ID: 1195764682

View in Genome Browser
Species Human (GRCh38)
Location X:108283572-108283594
Sequence CCCCCCAAAAAAAAAACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 540}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195764682_1195764694 -1 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764694 X:108283594-108283616 GGGGTTGGCGGCGGGGATGCGGG 0: 1
1: 1
2: 7
3: 56
4: 622
1195764682_1195764695 0 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764695 X:108283595-108283617 GGGTTGGCGGCGGGGATGCGGGG 0: 1
1: 0
2: 4
3: 34
4: 459
1195764682_1195764693 -2 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764693 X:108283593-108283615 GGGGGTTGGCGGCGGGGATGCGG 0: 1
1: 1
2: 10
3: 115
4: 1253
1195764682_1195764696 5 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764696 X:108283600-108283622 GGCGGCGGGGATGCGGGGAGTGG 0: 1
1: 1
2: 6
3: 137
4: 1339
1195764682_1195764690 -10 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764690 X:108283585-108283607 TTTTGGGGGGGGGTTGGCGGCGG 0: 1
1: 3
2: 28
3: 211
4: 1261
1195764682_1195764691 -9 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764691 X:108283586-108283608 TTTGGGGGGGGGTTGGCGGCGGG 0: 1
1: 0
2: 5
3: 85
4: 734
1195764682_1195764692 -8 Left 1195764682 X:108283572-108283594 CCCTAAGTTTTTTTTTTGGGGGG 0: 1
1: 0
2: 7
3: 78
4: 540
Right 1195764692 X:108283587-108283609 TTGGGGGGGGGTTGGCGGCGGGG 0: 1
1: 0
2: 2
3: 75
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195764682 Original CRISPR CCCCCCAAAAAAAAAACTTA GGG (reversed) Intronic
901314672 1:8298318-8298340 GTCCCCAGAATAAAAACTTATGG + Intergenic
902822733 1:18953342-18953364 CTCCCCAAAGAAAATTCTTAGGG + Intronic
903578969 1:24357052-24357074 CCCCCCAAAAAAAAAATCCATGG + Exonic
904555652 1:31361755-31361777 CTCCCCAAAAAAAACACCTATGG - Intronic
904766904 1:32856665-32856687 CCACCCACAAAAAAAAATCAAGG - Exonic
905151777 1:35933768-35933790 CCACAAAAAAGAAAAACTTATGG - Intronic
905993987 1:42365132-42365154 CCCCCCAAAAAAGCAACTGATGG + Intergenic
906220148 1:44071976-44071998 CCCCCCCAAAAAAAAACAGTAGG - Intergenic
906852294 1:49264544-49264566 CTCAAAAAAAAAAAAACTTATGG - Intronic
907226410 1:52951289-52951311 CCCCCCAAAAAACAAAAAAAAGG + Intronic
907417947 1:54327299-54327321 CCCCCCAAAAAAACAGGTAAGGG + Intronic
908384156 1:63624994-63625016 CTCCTCAAAGAAAAAATTTATGG - Intronic
909553051 1:76920850-76920872 GCCCCCAAACAGAAAACATATGG + Intronic
910204693 1:84737421-84737443 CTCCTTAAAAAAAAAACCTAGGG + Intergenic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
910933713 1:92467994-92468016 CCAACCAAACAAAAAACTAAAGG + Intergenic
910985532 1:93001674-93001696 CCCCTTTAAAAAAAAATTTAAGG - Intergenic
911450515 1:98054588-98054610 CCCCCCTGAAAAAGAAATTATGG + Intergenic
912395653 1:109341346-109341368 TCTCAAAAAAAAAAAACTTAGGG - Intronic
912654630 1:111475012-111475034 CCTCCTAAAAAAAAAAATCAGGG + Intronic
913977575 1:143475139-143475161 CCCCCCACAAAGAAAATTTCAGG + Intergenic
914071979 1:144300769-144300791 CCCCCCACAAAGAAAATTTCAGG + Intergenic
914107176 1:144665587-144665609 CCCCCCACAAAGAAAATTTCAGG - Intergenic
914561106 1:148820700-148820722 CCCCCCCCAAAAAAAAAGTAGGG - Intronic
915182436 1:154074011-154074033 CGACAAAAAAAAAAAACTTAGGG - Intronic
915464283 1:156087242-156087264 CCCCCCACAAAAAAAAAAAAAGG - Intronic
916996467 1:170307086-170307108 CCCCCCCCAAAAAAAACACACGG + Intergenic
917104775 1:171481320-171481342 CCCCGCAAAAAAAAAACCTTTGG - Intergenic
917343527 1:174004896-174004918 CCCCTCTAAAAAAAAGCTTTTGG - Intronic
