ID: 1195757458

View in Genome Browser
Species Human (GRCh38)
Location X:108213464-108213486
Sequence CTTATCAATACCATAACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195757458 Original CRISPR CTTATCAATACCATAACCAA GGG Intronic
909635750 1:77815214-77815236 CTTACCAATATCATCAGCAAGGG - Exonic
913421230 1:118671936-118671958 CTTAGCATTACCATAACCATGGG + Intergenic
915865144 1:159491521-159491543 CTTAAAAATACCTTAACGAAGGG - Intergenic
917169588 1:172156254-172156276 GTTATCTATACCATAAACACTGG - Intronic
919538384 1:198816814-198816836 CTTATCACTAACATAATCATAGG - Intergenic
920949828 1:210562369-210562391 CTTTTCAATCCAATCACCAAGGG + Intronic
921429319 1:215045297-215045319 CTTATCAATAGAATAACCGTTGG + Intronic
922149850 1:222990456-222990478 TTTATCAATACAATATCTAATGG - Intronic
924096301 1:240554815-240554837 CTTAACATTAGCATAACTAATGG - Intronic
1063843826 10:10102894-10102916 CTTATCAATAACATAGGCCATGG + Intergenic
1063882977 10:10550107-10550129 CTTACCAATAACATAAACAGTGG + Intergenic
1069848503 10:71390067-71390089 AAGATCAATACCATAACCACAGG - Intergenic
1071168851 10:82839490-82839512 CTCTACAATACCATCACCAAGGG + Intronic
1078112682 11:8411248-8411270 CCTCAGAATACCATAACCAATGG + Intronic
1078991538 11:16652105-16652127 ATTATCAATGACATAAACAATGG + Intronic
1081438955 11:43059168-43059190 TTTATCAATACCCTAACTAACGG - Intergenic
1086075954 11:82852500-82852522 CTTAGCATTATCTTAACCAAGGG - Intronic
1087450277 11:98312232-98312254 ATTATCACTGCCATCACCAAGGG - Intergenic
1087505471 11:99015072-99015094 CTTATCACTACCATAAGTGATGG + Intergenic
1087584455 11:100100607-100100629 CTAATCAATCACATAAACAAAGG - Intronic
1089448077 11:118569541-118569563 CGTATCAATTCCATCTCCAATGG - Intronic
1093490497 12:19699590-19699612 CATATTAATACCATGTCCAAGGG + Intronic
1093806236 12:23436345-23436367 CTCATTAATACTATAACCAAAGG + Intergenic
1095595675 12:43955174-43955196 CATATCAATAACATACCGAATGG + Intronic
1097710307 12:62910399-62910421 CTTTTCAGTAACATAACCAGGGG + Intronic
1103335699 12:120187965-120187987 CTGATCTGCACCATAACCAAGGG - Intronic
1105946566 13:25195551-25195573 CTCACTAATGCCATAACCAAAGG - Intergenic
1109070699 13:57763367-57763389 CTTCTCAGGACCATAGCCAAAGG + Intergenic
1112772101 13:102803006-102803028 CTTATCAAAAACATAGGCAAAGG - Intronic
1112800963 13:103109338-103109360 CATATCATTTCCATAAACAATGG - Intergenic
1114367196 14:22041778-22041800 CTTATCAATACCAAAACCGCTGG - Intergenic
1114920233 14:27317100-27317122 CTTAGCAATTCCATGGCCAATGG + Intergenic
1117885128 14:60353290-60353312 CTTAACAATAACATTATCAAGGG + Intergenic
1118599630 14:67462870-67462892 CCCACCAATACCATAGCCAATGG + Intronic
1118652406 14:67911165-67911187 CTGCTCAATAACATCACCAAGGG - Intronic
1120420992 14:84285769-84285791 CTTATCATTGCCATAAACATGGG - Intergenic
1120449377 14:84647230-84647252 GTTATCAAGACCATGACTAATGG - Intergenic
