ID: 1195755046

View in Genome Browser
Species Human (GRCh38)
Location X:108191827-108191849
Sequence GAAATGGTACAGCTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195755046_1195755054 29 Left 1195755046 X:108191827-108191849 CCTGGGGCCAGCTGTACCATTTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1195755054 X:108191879-108191901 CTCACAGCAGCCCATCTCCAAGG 0: 1
1: 0
2: 2
3: 61
4: 388
1195755046_1195755052 2 Left 1195755046 X:108191827-108191849 CCTGGGGCCAGCTGTACCATTTC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1195755052 X:108191852-108191874 GGTGGCTGCTTTAAAAACATAGG 0: 1
1: 0
2: 1
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195755046 Original CRISPR GAAATGGTACAGCTGGCCCC AGG (reversed) Intronic
900149443 1:1171711-1171733 GAGATGGTCCCGCTGGACCCTGG - Intergenic
901231136 1:7642245-7642267 GAAATGGCACAGCTGCCCTTGGG + Intronic
901943723 1:12683982-12684004 GAAAAGGTGCAGCTGGAACCTGG - Intergenic
902672578 1:17985079-17985101 GAAAGGGAACAGCCAGCCCCTGG + Intergenic
903560319 1:24222169-24222191 GGACTGGGACAGCTGGCACCAGG + Intergenic
904172187 1:28599171-28599193 GAGATGATGCAGCTGGCTCCAGG - Intronic
904263881 1:29306773-29306795 GGCATGGCACATCTGGCCCCAGG - Intronic
911790007 1:102002755-102002777 GAAAAAGTACAGTTGGCCCTTGG - Intergenic
912749124 1:112270868-112270890 GAAGAGGGACAGCTTGCCCCTGG - Intergenic
920387835 1:205580770-205580792 GACATGGAACAGGTGGCCTCGGG - Exonic
920638068 1:207724358-207724380 GCGATGGGACAGCTGGCCACTGG - Intronic
924412386 1:243819633-243819655 GAAATCGTCCAGCTGTCCCTTGG - Intronic
1073855622 10:107670058-107670080 CAAATGTTACAGCTGGAACCTGG - Intergenic
1075403919 10:122181316-122181338 TCATTGGTACAGCTGTCCCCTGG + Intronic
1075526660 10:123192630-123192652 GAAATGGAGCAACTGGCCACTGG + Intergenic
1076405475 10:130209476-130209498 GAAATGAGAGAGCTGGACCCTGG - Intergenic
1079331469 11:19536427-19536449 GAGCTGGTACAGCTGGTCCCTGG - Intronic
1080191322 11:29552610-29552632 TGAATGGCATAGCTGGCCCCTGG + Intergenic
1081988480 11:47324695-47324717 GAACTGGAGCAGCTGGACCCAGG + Intronic
1082683960 11:56215514-56215536 GAATTGATACTGCTGGCCCTGGG + Intergenic
1083397105 11:62399732-62399754 GATGGGGTACAGTTGGCCCCTGG + Intergenic
1083844305 11:65321912-65321934 GACAGGGCACAGCTGGCCACAGG + Exonic
1084594255 11:70107691-70107713 CAAATGGCAGAGCTGGCGCCAGG + Intronic
1088281986 11:108144418-108144440 GAAAGGGAACAGCTGGCAGCAGG + Intronic
1090276990 11:125427199-125427221 GAGAGGGTGCAGATGGCCCCAGG - Intronic
1091294183 11:134461173-134461195 GAAAAGGTAGAGCTGGTCCCAGG - Intergenic
1092099359 12:5870354-5870376 GAAGTGGCAGAGCTGGCACCAGG - Intronic
1092397633 12:8142195-8142217 GAAATTTTACAGCTGGCCTCTGG - Intronic
1092889666 12:12956885-12956907 GAAATTATATAGCTGGCCCTGGG + Intergenic