917408266 1:174732196-174732218 CCCCCCAAAAAAAAAAAACATGG + Intronic
917982315 1:180277863-180277885 CCCCCCCCAAAAAAAGTTTAAGG - Exonic
918908688 1:190534791-190534813 CCCCCCACAAGAAATACTAAAGG + Intergenic
919212631 1:194508457-194508479 CACCCCAAAAAATATATTTATGG + Intergenic
919520248 1:198579844-198579866 TCCCCAAAAAAGAAAACTTTAGG - Intergenic
919686663 1:200489296-200489318 CCCCCCACAAAAAAAAGAAAAGG - Intergenic
919900943 1:202043901-202043923 CCCCCCACAAAAAAAGGTTATGG + Intergenic
920989367 1:210922078-210922100 CCCTTTAAAAAAAAAACTGACGG + Intronic
921068235 1:211638042-211638064 CCTCTAAAAAAAAAAAATTAAGG - Intergenic
922444381 1:225684203-225684225 CTCCCCAAAGATAAAGCTTAGGG - Intergenic
922554052 1:226519613-226519635 CACCCCAAAAGGAGAACTTAGGG - Intergenic
923940035 1:238811929-238811951 CCCGTAAAAAAAAAAATTTAAGG + Intergenic
924698550 1:246426365-246426387 CACCCCAAAAAGAAACCTTTAGG + Intronic
1063522672 10:6755060-6755082 CCCAGTAAAAAAAAAATTTAGGG - Intergenic
1063678984 10:8168476-8168498 CCCTACAAAAAAAAATCTAAAGG - Intergenic
1064233294 10:13549002-13549024 CCCCCTAAAAAAAAACCTAAGGG - Intergenic
1064233296 10:13549003-13549025 CCCCCCTAAAAAAAAACCTAAGG - Intergenic
1064388100 10:14916677-14916699 CCCCCAAAATGAAATACTTAGGG + Intronic
1064477957 10:15711768-15711790 CCCCCCAAAAAAAGAAAGAAAGG + Intronic
1064478142 10:15713748-15713770 CCCCCCAAAACAAAGGCTTCCGG + Intronic
1065102759 10:22346792-22346814 CCCCCCAATAAAAACACACAAGG - Intronic
1065555475 10:26911299-26911321 CCCCCCAAAAAAACTACCTGAGG + Intergenic
1065565998 10:27010321-27010343 CTCCCCAAAAAAATCAATTAAGG + Intronic
1065653344 10:27917795-27917817 CCTCCCAAAAAAGAGACTGATGG + Intronic
1066241119 10:33535972-33535994 CCCCCCCAAAAAAATAATAAAGG + Intergenic
1066241121 10:33535973-33535995 CCCCCCAAAAAAATAATAAAGGG + Intergenic
1066426428 10:35311683-35311705 CCCCCCCAAAAAAAAGTTTTTGG + Intronic
1067446583 10:46352713-46352735 CCCCCCAAAAAAAAATTATCTGG + Intergenic
1067835477 10:49636646-49636668 CTCCCCAAAAAGAAATCTTCAGG - Intronic
1068609832 10:59046823-59046845 CCCGCAAAAAAAAAATCTCATGG - Intergenic
1068638453 10:59374420-59374442 CCTCCCATAAAAATAACTTGTGG - Intergenic
1068796394 10:61085686-61085708 CACAACAAAAACAAAACTTAAGG - Intergenic
1068934542 10:62622846-62622868 CCCCCCAAAAAAAGGATTTGAGG - Intronic
1070027866 10:72649446-72649468 CCCGCCAAAAAAAAAAGTTGTGG - Intergenic
1070146089 10:73774300-73774322 CCGCTTAAAAAAAAAAATTATGG - Intronic
1070620666 10:78007993-78008015 CCCCCCAAAAAAAAGCTTTGAGG - Intronic
1070935551 10:80291982-80292004 CCCCCCAATAAAAAAACATAAGG - Intergenic
1071684206 10:87737367-87737389 TCCTCTAAAAAAAAAAATTAAGG + Intronic
1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG + Intergenic
1072517601 10:96201158-96201180 TCCACCAAAAAAAATCCTTAAGG + Intronic
1072866207 10:99064727-99064749 CAACCAAAAAAAAAAAATTAAGG + Intronic
1072955575 10:99885214-99885236 CCCCCCACAAAAAAAGCCTGGGG + Intronic
1073031976 10:100533829-100533851 CCCCCCAAAAAAAGCATATAAGG - Intronic
1073347438 10:102794484-102794506 CCCCCACAAAAGAAAATTTAAGG + Intronic
1073487800 10:103831772-103831794 CACCCCAAAAAGAAACCTCATGG + Intronic
1073730048 10:106277210-106277232 GCACACAAAAAAAGAACTTATGG - Intergenic
1073860835 10:107737215-107737237 CTCCCCAAAAAGAAAAATTTAGG + Intergenic
1074653505 10:115554791-115554813 CCCCTAAACAAAAAAACTTTGGG + Intronic
1077213616 11:1384901-1384923 CCCAAGAAAAAGAAAACTTACGG - Intergenic
1077931276 11:6735530-6735552 CCCCCCAAAAAAAATCCTACTGG - Intergenic
