ID: 1195755572

View in Genome Browser
Species Human (GRCh38)
Location X:108195725-108195747
Sequence GGAGATCTTTAAATAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195755572 Original CRISPR GGAGATCTTTAAATAGATTA TGG Intronic
903315098 1:22497156-22497178 GTGGATCTTTAACTAGAATAAGG + Intronic
904487124 1:30833255-30833277 GGAGTTCTTTATATATATTCTGG - Intergenic
905154951 1:35969186-35969208 GGAGTTCTTTATATATATTCTGG + Intronic
905762417 1:40571132-40571154 TTAGATCTTTTAATAGATTCAGG - Intergenic
906930950 1:50168831-50168853 GGAGTTCTTTAATTAGTTTTGGG - Intronic
906938119 1:50232337-50232359 GGAGAACTTTGAAAACATTATGG - Intergenic
908209279 1:61883309-61883331 GTAAATATTTAAATAAATTATGG + Intronic
909168302 1:72257542-72257564 GTAGATCTTTAAATATATGGAGG - Intronic
909323138 1:74315857-74315879 GGAGATATAAAAATAGACTAGGG + Intronic
909527173 1:76638376-76638398 AGAAATCGTTAAATAGCTTAGGG - Intergenic
909932478 1:81513293-81513315 GGAGAACTTTGAATAGACAATGG + Intronic
910022551 1:82609799-82609821 AGAGATATTTAAATTGATAATGG + Intergenic
912910636 1:113756091-113756113 GGAAATCTTTAAATTGGCTAGGG + Intronic
913263491 1:117022499-117022521 GGAGATCTTTAAAAATGTAATGG + Intronic
913446502 1:118955972-118955994 AGAGATCTTCAAGGAGATTATGG - Intronic
916482718 1:165229766-165229788 GGATATCTGTAAATACATGAGGG + Intronic
917341879 1:173988113-173988135 GTAGAACTTTACAAAGATTATGG - Intronic
917453934 1:175169902-175169924 GGAGCTCATTAAATACATTGAGG - Intronic
917863195 1:179168083-179168105 GTATATTTTTAAATAGATAATGG + Intronic
918272352 1:182914065-182914087 AGAGATCTTTAATAAGATTAAGG + Intronic
918425401 1:184404715-184404737 GGAAATCCTTGAATAGATTGTGG + Intronic
918938961 1:190964737-190964759 GGAGGTCTAGAAAGAGATTAGGG + Intergenic
919121779 1:193349911-193349933 TGAGATCTTTAAATGCATTTAGG + Intergenic
921886496 1:220312611-220312633 GGAGATCCCTAAACAGATTTCGG + Intergenic
923961262 1:239086020-239086042 GAAGATCTTCAAATAGAAGAGGG - Intergenic
924456156 1:244220202-244220224 GGAAACCTTTAAATAGAACAGGG + Intergenic
1063192103 10:3705275-3705297 GGATATCTTTAATTAGTTAAGGG - Intergenic
1064645052 10:17452716-17452738 GGAAACTATTAAATAGATTATGG + Intronic
1065868085 10:29931522-29931544 GGAAATGGTTAAATAGACTACGG - Intergenic
1065992084 10:31021282-31021304 GGAGATGTTAAAATAAATTTAGG - Intronic
1066340752 10:34530576-34530598 GGAAATCATTAAAGAGATTGTGG - Intronic
1067882225 10:50055855-50055877 GGAGATGTTGCACTAGATTAAGG + Intergenic
1068134588 10:52939577-52939599 GGAGATATTTACATATATTCTGG + Intergenic
1069268305 10:66491633-66491655 AGACATCCTTAAATGGATTAGGG + Intronic
1070034580 10:72709949-72709971 GGTGAACTTTAAATACATAATGG + Intronic
1070868592 10:79727150-79727172 GTATTTCTTTTAATAGATTAAGG + Intergenic
1071635506 10:87249365-87249387 GTATTTCTTTTAATAGATTAAGG + Intergenic
1071659734 10:87488609-87488631 GTATTTCTTTTAATAGATTAAGG - Intergenic