1095942225 12:47734882-47734904 GAGAGGGGACAGCTGGCTCCAGG + Intronic
1098499183 12:71170717-71170739 GAAATGTTAGATTTGGCCCCTGG - Intronic
1099513461 12:83566945-83566967 GAAATTGAACAGCTGACCCAAGG + Intergenic
1101307215 12:103540618-103540640 GAAATGATATAGCAGGCCACAGG - Intergenic
1104231518 12:126889131-126889153 GAATGGGTAGAGCTGACCCCCGG - Intergenic
1104599344 12:130142013-130142035 GAAATGGCTCTGCTGACCCCTGG - Intergenic
1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG + Intronic
1110806029 13:79755460-79755482 GAAATGGAACATCTGACCCAAGG - Intergenic
1118822046 14:69352176-69352198 CAAAAGGTACAGGAGGCCCCAGG - Intronic
1119083102 14:71715255-71715277 GAAATGGTACAACTGGCCACAGG - Intronic
1122329380 14:100902445-100902467 GACATGGAGCAGCTGGCCCCAGG - Intergenic
1123913635 15:24997664-24997686 GAAATGTTATAGCTGGCTACTGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1125077540 15:35636914-35636936 GGTATTGTACAGCTGGCACCTGG + Intergenic
1125243945 15:37612175-37612197 AAAATGGTACAGCTGTTCCAGGG - Intergenic
1125761839 15:42101913-42101935 GAAAAGATACAGCTTGACCCTGG + Intergenic
1125886985 15:43236536-43236558 GAAGGGGTAGAGCTGGTCCCTGG - Intronic
1126352487 15:47759053-47759075 GAAGTGGCACAGCTGACACCAGG - Intronic
1127349907 15:58140899-58140921 GGACTGGTACAGGTGGTCCCTGG + Intronic
1127661189 15:61101790-61101812 GAGATGGTACAGAGGGCCACTGG + Intronic
1132846504 16:2003308-2003330 TAAAGGGTACAGCTGTCCCAGGG - Intronic
1136010661 16:27361531-27361553 GGAAAGGTCCAGCAGGCCCCAGG - Intronic
1138193927 16:55038514-55038536 GAAGTGGCACAACTGTCCCCAGG - Intergenic
1138420154 16:56893631-56893653 GATATGTGACAGCTGGCCCTTGG + Intronic
1139517736 16:67461745-67461767 GAGATGGTCCAGCTGACACCAGG + Intronic
1142616672 17:1140458-1140480 GATCTGGTACAGGTGGCACCTGG - Intronic
1145177278 17:20711789-20711811 GAAATAGTACAGTTGGGCCACGG - Intergenic
1145940162 17:28739114-28739136 GAAATGGTGCAGGTGGCCTGTGG + Exonic
1150029570 17:61718757-61718779 CAAATGGTACAGTTGTCCCTTGG + Intronic
1151419635 17:73988698-73988720 GAAGTGGTCCTTCTGGCCCCAGG - Intergenic
1153947606 18:10031342-10031364 GACAAGGCACCGCTGGCCCCGGG - Intergenic
1156036199 18:32770454-32770476 GCAATGGAACTGCTGGCCCTGGG + Exonic
1156525705 18:37765544-37765566 GCAGTGGTACACCTGGACCCTGG - Intergenic
1156786636 18:40923092-40923114 GAAAAGGAAGAGCTTGCCCCAGG - Intergenic
1159892351 18:73964557-73964579 TACATGGAACAGCTGGGCCCTGG + Intergenic
1164837978 19:31370483-31370505 GGAATGGTACAGTTTGCCCCTGG - Intergenic
1166592141 19:44008936-44008958 GTAATGGTACATCAGGCCTCAGG + Intronic
1166599443 19:44081161-44081183 GTAATGGAACATCAGGCCCCAGG + Intronic
1167421551 19:49407002-49407024 GAAATGGGAAAAATGGCCCCGGG - Intronic
1167441019 19:49508943-49508965 GTAATGTTACAGCAGGGCCCTGG + Intronic