1078130607 11:8611205-8611227 CCCCCCAAAAAAAAAAAAAATGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079093745 11:17497879-17497901 TCACCCAAGAAAAAGACTTAAGG - Intronic
1079274514 11:19022052-19022074 ACCGCCAAGAAAAAAACTCAAGG - Intergenic
1080487076 11:32719916-32719938 CCTCCCAAAAAGAAATCTTCAGG + Intronic
1080651560 11:34226757-34226779 CACCCCAAAAAGAAAACGTTTGG + Intronic
1080829844 11:35881815-35881837 TCCCCAAAATAAAATACTTAGGG - Intergenic
1081512678 11:43791581-43791603 CCCCTCAAAAAACAAAATTCAGG + Intronic
1081553328 11:44134268-44134290 CCCCCCACCAAAAAACATTAGGG - Intronic
1081832229 11:46122750-46122772 CCCTCCAAAAAAAAAAAAAAAGG - Intergenic
1083240974 11:61388324-61388346 CCCCACCAAAAAAAAAATTTAGG + Intergenic
1084203195 11:67576062-67576084 CCCCCAAAAAAAAAAAAAAAAGG + Intergenic
1085221045 11:74873935-74873957 CACCTCATAAAAAAAACTCAAGG + Intronic
1085782366 11:79421255-79421277 CCCCCCTCAAAAAAAAGGTAGGG + Intronic
1086251912 11:84825985-84826007 CCCCCAAAAATAAACACTGAGGG - Intronic
1086744922 11:90412920-90412942 CCCGCCAAAAAAAATCCTTCAGG - Intergenic
1087564093 11:99831608-99831630 TGCACCAAAAAAAAAAGTTATGG - Intronic
1088246419 11:107822228-107822250 CGTCTCAAAAAAAAAATTTAAGG + Intronic
1088458910 11:110062160-110062182 CCACCCAAAAAAAAGAGTTAAGG + Intergenic
1088610894 11:111575612-111575634 CCCCCCAAAAATAAGACACAGGG - Intergenic
1088697996 11:112385268-112385290 CCACCAAAAAAAAAAACTTTAGG - Intergenic
1089562779 11:119353358-119353380 CCCCTCAAAATAAAAACATGAGG - Intergenic
1090158119 11:124463344-124463366 ACCCCCAAAAAACAAAATGAAGG + Intergenic
1091571739 12:1692232-1692254 CCCCCCAAAAAATAATGCTATGG - Intronic
1092003250 12:5048306-5048328 CCCCCCAAAAAAAAAATTACAGG - Intergenic
1092073120 12:5649597-5649619 CCCCCAAAAAAATACCCTTAAGG - Intronic
1092442843 12:8524148-8524170 ACAACCAAAAAAAAAACTTCAGG - Intergenic
1092467373 12:8745395-8745417 CATCTCAAAAAAAAAATTTACGG - Intronic
1093173872 12:15889130-15889152 CCCCCAAATAAAAAAGCTTAAGG - Intronic
1093403159 12:18771944-18771966 CCCCCCAAAAAAAAAGCTAGAGG - Intergenic
1094277958 12:28700131-28700153 CCCACCAAAAAAAAAAATCAAGG + Intergenic
1096012932 12:48237093-48237115 CTCCCCAAAGATAAAGCTTAAGG + Intergenic
1096059011 12:48680977-48680999 CCCGCCAAAAAATTAACTTTAGG + Intronic
1096339985 12:50789761-50789783 CCCACCAAAAAAAAAAGATTGGG + Intronic
1096357176 12:50950982-50951004 TCACCTTAAAAAAAAACTTATGG - Intergenic
1096601238 12:52731229-52731251 CCCCCTCAAAAACAAACTTTCGG - Intergenic
1097205575 12:57317982-57318004 CCCCCCCAAAAAAAAAAAAAAGG + Intronic
1097815759 12:64071874-64071896 CCCCCCAAAAAAAAAAGTCGTGG + Intronic
1098034762 12:66290338-66290360 TCTCTCAAAATAAAAACTTATGG + Intergenic
1098481470 12:70966886-70966908 ACCCTCAAAAAAGAAACTGAGGG + Intergenic
1099092965 12:78337218-78337240 CCCCCCAAAAATTGAACTAATGG + Intergenic
1099170006 12:79352191-79352213 CCCCCCAAAAAAAAAACGGGGGG + Intronic
1099431676 12:82593581-82593603 CCCAACAAAGAAAAAAATTATGG - Intergenic
1099860171 12:88216643-88216665 CCCACCAAAAAAAAAGCCCAGGG + Intergenic
1099991361 12:89725201-89725223 CAACACAAAAAGAAAACTTAAGG + Intergenic
1100736351 12:97538146-97538168 CCCCCCAAAAATAATAATAAAGG + Intergenic
1101248665 12:102910371-102910393 CTCCCCAAAAAAAAAAAAAAAGG - Intronic
1101957144 12:109221878-109221900 CCCCCCAAAAAAAAAAAAAAAGG - Intronic
1101970252 12:109307864-109307886 CCTGCCAAAAAAAAACCTTCTGG - Intronic
1102326279 12:111987504-111987526 CCCCTCAAAAAAAAAAAAAAAGG + Intronic