1121689867 14:95869989-95870011 CTTATGAATAGCATCAGCAAAGG - Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1124162150 15:27282150-27282172 CTTCTGAAAACCAAAACCAAGGG - Intronic
1126338885 15:47617923-47617945 CTTATCAGGACCATACCAAATGG - Intronic
1129087680 15:73113309-73113331 CTTATTAATACTTTAACCATTGG + Intronic
1130723175 15:86410043-86410065 CTTATCTATATTATACCCAAGGG - Intronic
1143813295 17:9490003-9490025 CTTATCAATACTATCACTTAAGG + Intronic
1147839903 17:43363850-43363872 CTTATCAGTGACAAAACCAAGGG + Intergenic
1155779049 18:29807942-29807964 CTGATCAATAATATTACCAATGG - Intergenic
1161613267 19:5255781-5255803 CTTAGCAACAACATTACCAACGG + Intronic
1162224273 19:9206638-9206660 CTTATCAACAATATAACTAATGG - Intergenic
1164020356 19:21297510-21297532 CATATTAATACAAAAACCAAAGG + Intronic
1167806686 19:51791576-51791598 CCTTTTAATACCATAACCTAGGG + Intronic
928452957 2:31395148-31395170 CTTACCAATACATTAACTAAAGG - Intronic
930705908 2:54504677-54504699 CTTATGAATACCAAAATCCATGG - Intronic
931149757 2:59560034-59560056 CTTCCCATTACCATAAACAATGG + Intergenic
931172761 2:59822083-59822105 CTTATAAAGACCATAGGCAATGG + Intergenic
932390756 2:71388978-71389000 TTAAACAATACCATAAACAAGGG + Intronic
935925785 2:108066947-108066969 CTTATCAATTTCAGAACTAAGGG - Intergenic
938721250 2:134069071-134069093 CTTAACAATCCCATTACCAAAGG - Intergenic
938871202 2:135478641-135478663 TTTATCACTACCATAACAACCGG - Intronic
944286103 2:197951474-197951496 CTTATAAATTCCACAGCCAAAGG - Intronic
947168349 2:227285841-227285863 CTTTTCAAATGCATAACCAAGGG + Intronic
1172072529 20:32268899-32268921 TTTCTCAATACCATCAGCAATGG + Intergenic
1173798826 20:45881777-45881799 CTTATACATACCAGGACCAAAGG + Intronic
1179937685 21:44615527-44615549 GTCATTAATTCCATAACCAAAGG + Intronic
1182471656 22:30552437-30552459 CTTCTCTATAACAAAACCAAAGG + Intergenic
1182493114 22:30687154-30687176 CTCATCAACACTATAACAAAAGG + Intergenic
1183613857 22:38929839-38929861 TTTGTAAATACAATAACCAAAGG - Intergenic
953864189 3:46569962-46569984 CTGGTCAATGCCATAACCACAGG + Intronic
955874460 3:63475343-63475365 ATAATCAATATCATAACCACTGG - Intronic
957258296 3:77867216-77867238 CTGATAGACACCATAACCAATGG + Intergenic
957598022 3:82292718-82292740 CTCATGAATACTATAACCTAGGG - Intergenic
957727419 3:84086081-84086103 CATAATAATAGCATAACCAATGG + Intergenic
958456490 3:94338136-94338158 CTTACTAATACCATCACCTATGG - Intergenic
959143235 3:102511929-102511951 TTTATAAATACCATCACCTAGGG - Intergenic
959446869 3:106451191-106451213 CTTATAAATTACATAAACAAAGG - Intergenic
960009368 3:112816720-112816742 ATAATCAATTCCATAATCAATGG + Intronic
962431050 3:135320226-135320248 CTTCTCAATACCTTAATTAAGGG + Intergenic
964771681 3:160230290-160230312 GTGTTCAATATCATAACCAAGGG + Intronic
966600862 3:181773798-181773820 CTCACCAATACCAGCACCAAGGG + Intergenic
971540297 4:27808028-27808050 ATTATTAATACAATAATCAAAGG - Intergenic
971716012 4:30178304-30178326 CTTGTCAATACCACAAACACTGG - Intergenic
974737834 4:65961722-65961744 CTTATCAGGACCATAACCTCAGG + Intergenic