1072122523 10:92416803-92416825 GGATATATATAAATATATTAAGG - Intergenic
1073610167 10:104935422-104935444 GGAGATGTTTAAATACATCTAGG + Intronic
1077650409 11:3966412-3966434 GTAGATGATTAAATGGATTAGGG + Intronic
1081879923 11:46440601-46440623 GGCCAACTTTAAATAAATTATGG + Intronic
1081949690 11:47033579-47033601 GGAGATCATGAAAGAGATTGTGG - Intronic
1083494066 11:63035042-63035064 GGAGATTTTTAAATGCATTAGGG - Intergenic
1087250362 11:95892264-95892286 GGATGTTATTAAATAGATTAGGG - Intronic
1087331226 11:96783141-96783163 AGAGATATTCAAACAGATTAGGG - Intergenic
1087785045 11:102345131-102345153 AGAGATTTTTAAATAGTATATGG + Intergenic
1088538508 11:110887466-110887488 GGAGCACTGTAAAGAGATTAGGG + Intergenic
1088903551 11:114136987-114137009 GGAGGTCTTTAAAAATATTCTGG + Intronic
1093144481 12:15548657-15548679 GGGGCTCATTAAATAAATTATGG + Intronic
1093360337 12:18218473-18218495 GGTGTTGTTAAAATAGATTAGGG - Intronic
1094095779 12:26702772-26702794 GGATATCTTTACATTGAATAAGG + Intronic
1095279012 12:40327534-40327556 GGAGAACTTTAAAAGGATTTAGG + Intronic
1097786168 12:63762177-63762199 GGAGTTTTTTAAATATATTCTGG + Intergenic
1097974917 12:65674516-65674538 GTAGATTTTTAGATAGATCATGG + Intergenic
1098021452 12:66160470-66160492 GGGGATGGTTAAATAAATTATGG + Intronic
1098081418 12:66789636-66789658 GGACATGTTTAAATAGTTAATGG - Intronic
1098099598 12:67000499-67000521 GGAGAGCTTTCAATTAATTATGG + Intergenic
1098348926 12:69536460-69536482 GGAGTTTTGTAAATAGAATAAGG + Intronic
1098723589 12:73932951-73932973 TGAACTCTTTAAATAGATTTAGG - Intergenic
1100282620 12:93132470-93132492 AGAGGTCTTTAAAAAGTTTATGG + Intergenic
1100899504 12:99221924-99221946 GGAGATAGTTAAATAAATTAAGG + Intronic
1101356585 12:103984098-103984120 GGAGAAATTTAAATATATTTAGG - Intronic
1102393863 12:112571623-112571645 TAAGATCTTTAAATACATTTTGG + Intronic
1104593442 12:130103144-130103166 GGATCTGTTTAAATAAATTATGG + Intergenic
1106668929 13:31883967-31883989 GGAGTTATTTATATAAATTATGG + Intergenic
1106674370 13:31942379-31942401 AGAGATCTTTAAAAACATAATGG + Intergenic
1107316916 13:39142550-39142572 GGAATTCCTTAAATAGATTATGG - Intergenic
1107333721 13:39330717-39330739 GAAATTCCTTAAATAGATTATGG - Intergenic
1107700039 13:43038023-43038045 GGGAATCATTAAATAAATTAAGG - Intronic
1108303785 13:49109529-49109551 GGAGATCTTTCATTACTTTATGG - Intronic
1110011171 13:70335924-70335946 AGAGATCCTCAAATGGATTATGG + Intergenic
1111279051 13:85994771-85994793 TGAGATTTTTAAAAATATTAAGG - Intergenic
1111941531 13:94613754-94613776 TGGCATCTTTAAAAAGATTAAGG - Intronic
1115455696 14:33599736-33599758 GGAGATCTTGACTTAGATTTGGG + Intronic
1115461819 14:33669619-33669641 GGAGATCTTCAAAGAGTTTGTGG + Intronic
1116047633 14:39763963-39763985 GGAGAACTTGAAATTGATCATGG + Intergenic
1116064476 14:39965255-39965277 TGAGATATTTAAATGGATTATGG + Intergenic