1102332968 12:112051210-112051232 CCCACCAAAAAAGAAAAATATGG - Intronic
1102461151 12:113100292-113100314 CCCCCAAAAAAAGAAGCTAAGGG - Intronic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1102719186 12:115001837-115001859 CCCCACAAAACAAACACTTCCGG - Intergenic
1104261152 12:127183357-127183379 CCCCCCAAAAAAAAAAGAGATGG - Intergenic
1105221758 13:18336259-18336281 CCCCCCACAAAGAAAATTTCAGG - Intergenic
1105655369 13:22431545-22431567 CTCTGCAAGAAAAAAACTTAGGG + Intergenic
1105770281 13:23604263-23604285 CCCCCAAAATAAAATACCTAGGG + Intronic
1107258785 13:38465040-38465062 CTCCCCAAAAGAAAATCTTCTGG - Intergenic
1107321135 13:39189850-39189872 CCCACCTAAAAAAAATCTAAGGG + Intergenic
1107703462 13:43073922-43073944 CTCCCCCAGAAAAAAATTTAAGG - Intronic
1107742976 13:43473338-43473360 CCCCCAAAAAAGAAAAGTTAAGG - Intronic
1108349093 13:49574108-49574130 ACCCCCAAAAAAAGAAATTTGGG - Intronic
1108560520 13:51638974-51638996 CCCCACAAAAACAAAAATAAGGG + Intronic
1109830505 13:67781025-67781047 CTCCCCAAAAGAAAAACCTGAGG - Intergenic
1109879006 13:68446611-68446633 CCCCCCCAAAAAAAAACAACTGG + Intergenic
1111135540 13:84037528-84037550 CACACCAACAAAAAAGCTTAAGG + Intergenic
1111495005 13:89036048-89036070 CCCCCCAACAAAAATAATCAAGG - Intergenic
1112032196 13:95467513-95467535 CCCCCCAAAAAAAACAATAGAGG - Intronic
1112092372 13:96094880-96094902 CCTGCCAAAAAAATAACTGAGGG - Intronic
1112120047 13:96399961-96399983 TCCCCTGAAAAAAAAACTTTGGG - Intronic
1112278851 13:98045149-98045171 CCCCCCAAAAAAGAATATTGAGG + Intergenic
1112297083 13:98197636-98197658 CATCTCAAAAAAAAAAATTAAGG - Intronic
1113049501 13:106193921-106193943 CCATCCAAAAAAAAAAATGAAGG + Intergenic
1113352740 13:109545252-109545274 CCCTCCAAAAAAAAAAAAAAAGG + Intergenic
1115729809 14:36256388-36256410 CCCCCAAAAAAAAAAAAATCCGG - Intergenic
1116248391 14:42449746-42449768 CCCCACATAAAAAGAACTTTAGG + Intergenic
1116690049 14:48094165-48094187 CCTCCCAAAAAGAAAAATCATGG - Intergenic
1117119843 14:52554564-52554586 CCCACCAAAAGAAAAGCTTGAGG + Intronic
1117492066 14:56258298-56258320 CCCCCGCAAAAAAAAATTAATGG + Intronic
1118175357 14:63434470-63434492 CTCCCCAAAAAGAAAAATAAAGG + Intronic
1118225915 14:63899201-63899223 TCTCAAAAAAAAAAAACTTAAGG - Intronic
1118587758 14:67371419-67371441 CACCAAAAAAAAAAAAGTTAAGG + Intronic
1119333544 14:73813696-73813718 CCCCCCCAAAAAAAAAGTTCAGG + Intergenic
1119333546 14:73813697-73813719 CCCCCCAAAAAAAAAGTTCAGGG + Intergenic
1119500790 14:75126061-75126083 CCCCCCAAATTAAGAACTAATGG + Intronic
1120934359 14:89879519-89879541 CCCCTCCAAAAAAAAAATCAAGG + Intronic
1121078844 14:91091218-91091240 CCCCCCTCAAAAAAAAATTCCGG + Intronic
1121177021 14:91898194-91898216 CCCCCGCCAAAAAAAACTTCAGG - Intronic
1122980528 14:105190411-105190433 CCCACCAAAAAAAAAAAAGATGG + Intergenic
1202832981 14_GL000009v2_random:57357-57379 CGTCCCAAAAAAAAAACCCAGGG + Intergenic
1124056333 15:26243927-26243949 CCCCGCAAAAAAAAATCAAAAGG - Intergenic
1124456990 15:29852607-29852629 CCCAGCAAAATAAAAACTTAGGG + Intronic
1125983462 15:44025966-44025988 CCCACCAAAAAAAGGAATTAAGG - Intronic
1126148579 15:45501302-45501324 CATCTCAAAAAAAAAAATTATGG + Intronic
1127023260 15:54775150-54775172 TCCCCCAAAGAAAAAATATATGG + Intergenic
1127080611 15:55374961-55374983 GGCCCCAAAACAAAAACTTTTGG + Intronic
1127195429 15:56579861-56579883 CCCCCCGAAAAAAAAAAGAAAGG + Intergenic
1127455308 15:59151445-59151467 CCCCCCAAAAAAACCAACTAAGG + Intronic
1128000540 15:64187187-64187209 CCCCCCAAAAAAAACCATGATGG - Intronic