1167526966 19:49990219-49990241 GAACTGGTATAGCTTGCCCAAGG - Intronic
925078163 2:1037217-1037239 GACATGGTCCAGCTGGCTCTGGG - Intronic
928914477 2:36456699-36456721 GAAATGTTACAGCTGGGATCTGG - Intronic
931103593 2:59030269-59030291 GAAATCATACAGCTGGACACTGG - Intergenic
932300521 2:70663792-70663814 GAAATGGTTCTGTTAGCCCCAGG - Intronic
932366341 2:71155838-71155860 GAAGTGGTCCAGCTGGCAGCTGG + Intergenic
933757613 2:85652374-85652396 AAGATGCTACATCTGGCCCCAGG + Intergenic
936629767 2:114189521-114189543 CAAATGATACAGGTGTCCCCTGG - Intergenic
937274543 2:120675417-120675439 GAAAGGGGAGAGCCGGCCCCAGG + Intergenic
937610256 2:123852723-123852745 GGCAAGGAACAGCTGGCCCCAGG + Intergenic
1173835933 20:46125669-46125691 GACCTGGTCCAGGTGGCCCCAGG - Intronic
1175142084 20:56868281-56868303 GAAATGGTTCCTCTAGCCCCAGG - Intergenic
1176302140 21:5103594-5103616 GACATGGTCCAGGAGGCCCCAGG - Intergenic
1178441828 21:32604629-32604651 GAAAAGGTACAGATGGCAGCAGG + Intronic
1179354053 21:40642151-40642173 GTACTGGCACAGCTGGGCCCTGG + Intronic
1179854887 21:44158302-44158324 GACATGGTCCAGGAGGCCCCAGG + Intergenic
1183815718 22:40298669-40298691 GAAATGGCAGAGCTGGGGCCGGG + Intronic
950995726 3:17494317-17494339 GAAATGTTTCAGCTGGCATCAGG - Intronic
953119455 3:40025672-40025694 GAAATTTTACAGCTGGGCCACGG + Intronic
953415641 3:42714545-42714567 GAAATGGCACACCTAGCCACAGG - Intronic
954312567 3:49781669-49781691 GATATAGTCCAGCTGGCTCCAGG - Intronic
962477266 3:135766044-135766066 CAAATACTACAGCTGACCCCAGG + Intergenic
964406356 3:156352805-156352827 GGAATGGCTCAGCTGGGCCCAGG - Intronic
965670225 3:171140382-171140404 GAACAGGTACAGCTGGGACCAGG - Exonic
967356280 3:188575507-188575529 GAAATGGTACAGCTAGTACGTGG + Intronic
967814123 3:193784987-193785009 GAAATGGAAAAGCTGGCCTCTGG + Intergenic
975472942 4:74791902-74791924 GAAGTGGTAGAGCTGGAACCAGG + Intronic
980694538 4:136337788-136337810 CAATTGGTACAGTTGGCCCAGGG - Intergenic
985713545 5:1443387-1443409 GAGATGGTACAGCTGGGGCACGG + Intronic
988728465 5:33946780-33946802 GAAATGCTGCAGGTGGCACCAGG + Intronic
996611863 5:125391978-125392000 GAGTTGGTACAGCAGGCGCCAGG - Intergenic
1000304952 5:159986676-159986698 GAAATGATACAGTTGGTCCATGG + Intergenic
1003169590 6:3710583-3710605 GAAATTCTACAGCATGCCCCAGG + Intergenic
1004490237 6:16108237-16108259 GAAACATGACAGCTGGCCCCAGG + Intergenic
1004814106 6:19293963-19293985 GAAATGCAAAAACTGGCCCCAGG - Intergenic
1006165950 6:32064990-32065012 GAAATGGTCAAACTGGCCCTCGG + Intronic
1006628055 6:35411404-35411426 GAAGTGGTGCAGCTTGCTCCAGG - Intronic
1006794271 6:36721967-36721989 GGAAGGGCTCAGCTGGCCCCAGG - Exonic
1006978042 6:38122127-38122149 GTTATGGTACAGTTGTCCCCTGG + Intronic
1007292475 6:40798032-40798054 GCAATGATCCATCTGGCCCCTGG - Intergenic
1007629562 6:43265242-43265264 CAAGTGGTAGAACTGGCCCCTGG - Intronic