1117253699 14:53957309-53957331 GGAAATCTTTTAACAGTTTATGG - Intronic
1118000780 14:61521730-61521752 GGTAAGCTTTAAAAAGATTAAGG - Intronic
1119276190 14:73358435-73358457 GGAGAACTGTAAGTAGTTTAGGG - Intronic
1120034031 14:79675162-79675184 TGATATCTTTATTTAGATTAGGG + Intronic
1120302979 14:82731894-82731916 GGAAATCTTTAAAAAGATCTAGG - Intergenic
1120982941 14:90307275-90307297 GGAAATGGTTAAATAAATTATGG - Intronic
1121422621 14:93825932-93825954 GGAGAACTGTAAATACTTTAAGG - Intergenic
1121887139 14:97553929-97553951 GGAGCTCTTTAGATAGGGTATGG + Intergenic
1126817629 15:52469962-52469984 GGAAATCATGAAAGAGATTATGG - Intronic
1129316181 15:74746188-74746210 GGAGAATTTCAAATAGTTTATGG + Intergenic
1130289171 15:82581731-82581753 GGAGATTTTTAAAAACATTGGGG - Intronic
1131197972 15:90372150-90372172 GGAGATCTGGAAATACTTTATGG - Intergenic
1132378198 15:101346313-101346335 AGAGATGCTTAAATAAATTATGG + Intronic
1137229062 16:46544864-46544886 GGAGATCATGAAAGAGATTGTGG + Intergenic
1137384535 16:48029419-48029441 GGAGAGTGTTAAATATATTAAGG + Intergenic
1137464359 16:48694773-48694795 GGAGATCTTTAAAAAGAACTGGG - Intergenic
1137668350 16:50265139-50265161 GGAGATCTTTATATATGCTAGGG + Intronic
1139027995 16:62843019-62843041 GGAGAACTATGAATACATTATGG - Intergenic
1141969207 16:87468967-87468989 AGACATCTTTAAAAAGAATACGG + Intronic
1142771951 17:2104520-2104542 GAAGCTCTTTAAAGAGGTTAAGG + Intronic
1143354313 17:6314119-6314141 GCAGATATGTAAATAGATTTAGG + Intergenic
1143384524 17:6519983-6520005 GGAGATCTTCATATATATTCTGG - Intronic
1146138358 17:30342979-30343001 GTATATCCTTAAATAGATTATGG - Intergenic
1148406093 17:47417701-47417723 GGAGATCATGAAAGAGATTGTGG - Intronic
1149779209 17:59383059-59383081 GAATAGTTTTAAATAGATTAGGG + Intronic
1151114568 17:71720831-71720853 GGAAATCTGTGAATAGATTGAGG + Intergenic
1151299515 17:73212855-73212877 AAAGTTCTTTAAACAGATTAGGG + Intronic
1153334872 18:3912933-3912955 GCTGATCTATAAATAGCTTATGG - Intronic
1153437395 18:5082270-5082292 GTAGATGTTTAAATAGATTTGGG - Intergenic
1153465600 18:5384811-5384833 GGAAATCTGTAAATAAATCATGG - Intergenic
1153673139 18:7431633-7431655 TGAGATATTTCAATAGGTTAGGG - Intergenic
1153812121 18:8761426-8761448 GAAGTTCTTGAAATAGATAATGG - Intronic
1155752079 18:29437887-29437909 GTAGATCTTTCAAAAGATTGGGG + Intergenic
1156101225 18:33597437-33597459 GGAGATGGTTAAATAAATGAAGG - Intronic
1157087030 18:44591387-44591409 TGAGATTTTTAAAAAGAGTAGGG - Intergenic
1157507163 18:48235991-48236013 GGTGATCTTTAAAGAGAAAATGG - Intronic
1158501619 18:58007566-58007588 GGAGATGCATAAATACATTATGG + Intergenic
1158506863 18:58054142-58054164 GTAATTCTCTAAATAGATTAGGG - Intronic
1160381576 18:78461012-78461034 GGCGCTCTTTGAAGAGATTAAGG - Intergenic
1164472597 19:28548526-28548548 GGAAACCTTTAAATGTATTATGG + Intergenic
1165877662 19:39020726-39020748 GGAAATCATTAAAGAGATTGTGG + Intronic