1128277534 15:66366148-66366170 CCTCCCAAAAAAAAAAACTGGGG + Intronic
1128277535 15:66366149-66366171 CTCCCAAAAAAAAAAACTGGGGG + Intronic
1128496028 15:68199163-68199185 CCCCTCAAAAAAAAAAGGTTAGG + Intronic
1128634828 15:69296498-69296520 CTCCACAAAAAAGAAACTGAGGG + Intergenic
1128860378 15:71065586-71065608 CCCCCCAAAATAAAAATATCTGG + Intergenic
1129943346 15:79517895-79517917 CCCCCAAAAAAAAAACCATCAGG - Intergenic
1130034813 15:80349144-80349166 CCCCCCAAAAAAATCCCTGATGG + Intronic
1131476830 15:92747013-92747035 CTCCCCAAAAAAAAAAAAAAAGG + Intronic
1131692539 15:94842714-94842736 CCACCCAAAAAAAAAAAAGAAGG + Intergenic
1131860477 15:96647576-96647598 CATCTCAAAAAAAAAAATTAAGG + Intergenic
1133344590 16:5061507-5061529 CCCCCAAAAAAAAAAACAAGTGG + Intronic
1133914715 16:10098935-10098957 CCCCCCCCAAAAAAAACCTATGG + Intronic
1134464587 16:14463823-14463845 CCCCCCCAAAAAAAAAAGTTTGG - Intronic
1135116432 16:19727591-19727613 CCCCCCCAAAAAAAAAGATTTGG + Intronic
1135529034 16:23236769-23236791 CCCCCCAAAAGAACTACTTGAGG - Intergenic
1136646743 16:31626049-31626071 CCCCACCAAAAAAAAAGTTAAGG + Intergenic
1136646745 16:31626050-31626072 CCCACCAAAAAAAAAGTTAAGGG + Intergenic
1136658426 16:31730222-31730244 CCCACCAAAAAAAAAATTAAAGG - Intronic
1137466294 16:48712852-48712874 CCCCCCACAAAAAAAAACTTAGG - Intergenic
1137915849 16:52429142-52429164 CCTGCAAAAAAAAAAAATTAGGG + Intergenic
1138319363 16:56098695-56098717 TCCACCACAAAAAAAACTTGGGG + Intergenic
1138450375 16:57090530-57090552 CCCTCCAAAAAAAAAAAGAAAGG - Intergenic
1138775285 16:59714748-59714770 CCACCCAAGGAAAAAAATTATGG - Intronic
1138812710 16:60169752-60169774 CCCCAAAAAAATAAAAATTAGGG - Intergenic
1139889264 16:70237714-70237736 CCCCCCAAAAGAAAGACTAAAGG + Intergenic
1141106006 16:81234352-81234374 ACCCCCACAAAAAAAACTAATGG - Intergenic
1141838781 16:86560613-86560635 CCCCCAAAAAAAAAGAATTAGGG - Intergenic
1141838783 16:86560614-86560636 CCCCCCAAAAAAAAAGAATTAGG - Intergenic
1142295417 16:89218338-89218360 CCCCCAATAAATAAACCTTACGG + Intronic
1203141079 16_KI270728v1_random:1767090-1767112 CCCCCCAAAAAAAAGAAAAAAGG - Intergenic
1142498736 17:320637-320659 CCCCCCAAAAAAAAAAGAAAAGG + Intronic
1142564232 17:829139-829161 CCCCCCTAAAAAAAAAAAAAAGG - Intronic
1143616629 17:8055228-8055250 CCCCCCAAAAAAAAGAAAGAAGG - Intergenic
1143716192 17:8771415-8771437 CCCCCCAAAAAAAATTCTACCGG - Intergenic
1144251601 17:13422167-13422189 GCCCCCCAAAAAAGAATTTAGGG + Intergenic
1144254437 17:13452428-13452450 CCCCCCAAAAAAAAAGAAAATGG + Intergenic
1144554140 17:16266890-16266912 CCCCCCAAAAAAAAAGAGCAAGG - Intronic
1145211673 17:21017870-21017892 ACCTTCAAAAAAAAAATTTAAGG - Intronic
1145711638 17:26983598-26983620 CCCCACTTAAAAAAAATTTAAGG - Intergenic
1146564002 17:33896368-33896390 CCCCCCAAAAAAACATCTGATGG - Intronic
1146781329 17:35675632-35675654 CCCCCCACAAAAAAAAAAAAAGG - Intronic
1147123076 17:38347465-38347487 CCCGCCCAAAAAAAAAATTGTGG + Intergenic
1147127088 17:38378513-38378535 CCCCCAAAAAAGAAAAAGTAAGG + Intronic
1147229674 17:39008132-39008154 CACACAAAAAAAAAAAATTAGGG + Intergenic
1147351074 17:39844596-39844618 CCCCCCAAAAAAATGAATGATGG - Intronic
1147436923 17:40422137-40422159 CCGTCTAAAAAAAAAAATTATGG - Intergenic
1147569489 17:41559825-41559847 CCCCCACAAAAGAAAACTTTAGG + Intergenic
1147654228 17:42079673-42079695 CCCCCCAAAAAAAAGAAAGAAGG + Intergenic
1148056777 17:44803015-44803037 CACCAAAAAAAAGAAACTTAAGG - Exonic
1148188636 17:45663065-45663087 CCCTCCAAAAAAAAATCATAAGG - Intergenic
