ID: 1195758349

View in Genome Browser
Species Human (GRCh38)
Location X:108221104-108221126
Sequence AAAAATGCAGAAATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5157
Summary {0: 1, 1: 0, 2: 11, 3: 218, 4: 4927}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195758344_1195758349 25 Left 1195758344 X:108221056-108221078 CCATTGTACTCCAGCCTGGGCAA 0: 2312
1: 45463
2: 120001
3: 189875
4: 216689
Right 1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG 0: 1
1: 0
2: 11
3: 218
4: 4927
1195758348_1195758349 11 Left 1195758348 X:108221070-108221092 CCTGGGCAACAGGGCGAGACTCT 0: 138
1: 5535
2: 38930
3: 117765
4: 195373
Right 1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG 0: 1
1: 0
2: 11
3: 218
4: 4927
1195758347_1195758349 15 Left 1195758347 X:108221066-108221088 CCAGCCTGGGCAACAGGGCGAGA 0: 465
1: 16916
2: 101838
3: 213390
4: 376852
Right 1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG 0: 1
1: 0
2: 11
3: 218
4: 4927

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195758349 Original CRISPR AAAAATGCAGAAATGCAGCC TGG Intronic
Too many off-targets to display for this crispr