1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG + Intergenic
1011131356 6:84054792-84054814 GGAATGGTACAGGAGGCCCTTGG + Intronic
1011430854 6:87285105-87285127 GAGATGATACAACTGGCCCATGG + Intronic
1012682268 6:102196999-102197021 GAAATTTTACAGCTGGGCCTTGG + Intergenic
1014725644 6:124968541-124968563 GAAAAAGTCCTGCTGGCCCCAGG - Intronic
1019514927 7:1435358-1435380 GACATGGTACAGGAGGGCCCTGG + Intronic
1019996119 7:4725488-4725510 GAAAGCGGACATCTGGCCCCGGG - Intronic
1026465606 7:70651253-70651275 TAAATGGTAAAGCTGGACCCAGG + Intronic
1029229255 7:99052663-99052685 GAAATTGTACAGTTGGCCTTGGG - Intronic
1029549821 7:101231847-101231869 GAAATAGCAGAGATGGCCCCTGG - Intergenic
1030012703 7:105186933-105186955 GAAAGCTTACATCTGGCCCCTGG - Intronic
1032069614 7:128795688-128795710 TAAGTGGTATAGCTGGGCCCAGG - Intronic
1033472092 7:141659439-141659461 GAAAATGTCCAGTTGGCCCCTGG - Exonic
1034198726 7:149267257-149267279 GCGATGGTGCAGCTAGCCCCTGG - Intronic
1035430681 7:158818497-158818519 GAAATGGAACAGATGAGCCCTGG - Intronic
1037884300 8:22588406-22588428 GAAATGGTGCCCCTGGCCCTGGG + Intronic
1037884880 8:22590673-22590695 GAAATGGTGCCCCTGGCCCTGGG + Intronic
1037973465 8:23191886-23191908 GAGCTGGTACAGCAGGCCCAGGG - Exonic
1039507392 8:38061800-38061822 GTGATGCTACAGCTGGACCCTGG + Intergenic
1041103170 8:54417048-54417070 CAAATGCAAAAGCTGGCCCCTGG - Intergenic
1041373370 8:57188374-57188396 GAAAAGGTACACATGGCCCAAGG + Intergenic
1045388771 8:101694628-101694650 GAAATGGCTCAGCTTACCCCAGG - Intronic
1051192649 9:14531654-14531676 CAAATGGTACAGTCGGTCCCAGG - Intergenic
1052454746 9:28681590-28681612 GAAAAGGGACAGCTGGCTCCTGG + Intergenic
1052532278 9:29702058-29702080 GAAATGGGATAACTGGCCCAAGG - Intergenic
1052975702 9:34408363-34408385 GAGATGGGACAGCTGGGCTCTGG + Intronic
1056346249 9:85698505-85698527 CAAATGGTAGAGCTGCCCTCTGG - Intronic
1057124112 9:92602704-92602726 GACATGGTACCCCTCGCCCCTGG - Intronic
1057502601 9:95607544-95607566 GTGATGGTGCTGCTGGCCCCCGG + Intergenic
1058444963 9:105046717-105046739 GAACTTGTAGATCTGGCCCCTGG - Intergenic
1059723828 9:116986793-116986815 GAGATGGTTCTGCTGTCCCCAGG + Intronic
1060223036 9:121774407-121774429 GAAAAGGTAAAACTGGACCCTGG + Exonic
1061576941 9:131513285-131513307 GACATGGTGCAGCTGGTCCACGG + Exonic
1062133670 9:134913512-134913534 GAACGTGTGCAGCTGGCCCCAGG + Intronic
1186541709 X:10407885-10407907 GACATGGTACATTTGTCCCCAGG - Intergenic
1187401778 X:18966807-18966829 GAAATGCTGGAGCTGGTCCCTGG + Intronic
1194467749 X:94254953-94254975 GAATTGCTGCAGCTGGCACCAGG - Intergenic
1195755046 X:108191827-108191849 GAAATGGTACAGCTGGCCCCAGG - Intronic
1196699546 X:118653290-118653312 GAAAAGATACAGCTTTCCCCTGG + Intronic
1197041425 X:121940213-121940235 GAAATTTTACAGCTGGGCCTCGG - Intergenic