1148255688 17:46129837-46129859 CTCTCCAAAAACAGAACTTAGGG + Intronic
1148879979 17:50718304-50718326 CCCCCCAAAAATAAAAGTGTTGG + Intergenic
1148898409 17:50854887-50854909 CCCTCCAAAAAAAAAAAAAAAGG + Intergenic
1148925301 17:51079230-51079252 CCCCCCAGAAAAAAAAAAAAAGG - Intronic
1149387790 17:56158770-56158792 CCCCCTAAAATAAAAGCTTTGGG + Intronic
1149714443 17:58774165-58774187 CCCCCCAAAAAAAACATTATAGG + Intronic
1149759203 17:59214287-59214309 CCCTGCAAAAAAAAAAGTTCTGG + Intronic
1150867131 17:68864487-68864509 CCCCCCCAAAAAAAGAGTAATGG - Intergenic
1150936176 17:69638122-69638144 CCCCCAAAAAAAAAGACAGATGG - Intergenic
1151178835 17:72311192-72311214 CCCCCAAAAAAAAAGATCTATGG + Intergenic
1151181201 17:72329890-72329912 CCCACCAAAAAACCATCTTATGG - Intergenic
1151256448 17:72880408-72880430 CCCCACAAAAAAAAACCTGTTGG + Intronic
1151469253 17:74307797-74307819 CCCCCAAAAAAAGAAACATCTGG - Intronic
1151531058 17:74705025-74705047 CCCCCCAAAAATAAAAATATTGG + Intronic
1151644131 17:75418245-75418267 CCCGCTAAAAAAAAAAATTCAGG + Intergenic
1151838520 17:76600449-76600471 CCCACCTAAAAAAAAACTCAAGG - Intergenic
1152972453 18:176154-176176 CCCCCCAAAAAAAAAACATTTGG + Intronic
1153203766 18:2674155-2674177 CCCACAAAAAAAAAAAAGTAAGG - Intronic
1153641232 18:7159093-7159115 CCCCCCCAGAAAAAACCTCATGG + Intergenic
1154111321 18:11570880-11570902 CCCCCAAAAAATAAATATTATGG + Intergenic
1155747825 18:29383042-29383064 CCACTCAAAAACAAAAATTAAGG - Intergenic
1155946025 18:31852336-31852358 CCCCCCCAAAAAAAAGCGTTTGG + Intronic
1155946027 18:31852337-31852359 CCCCCCAAAAAAAAGCGTTTGGG + Intronic
1156141102 18:34112366-34112388 CCCCCCAAAAAAAAAAGATATGG + Intronic
1156180574 18:34598860-34598882 CATCTCAAAAAAAAAATTTAAGG + Intronic
1156323383 18:36049431-36049453 CCCCCCCACCAAAAAACTTAGGG + Intronic
1156713325 18:39975425-39975447 CACCTCAAGAACAAAACTTAAGG - Intergenic
1156737065 18:40273192-40273214 CCCCAAAAAAGAAACACTTAGGG - Intergenic
1157683716 18:49626716-49626738 CCCCCCAAAAAAAAATCCTCTGG + Intergenic
1158681015 18:59566807-59566829 ACCCCCAAGAAAAAAAATGATGG + Intronic
1158890952 18:61871209-61871231 CCACCCCAAAAAAAAACAGAAGG + Intronic
1158977907 18:62728878-62728900 CTAGCCAAAAAAAAAACTCAAGG - Intronic
1160167881 18:76529927-76529949 CCCCCCAAAAAAAGAAGTAGCGG - Intergenic
1160305866 18:77735714-77735736 TCCCCTAACAAAAAAACTTATGG - Intergenic
1160523154 18:79520439-79520461 CCCCACATAAAAAAAGTTTAAGG + Intronic
1160855592 19:1215738-1215760 CATCTCAAAAAAAAAACTTGGGG - Intronic
1161423582 19:4189550-4189572 CTCTTAAAAAAAAAAACTTAGGG - Intronic
1162319624 19:9963545-9963567 CCCCCCAAAAAAAACAGGCATGG - Intronic
1162409442 19:10496497-10496519 ACCCCCAAAAAAAAAAAAAAGGG + Intronic
1163162439 19:15472590-15472612 CCCCCCCAAAAAAAAATTGGAGG + Intronic
1163475550 19:17523887-17523909 CCCCCCAAAAAAGAAAGCGAGGG - Intronic
1163891405 19:20019240-20019262 CCCCCCAAAAAAAAGTGTTACGG + Intronic
1163919423 19:20274896-20274918 GCCCAGAAAAAAAAAACTGAAGG + Intergenic
1164953461 19:32359879-32359901 CCCTACAAAAAAAAAGCCTAAGG - Intronic
1165954224 19:39491852-39491874 GACTCCAAAAAAAAATCTTAAGG - Intronic
1166541052 19:43606156-43606178 ACACACAAAAAAAAAACTGAAGG - Intronic
1167165008 19:47793182-47793204 CGTCTCAAAAAAAAAACTTTGGG - Intergenic
1167349069 19:48963715-48963737 TCCCAGAAAAAAAAAAATTATGG + Intergenic
1168233933 19:55050109-55050131 CCCCCCAAAAAAAAAAAAATAGG - Intronic
925898608 2:8492843-8492865 CCCCCCAAAAAAAAAAAAAAAGG - Intergenic
926179207 2:10625720-10625742 CCCCACAAAAAAAAAGCCTGGGG + Intronic