925263788 2:2550350-2550372 GGAGGTTTTTAAGTAGATTTAGG - Intergenic
926036052 2:9636780-9636802 GAAGATCTTTAAATATTTTGTGG - Intergenic
926544783 2:14226134-14226156 GGAGATCTTAAGGCAGATTAAGG - Intergenic
926614974 2:14987822-14987844 GGAAATATTTAAATATATTTCGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927696486 2:25242948-25242970 GGGGTTCGTTAAATAAATTACGG + Intronic
928274295 2:29885533-29885555 GGAAATCATGAAAGAGATTATGG + Intronic
928901128 2:36318672-36318694 GGAGATATTTAAATAGAATCTGG + Intergenic
933720700 2:85395641-85395663 GGAGATTTTTAAAAAGAGCAGGG + Intronic
933871030 2:86565439-86565461 GGAAATGGTTAAATAAATTATGG - Intronic
935274239 2:101462441-101462463 GGATATGGTTAAATAAATTATGG + Intronic
935288882 2:101592316-101592338 GGAGATGTACAAAGAGATTAAGG - Intergenic
935362636 2:102260429-102260451 GGTAATATTTAAATAAATTATGG + Intergenic
935483548 2:103623725-103623747 AGAGATCTTCACATAGATGAGGG - Intergenic
936647299 2:114386647-114386669 GAAGCTCTTTAAATAGCTCATGG + Intergenic
938154804 2:128925797-128925819 GGAGACTTTTAATTAGATTCTGG + Intergenic
938671653 2:133592171-133592193 GGAGCTGGTTAAATAAATTAGGG - Intergenic
939438599 2:142211586-142211608 GTAGAACTTAAAATAGACTATGG - Intergenic
940548143 2:155116136-155116158 GGAGACAGTTAAACAGATTATGG + Intergenic
940641002 2:156343904-156343926 GTACATCTTAAAATATATTAGGG + Intergenic
941681598 2:168405423-168405445 GGGGGTCTTTAAATAGTTCATGG + Intergenic
942716188 2:178895174-178895196 GGAAATGTTTGAATAGTTTAAGG - Intronic
942850618 2:180480561-180480583 CTAACTCTTTAAATAGATTAGGG + Intergenic
943237023 2:185335948-185335970 GAAGAACTATAAATAGAATAGGG - Intergenic
943698507 2:190962872-190962894 GGAGAATTTTAAATACATCATGG - Exonic
944459515 2:199931985-199932007 GGAAATCTTTAACTAGGCTAAGG + Exonic
947395408 2:229681784-229681806 GGAGTTCATTTAATAGGTTAAGG + Intronic
1170326961 20:15166682-15166704 GAACTTCTTTAACTAGATTAAGG + Intronic
1171486986 20:25492367-25492389 GGAAATGGTTAAATAAATTATGG + Intronic
1174555204 20:51390238-51390260 AGGGATCTTTAAATAGGTTCAGG + Exonic
1177464932 21:21464715-21464737 AGAGTTGTTTATATAGATTATGG - Intronic
1177907157 21:26985920-26985942 GTAGATATTTTAATAGATGAGGG - Intergenic
1178206687 21:30475583-30475605 GCAGATATTTAACAAGATTATGG + Intergenic
1179282667 21:39947679-39947701 TGAGACCTTTGAATATATTAAGG - Intergenic
1181716029 22:24729671-24729693 GGACATCTTTTATCAGATTAAGG + Intronic
1182053221 22:27329140-27329162 AGAGATTTTTATATAGATCAAGG - Intergenic
1182613776 22:31571850-31571872 GGTGACCTTTAATTAGACTATGG - Intronic
1183137485 22:35903056-35903078 GGAGAACTTTAAAAAAATTAGGG - Intronic
949124612 3:432143-432165 GGAGGTATTTAAATAGATGGTGG - Intergenic
949697293 3:6713837-6713859 GGAGATTTTTAAAGTGATTATGG + Intergenic
950346341 3:12297160-12297182 GGAGATGTTTAAATAAATTATGG + Intronic
951433116 3:22631075-22631097 AGAGATATTAAAATAGATCATGG - Intergenic
