAGCAGGCAATGGG + Intergenic
1186622630 X:11257481-11257503 TATTTACAAAAACAGCAGGCTGG + Intronic
1186633059 X:11371289-11371311 TATTTACAATAACAGGTGATGGG - Intronic
1186712793 X:12217692-12217714 TATTTACAAAAACAGATGAAGGG - Intronic
1186748106 X:12591524-12591546 TATTTATAAAAACAGGCAGAGGG - Intronic
1186893601 X:13984434-13984456 TATTTACAAAATCAGGTGGTAGG - Intergenic
1186896369 X:14008271-14008293 TATTTATAAAAACAGGCGGCCGG - Exonic
1186923230 X:14304585-14304607 TATTTACAAAAACAATTGGGAGG + Intergenic
1186953917 X:14659111-14659133 TATTTGCAAAAACAGGTAGTGGG - Intronic
1187028218 X:15457833-15457855 CTTTTACAAAAACAGGTGGCAGG - Intronic
1187116112 X:16353036-16353058 TATTTACAAAAACAGGCGATAGG + Intergenic
1187416800 X:19100441-19100463 CATTTACAGAAACAGATGGAGGG + Intronic
1187434503 X:19254923-19254945 TATTTATGAAAACAGGTGGCAGG + Intergenic
1187575882 X:20554774-20554796 TACTTACAAAAACAAGTGGTTGG - Intergenic
1187708278 X:22028656-22028678 TATTTACAAAAACAGGCAGTGGG + Intergenic
1187722519 X:22165975-22165997 TATTTATAAAAACAGGGGTAGGG + Intronic
1187729325 X:22236584-22236606 TATTTACAAAAACAGGCAGCAGG - Intronic
1187767842 X:22662810-22662832 TATTTACAAGAGCAGGTAGTGGG - Intergenic
1187980372 X:24750064-24750086 TATTTACAAAAATAGATGGCAGG - Intronic
1188010895 X:25054919-25054941 TATTTACAAAAACAGGTGGTGGG + Intergenic
1188250578 X:27888570-27888592 TATTTAGAAAAACAGGTGGTGGG - Intergenic
1188295978 X:28448884-28448906 TATTTACAAAAACAGGCAGCTGG - Intergenic
1188310557 X:28611934-28611956 TATTTAAAAAAACAGGTGGCTGG - Intronic
1188527775 X:31104933-31104955 TATTTACAAAATTAAGTGGCAGG - Intronic
1188625804 X:32283699-32283721 TATTTACCAAGGCAGATGGCAGG - Intronic
1188912474 X:35866516-35866538 TTTTTACAAAGAAAGGTGGAGGG - Intergenic
1189030614 X:37445804-37445826 TATTTACAAGAACAGATGGTGGG - Intronic
1189138877 X:38580116-38580138 TATTTACAAAAAGAGGTGGCTGG - Intronic
1189180598 X:39001027-39001049 TATTTACAAAAACAGGTCAGAGG - Intergenic
1189264774 X:39705885-39705907 TATTTATAAAAGCAGGTGGTGGG + Intergenic
1189339716 X:40195554-40195576 TATTTACAAAAACAGGCAGCTGG + Intergenic
1189401327 X:40671525-40671547 TATTTACAAAAACAGGTGACAGG + Intronic
1189533264 X:41908971-41908993 TATTTACAAAAACAGGCAGTAGG + Intronic
1189554060 X:42123983-42124005 TATTTACTAACATAGGTGGAGGG + Intergenic
1189952839 X:46249920-46249942 TATTTTCAAAAATAGGTGGTGGG - Intergenic
1190339215 X:49283099-49283121 TATTTACTGAAGCTGGGGGATGG - Intronic
1190846898 X:54201643-54201665 TATTTACAAAAAGAGGTGGTGGG - Intronic
1192161898 X:68794660-68794682 TATTTACATAAGCTAGTGGCAGG + Intergenic
1192182563 X:68925379-68925401 TATTTACAAAAACAGGCAGTGGG - Intergenic
1192778971 X:74274922-74274944 GATTTACAAAAACAGGTAGTAGG - Intergenic
1193401222 X:81045294-81045316 TATTTATAAAAACAGGTGGTGGG - Intergenic
1195423347 X:104699682-104699704 TATTTACAAAAGCAGGCAGCAGG - Intronic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1195894118 X:109727886-109727908 TATTTACAAAAACCGGTGGTGGG + Intronic
1195898908 X:109777186-109777208 TATTTACAAAAACAGGCAGTGGG + Intergenic
1195996921 X:110740847-110740869 TATTTACAAAAACAAGTTGCAGG - Intronic
1196261088 X:113582355-113582377 TATTTAAAAAATTAGGTAGAAGG - Intergenic
1196329922 X:114459948-114459970 TAGTTACAAAAACAGGTAGTGGG - Intergenic
1196432798 X:115645105-115645127 TGTTTACAATAGCAGTAGGAAGG - Intronic
1196519644 X:116658356-116658378 TATTTACATAAACAGGTGGTGGG - Intergenic
1196791325 X:119467973-119467995 TATTTACAAAACAAGGGGGCCGG + Intergenic
1197840049 X:130736633-130736655 TATTTACAAAAACAGGTAGTGGG + Intronic
1198017272 X:132624123-132624145 TATTTACAAAAGCAGGCAGAGGG + Intergenic
1198244019 X:134811780-134811802 TATTTGCAAATCCAGGTGGTGGG - Intronic
1198574425 X:137994352-137994374 TATTTACAAAATCAGATGGTGGG - Intergenic
1198600208 X:138275754-138275776 TATTTACAAAGACAACTGGAGGG + Intergenic
1199049036 X:143213782-143213804 TATTTATAAAATCAGGTAGTAGG + Intergenic
1199145806 X:144365356-144365378 TATTAACAAAAGCAGATGGCTGG - Intergenic
1199150812 X:144484258-144484280 TATTTACAAAGACAGGCAGAGGG + Intergenic
1199399995 X:147388191-147388213 TATTTACAAAAGCAAGTGGTGGG + Intergenic
1199406794 X:147471563-147471585 TATTTACAAAAACAGGTGATGGG + Intergenic
1199519176 X:148715940-148715962 TACCTACAAAAGCAGGAGAAGGG - Intronic
1199590399 X:149462625-149462647 CATTTACAAAAGCAAGTGGTGGG + Intergenic
1199604234 X:149563822-149563844 TAACTATAATAGCAGGTGGAGGG + Intergenic
1201376406 Y:13326001-13326023 TATTTTCAAAAGCAGGTTGGTGG + Intronic
1201534603 Y:15031959-15031981 TATTTACAAAACCAGATGTTGGG - Intergenic
1201551208 Y:15218719-15218741 TATTTATAAAAGCAGGCAGTGGG - Intergenic
1201559964 Y:15305395-15305417 TATTTGCAAAGGGTGGTGGATGG + Intergenic
1201577186 Y:15473569-15473591 TATTTACAAATACAGGTGGTAGG + Intergenic
1201609761 Y:15827802-15827824 TTTACAAAAAAGCAGGTGGAGGG + Intergenic
1202300160 Y:23404890-23404912 TATTTACAAAAGCAGGCCGGTGG + Intergenic
1202570650 Y:26265708-26265730 TATTTACAAAAGCAGGCCGGTGG - Intergenic