926214884 2:10899392-10899414 TCCCACAAAAAAAAAACTCCAGG - Intergenic
927400598 2:22706234-22706256 CCCTACAAAAAAAATGCTTAAGG + Intergenic
927792577 2:26021711-26021733 CCTCCAAGAAAAATAACTTAGGG - Intergenic
927797985 2:26068543-26068565 CACCTCAAAAAAAAAATTAAAGG - Intronic
929685049 2:44026315-44026337 CACCCCAAAAAAAAACCTAGAGG - Intergenic
929716449 2:44315498-44315520 CCCGCCAAAAAAAAAAAAAAAGG + Intronic
929777109 2:44936457-44936479 CCCCCCAAAAGTAACCCTTAAGG + Intergenic
930335733 2:50042723-50042745 CTTGTCAAAAAAAAAACTTAAGG + Intronic
931342646 2:61416803-61416825 CCCCAAAAAAAAAAAGATTAGGG - Intronic
931342648 2:61416804-61416826 CCCCCAAAAAAAAAAAGATTAGG - Intronic
931661474 2:64568038-64568060 CTCCAAAAAAAAAAAAATTAAGG + Intronic
931975650 2:67641337-67641359 CCCCCAACAAAAAAAAAGTAAGG + Intergenic
932047673 2:68365779-68365801 CCTCCCAAAAAAAGAACTGAGGG - Intronic
932601002 2:73125471-73125493 CCCCCCACAAAAAAAAAAAATGG + Intronic
932949092 2:76271843-76271865 CCCACCAAAAAATAAACAAATGG - Intergenic
933628151 2:84626107-84626129 TCCCCTAAAAAAAAAACTCATGG + Intronic
933867901 2:86540088-86540110 CCCCCCAAAAAGACAAATTTAGG - Intronic
934182281 2:89636131-89636153 CCCCCCACAAAGAAAATTTCAGG + Intergenic
934292577 2:91710342-91710364 CCCCCCACAAAGAAAATTTCAGG + Intergenic
934320487 2:91967251-91967273 CATCTCAAAAAAAAAAATTATGG + Intergenic
935141219 2:100354570-100354592 CCCCCCGCAAAAAAAAAATAAGG + Intergenic
935310294 2:101776582-101776604 CCCCCCAAAAAAAAACACTATGG + Intronic
936661675 2:114549978-114550000 GCCCCCAAACCTAAAACTTAGGG + Intronic
938203872 2:129400715-129400737 CCCCCCAAAAAAAAAATCCCAGG + Intergenic
939192518 2:138932508-138932530 CCTCCAAAAAAAAAAATTAATGG + Intergenic
939205278 2:139094013-139094035 CCCCCCCAAAAGAAATCTTCAGG + Intergenic
940914079 2:159235291-159235313 CACTCCAGAAAAAAAACTTCAGG - Intergenic
941366536 2:164617944-164617966 CCCCCCCAAAAAAAAGATTCTGG - Intronic
941610760 2:167659231-167659253 ACCACCAAAAAAAAAACACATGG - Intergenic
941813228 2:169774998-169775020 CCCCCCATTATAAAAACTTCAGG + Intronic
942089446 2:172474742-172474764 CGCCCCAAGAAAAATACTAAGGG - Intronic
942385234 2:175435882-175435904 CCCCCAAAAATTAAAACTTGAGG - Intergenic
943744266 2:191444906-191444928 CCCCCCAAAAAAAAAAAAAATGG + Intergenic
944136199 2:196402329-196402351 CCCCCCAGAAATGAAACTCAAGG - Intronic
944992357 2:205252848-205252870 CCCACCAAAAAAAAAAAAAAAGG + Intronic
945053679 2:205849493-205849515 CCCCTCAAAAGAAAAACAAATGG + Intergenic
945441375 2:209884022-209884044 CCCCACAAAGAAACAACTTCTGG + Intronic
946720431 2:222600266-222600288 CCCCCAAATAAAACACCTTAGGG - Intronic
946856565 2:223956233-223956255 CACACCAAAAAACAAACTGATGG - Intergenic
947629915 2:231645412-231645434 CACCACAAAAAAAAAACGGAAGG - Intergenic
947680702 2:232029722-232029744 CCCCCAAGAAAACAAACTGAGGG - Intronic
948162739 2:235838191-235838213 CCCCCCAAAAAAAGAAAAGAGGG + Intronic
948838146 2:240636171-240636193 CCCCGCAAAACAAAAACCCAGGG - Intergenic
1169385158 20:5142441-5142463 CATCTAAAAAAAAAAACTTAAGG + Intronic
1169517356 20:6332560-6332582 CCCCCCAAAAAAATCACTCTAGG - Intergenic
1169982179 20:11396898-11396920 CCCCCCACAAAAAAAAGGAATGG + Intergenic
1170120156 20:12902660-12902682 ACAAACAAAAAAAAAACTTATGG + Intergenic
1170508422 20:17052880-17052902 CCCCCAAAATTAAGAACTTATGG - Intergenic
1170535648 20:17338157-17338179 CCCCCCCCAAAAAAAATGTAAGG - Intronic
1170766712 20:19295802-19295824 ACAACAAAAAAAAAAACTTAAGG - Intronic
1172050965 20:32117639-32117661 CCCCCCAAGAATAAAACAGATGG + Intronic