952429489 3:33208411-33208433 AGATATCCTTAAATAAATTATGG - Intronic
952819071 3:37470560-37470582 GGAGTTTTTAAAATAGATTTTGG + Intronic
954273682 3:49528716-49528738 GGAGATTCTTAATTAGATGATGG + Intronic
957690728 3:83563280-83563302 AGAGATATTTAAAAAGATAATGG - Intergenic
958272180 3:91515448-91515470 GGAGATGTATTAATAGTTTAGGG - Intergenic
958925497 3:100152527-100152549 GGAGCGCTTTAAATAAATTAAGG - Intronic
962396576 3:135019757-135019779 GGAGATGGTTAAATAAATTATGG - Intronic
964280967 3:155064670-155064692 GGAGCTCATTAAGTAGATTGAGG - Intronic
964535786 3:157719491-157719513 AGACATCTTTTAATAGGTTAAGG - Intergenic
964794247 3:160480502-160480524 GGAGATCCTCAAATAAAGTATGG - Intronic
964863908 3:161232392-161232414 GGAGATCTATAAAAAAATTTGGG - Intronic
965346166 3:167553482-167553504 GGATATCTAAAAATAAATTAAGG + Intronic
965491836 3:169346976-169346998 GGAAACCTTTAAACAAATTATGG + Intronic
965970425 3:174548195-174548217 GGAGAACTTTAAATAAATTTTGG + Intronic
967783061 3:193460347-193460369 GGTTATCTTTAAATAAATTCAGG - Intronic
969093121 4:4711472-4711494 GAAAATCTTTCAATAGGTTAAGG - Intergenic
970201056 4:13606605-13606627 GGACATGCTTAAATAAATTATGG + Intronic
970478996 4:16453788-16453810 GGAGCTATTTAAATATATTCAGG - Intergenic
971259830 4:25046025-25046047 GGAGATCTTGAGATTCATTAGGG - Intergenic
971628336 4:28954185-28954207 GGAGAGTTTTAACTAAATTAAGG + Intergenic
972401786 4:38711438-38711460 GTAGATATTTAAATACATAATGG + Intergenic
972463889 4:39333487-39333509 GGAAATTTTTATATAAATTATGG + Intronic
972955534 4:44385822-44385844 GGAGTTCTTTATATAAATTTTGG - Intronic
973792485 4:54391275-54391297 ATAGATGTTTAAATAAATTATGG - Intergenic
974481751 4:62453076-62453098 GGAAATATTTAAAAAGCTTATGG + Intergenic
975532450 4:75414697-75414719 GGAGATTTTTAAATGGATGTTGG + Intergenic
978497884 4:109379489-109379511 GGAGATATTTAATTTGATGATGG - Intergenic
979803712 4:124944079-124944101 GGAGAATTTTAAATAGAAAATGG + Intergenic
980228939 4:130023186-130023208 GGAAATATTTAAGTAGATAAAGG + Intergenic
982111613 4:152061693-152061715 GGGGCTATTTAAATAAATTATGG + Intergenic
982457690 4:155629567-155629589 TGAGATCTCAAAATAGATTTAGG - Intergenic
982585740 4:157235808-157235830 GGTGATGTTTACATAAATTATGG + Intronic
983559847 4:169089744-169089766 GGAAATGGTTAAATGGATTATGG - Intergenic
984774050 4:183465039-183465061 TTAGATTTTTAAATTGATTATGG - Intergenic
987591307 5:19930776-19930798 GATCATCTTTAAATATATTACGG - Intronic
987716020 5:21572157-21572179 GGAGATCTATACAGAGATTAAGG + Intergenic
987786227 5:22502479-22502501 AGATATGTTTAAATAGTTTAGGG - Intronic
988434469 5:31157637-31157659 AGAGATTTTTGAATAAATTATGG - Intergenic
989261565 5:39424747-39424769 GGAGATCTTTAAAAAAAAAATGG + Intronic
992146472 5:73854886-73854908 CCAATTCTTTAAATAGATTAAGG + Intronic
992384819 5:76274606-76274628 GGAGATAGTTAAATAAACTATGG - Intronic