975567814 4:75778230-75778252 CTTACCAATAACATAAGCAGTGG + Intronic
978572432 4:110153044-110153066 ATTTTCAAAACCATACCCAAAGG - Intronic
979229549 4:118331653-118331675 CTTATTATTTCCATACCCAAAGG - Intronic
979495217 4:121375615-121375637 CTAATCAATATCATAAGCCATGG - Intronic
986078646 5:4365620-4365642 CTTCTCCATACCTTTACCAAGGG - Intergenic
986115413 5:4768928-4768950 CTTTTCAATCTCATATCCAATGG + Intergenic
986689339 5:10301468-10301490 ATCATCAACACCATGACCAAAGG + Intronic
990254274 5:53949179-53949201 CTCCACAATACCATATCCAATGG - Intronic
991294692 5:65068192-65068214 CTTATAATTAGCATAACCTATGG + Intergenic
994505246 5:100635424-100635446 CTTAGAAATTCCATAACTAATGG - Intergenic
996256099 5:121404405-121404427 CTTATGAATACCATAACTTTGGG - Intergenic
998070481 5:139194047-139194069 CTTCTCAATACCAAAGCCAAGGG + Intronic
998778631 5:145631350-145631372 CTCAGAAATACCATAACTAAAGG + Intronic
1000723671 5:164740657-164740679 CTTTTCAATACCATAAACATTGG - Intergenic
1001146465 5:169188800-169188822 CTTATCAGTAACATAGACAATGG - Intronic
1008464681 6:51817366-51817388 ATTATCAATACCTCAACCTATGG + Intronic
1012642777 6:101640877-101640899 CTTATCAATATGATAAACAAAGG + Intronic
1012816451 6:104028145-104028167 CTTTTCAATCCCATATCCTAAGG + Intergenic
1016277850 6:142375645-142375667 CTAATCAGTACAGTAACCAATGG + Intronic
1021593406 7:22289682-22289704 CATATCAATATGATAATCAATGG - Intronic
1022884413 7:34627852-34627874 ATTATCAATACCTTGACCAAAGG + Intergenic
1028116475 7:87003107-87003129 GTTATCAATCCCATAAAGAAGGG - Intronic
1029314949 7:99703357-99703379 CTTATGAATACCATATTCCATGG - Intronic
1040770908 8:50973752-50973774 CTTAACATTATTATAACCAAGGG + Intergenic
1040947373 8:52897558-52897580 CATATCTACACCATAACAAAAGG + Intergenic
1041180015 8:55237324-55237346 CTTACCAATAACATAAACAGTGG + Intronic
1041921031 8:63181239-63181261 CTAATGAATACCTTAACTAAGGG - Intronic
1043234190 8:77840877-77840899 TTACTCAATACCATAACCAGAGG - Intergenic
1043304166 8:78773364-78773386 CTCATCAATGTCATAACGAACGG + Intronic
1043463132 8:80480527-80480549 CTTCTTAATACCATTACCATGGG + Intergenic
1043729020 8:83651150-83651172 CTTTTTAATAACTTAACCAACGG - Intergenic
1044924455 8:97198337-97198359 TTTAACAATACCATAAACAAAGG - Intergenic
1045785256 8:105913442-105913464 CATATCATTACAATAACCCATGG - Intergenic
1048150185 8:131886258-131886280 CTTCCCAATACCATAACCTTGGG + Intergenic
1057849033 9:98550203-98550225 CTTATCCATACGATTACTAACGG - Intronic
1058627813 9:106953508-106953530 CATAGCAAGACCAAAACCAAGGG - Intronic
1188688386 X:33098471-33098493 CTTAGCATAACCATAACCTAGGG + Intronic
1188935012 X:36164701-36164723 GATATCATTACCATAATCAAAGG + Intergenic
1194840489 X:98734912-98734934 TTCAACAATACCATGACCAAAGG - Intergenic
1195757458 X:108213464-108213486 CTTATCAATACCATAACCAAGGG + Intronic
1197258104 X:124286202-124286224 CTGATCTATTCCATAACCCAGGG + Intronic
1199448803 X:147956837-147956859 CTTATCATCATTATAACCAATGG - Intergenic