994466376 5:100138502-100138524 GTAGATCTTTGACTATATTATGG + Intergenic
994607615 5:101989280-101989302 GGAAATCATGAAAGAGATTATGG - Intergenic
994924702 5:106099572-106099594 GGAAAACTTGAACTAGATTATGG - Intergenic
996536436 5:124582687-124582709 GCAGATCTTGAAATACAATATGG + Intergenic
997024517 5:130042365-130042387 GCAAATCTTTAATTAGATCAAGG + Intronic
1000740722 5:164966867-164966889 GGAGATCTTAAGATACATTCCGG - Intergenic
1000861909 5:166465909-166465931 AGAGATCTTTGCATAGATAAGGG + Intergenic
1001302390 5:170543828-170543850 GCAAATCTTTAAACAGATTCAGG - Intronic
1004486514 6:16071458-16071480 GGAGATGTTTAAAGAGATAGAGG + Intergenic
1005152051 6:22762919-22762941 CAGGATCTTTAATTAGATTAGGG - Intergenic
1005455226 6:26013573-26013595 GGAGATTTTAAAATTGATTCTGG - Intergenic
1007634698 6:43292126-43292148 GGAGCTGGTTAAATAGATTATGG - Intergenic
1007888850 6:45265569-45265591 TGATATATTTAAATACATTAAGG + Intronic
1008180337 6:48320387-48320409 GAAGATATTTAAATAGGATAGGG + Intergenic
1008334187 6:50280579-50280601 GGATATTCTTAAATCGATTATGG - Intergenic
1008982929 6:57505681-57505703 GGAGATGTATTAATAGTTTAGGG + Intronic
1009000701 6:57709903-57709925 GGAGATCTATAAAGAGATTAAGG - Intergenic
1009170995 6:60398551-60398573 GGAGATGTATTAATAGTTTAGGG + Intergenic
1009617323 6:66026552-66026574 ATAGATATTTAAATAAATTAGGG - Intergenic
1011127740 6:84024836-84024858 TGAGATAGTTAAATAAATTATGG + Intergenic
1011263230 6:85490004-85490026 GGATATCTGTAAATATACTAAGG - Intronic
1011281719 6:85684870-85684892 GGAGATCTTTGATTGGAATAGGG + Intergenic
1011380608 6:86738631-86738653 GGAGAATTTCAAATAGTTTATGG - Intergenic
1012106050 6:95159790-95159812 GGAGATCATGAAAAAGATTGTGG - Intergenic
1012198374 6:96374053-96374075 GGATATTTTTAAATAGGTAAAGG + Intergenic
1012405998 6:98898697-98898719 GGAGAATGTTAAATAGATTATGG + Intronic
1012432044 6:99174243-99174265 GGAAATTTTTAAATAAATTCTGG + Intergenic
1012912141 6:105130299-105130321 GGGGATGGTTAAATAAATTATGG - Intronic
1013250847 6:108331770-108331792 GGAGAGAATTAAATAGAGTATGG + Intronic
1013437985 6:110132502-110132524 AGACACCTTTTAATAGATTAAGG + Intronic
1014031318 6:116708574-116708596 GGAAATCTTTTAATTAATTAAGG + Intronic
1015963509 6:138674875-138674897 GGGGAACTTTAAATGGATGATGG - Intronic
1016678095 6:146794926-146794948 GGAGACCTTTATGTAGTTTAGGG - Intronic
1016740331 6:147521073-147521095 GGATATGTTTAAATTAATTATGG - Intronic
1018695143 6:166384732-166384754 GGAGAGAGTTAAATAAATTATGG + Intergenic
1019302796 7:316839-316861 GGAGACGTTTAAAGAGATAATGG + Intergenic
1020400962 7:7777149-7777171 GGAGATCAGTAAATAAAGTATGG - Intronic
1021100099 7:16578140-16578162 GGAGAATGTTAAATAGACTATGG + Intronic
1021970430 7:25960470-25960492 TGAGATTTTTAGAGAGATTAAGG - Intergenic
1022062756 7:26816035-26816057 GGAGAATTATAAATAGATAATGG + Intronic
1022435267 7:30377396-30377418 GCATCTCTTTAAATATATTAAGG + Intronic
1022770501 7:33467086-33467108 GTTGATCTTTAAAGAGAATATGG + Intronic
1026455790 7:70571564-70571586 GGAGATGTTTAAACAGACTTTGG + Intronic
1027882383 7:83857046-83857068 GGAGCTCCTGAAATACATTAAGG - Intergenic
1028509352 7:91606096-91606118 AGGGATCTTTAAAAAGTTTATGG - Intergenic
1028955433 7:96684295-96684317 GGACAGCTTTAAATAAATTTGGG - Intronic
1029173817 7:98649565-98649587 GGATATCTTTAATTAGTTTGGGG - Intergenic
1029311681 7:99672928-99672950 AGAGCTCTTTAAAGAGATTATGG + Intronic
1030961164 7:115925001-115925023 GGATACCTTTTAATAGGTTAAGG - Intergenic
1031983219 7:128143700-128143722 GGGGAGCTTTAAAGAGATAATGG - Intergenic
1034741048 7:153473673-153473695 GGAGAAATGTAAATAAATTATGG - Intergenic
1037766160 8:21773572-21773594 GGAGATCTTACAATGGTTTATGG + Intronic
1039025909 8:33257637-33257659 GAAGATCATAAAATAAATTATGG + Intergenic
1040684428 8:49854961-49854983 GGAGATTTTTCAATAGAAAATGG - Intergenic
1042523437 8:69739003-69739025 GGAAATGTTTAAATAAATGATGG + Intronic
1042621254 8:70707567-70707589 GGAGTTTGTTAAATAAATTATGG - Intronic
1043788165 8:84428537-84428559 AGAAATCTTTAATTAGATTGAGG - Intronic
1044189874 8:89302548-89302570 ACAGATTTTAAAATAGATTATGG - Intergenic
1045630948 8:104121330-104121352 GAGGATTTTTAAATACATTAAGG + Intronic
1046270393 8:111889104-111889126 GGAAATCATAAAAGAGATTATGG - Intergenic
1048183608 8:132218512-132218534 GGAGATTTATAAAGAGAATAAGG + Intronic
1051059908 9:13033754-13033776 CCAGATTTTTAAATAGATTATGG + Intergenic
1052147285 9:25065569-25065591 GGAAATCTGTAAATAAATTCGGG + Intergenic
1052230795 9:26150051-26150073 GCAAATGTTGAAATAGATTATGG - Intergenic
1053482532 9:38426225-38426247 GGCAATCGTTAAATAAATTATGG + Intergenic
1055946638 9:81697563-81697585 GTAAATCTTTAAATACATTAGGG + Intergenic
1057943815 9:99307373-99307395 GGAAATATTTAAATAAAATATGG + Intergenic
1059837965 9:118178397-118178419 GTAGATCCTAAAATACATTAAGG - Intergenic
1060985114 9:127815325-127815347 GGAGAACTTGAAACAGATTCAGG - Exonic
1188336126 X:28935532-28935554 AGAGAACTTTAAATGGTTTATGG + Intronic
1188772462 X:34169654-34169676 GAACATCTTTAAAAATATTATGG - Intergenic
1189315756 X:40055160-40055182 GGAAATCTTTTAAAACATTAGGG + Intronic
1189857941 X:45242022-45242044 GGAGTTCTTTATATATATTCTGG + Intergenic
1190462315 X:50690222-50690244 TGAGATTTTCAAATATATTAAGG + Intronic
1193778490 X:85673692-85673714 AGGAATCTTTAAATAGACTATGG - Intergenic
1194280087 X:91940270-91940292 GAAGATCTTTAATTGGCTTACGG - Intronic
1194492845 X:94572184-94572206 GGAGATTGTGACATAGATTAGGG - Intergenic
1194629060 X:96261093-96261115 GGAGATTTTCAAATGCATTAAGG + Intergenic
1194683324 X:96881124-96881146 TGATATCTTTCAATAGATTTGGG + Intronic
1195755572 X:108195725-108195747 GGAGATCTTTAAATAGATTATGG + Intronic
1198247546 X:134844881-134844903 GTAGACCTTTAAAAAGTTTAGGG + Intronic
1199010497 X:142752920-142752942 GGGGATGATTAAATAAATTATGG - Intergenic