1172307085 20:33888556-33888578 CCCTCAAAAAAAAAAAGATATGG - Intergenic
1172461409 20:35121793-35121815 CTCCAAAAAAAAAAAACATAAGG - Intronic
1172725273 20:37035398-37035420 CCCCCCAAAGGAAATGCTTATGG - Exonic
1173211316 20:41034877-41034899 CCCGCCCAAAAAAAAAGTAAAGG - Intronic
1173413336 20:42835041-42835063 CCACACAAAAAAAGAACTCATGG + Intronic
1174642132 20:52053832-52053854 CCCCCCAAAAAAACAAAACACGG - Intronic
1175503674 20:59467485-59467507 GTCCCCATAAAAAAAACTGAGGG + Intergenic
1176730192 21:10487110-10487132 CCCCCCACAAAGAAAATTTCAGG - Intergenic
1177156195 21:17503802-17503824 CCTCTCAAGAAAAACACTTAAGG + Intergenic
1178034169 21:28562665-28562687 CACCACAAAAAAAAAAATTTAGG + Intergenic
1178072085 21:28979658-28979680 AACCCCAAAAACAAAACTTGCGG + Intronic
1178790821 21:35698547-35698569 CCCCCAAAATAATAAACTTAGGG + Intronic
1178942298 21:36916135-36916157 ACCACCTAAAAAAAATCTTATGG + Intronic
1180746525 22:18092807-18092829 CCCCCCAAAAAAAAGAAATGGGG - Exonic
1180791968 22:18579857-18579879 AACCCCAAAAAAACAACTTTTGG - Intergenic
1181229766 22:21415452-21415474 AACCCCAAAAAAACAACTTTTGG + Intergenic
1181248883 22:21519414-21519436 AACCCCAAAAAAACAACTTTTGG - Intergenic
1181849430 22:25739530-25739552 CATCTCAAAAAAAAAAATTAGGG + Intergenic
1182410975 22:30185990-30186012 CCCCCCAAGAAAAACACACAAGG - Intergenic
1182476184 22:30577654-30577676 CCCCCAAAAAAAAAAAGAAAGGG - Intronic
1182476186 22:30577655-30577677 CCCCCCAAAAAAAAAAAGAAAGG - Intronic
1182928209 22:34147478-34147500 CCTCCCATAAAAAAAATATATGG - Intergenic
1183620942 22:38972180-38972202 ACCCCCACAAAACAAACTGAAGG - Intronic
1184584114 22:45436136-45436158 CCCTCTCAAAAAAAAAATTAGGG - Intergenic
1185358764 22:50392361-50392383 CACCCCAAAATCAAAACTGAAGG + Intronic
949272465 3:2234964-2234986 TCCCCAAAAAAATAAACTCAGGG - Intronic
952371896 3:32730522-32730544 TCCTCCTAAAAAAAAACTTTAGG + Intronic
952371898 3:32730523-32730545 CCTCCTAAAAAAAAACTTTAGGG + Intronic
953011343 3:39028076-39028098 CCTCCCAAATAAAAAACTGTGGG + Intergenic
953430677 3:42837215-42837237 CTTCCAAAAAAAAAAACTTCAGG - Intronic
953733458 3:45469823-45469845 CCCACCAAAAAAAGAAATTTTGG + Intronic
954558368 3:51536015-51536037 GCCCCCAATTAAAAGACTTAAGG - Intergenic
954861106 3:53691146-53691168 CCCCCCAAAAAAAAAAAAAGAGG - Intronic
954884957 3:53864532-53864554 CTCCAAAAAAAAAAAAGTTAAGG + Intronic
955156737 3:56424268-56424290 CCACCAAAAAAAAAAAATCAGGG - Intronic
955373909 3:58378063-58378085 CTCTCCAGAAAATAAACTTACGG - Intronic
955435295 3:58893587-58893609 CCACAAAAAAAGAAAACTTAAGG - Intronic
955770211 3:62378044-62378066 CCCCCCAAAAAAAAAAAGTCAGG - Intergenic
957981446 3:87516420-87516442 TACCCCAAAAAAAAAAAGTAAGG + Intergenic
958735377 3:98003415-98003437 CCCACCAAAAAAAAAAAAAAAGG - Intronic
958874772 3:99603619-99603641 CCCCCCAAATATAAATCATAGGG - Intergenic
959221007 3:103519866-103519888 CCCCCAAAAAAAATAAATCAAGG + Intergenic
962225356 3:133602096-133602118 CCCCCTAAAAAAGAAACTCTAGG - Intronic
962781385 3:138721161-138721183 TCTCAAAAAAAAAAAACTTAAGG - Intronic
962782011 3:138728137-138728159 CTTCCCATAAAGAAAACTTAAGG + Intronic
963239412 3:142988278-142988300 GCCTTAAAAAAAAAAACTTAAGG + Intronic
963503411 3:146156910-146156932 ACCACCAATAAAAAAAATTATGG + Intronic
963623400 3:147640837-147640859 CCTCCCAGAAAAAAAAATTTGGG + Intergenic
963790149 3:149575092-149575114 CCCCCCAAAAAAAAAAGATGGGG + Intronic
964133907 3:153322423-153322445 CCTCCCAAAAAACAGACGTAGGG + Intergenic
964801288 3:160561846-160561868 CCCCCAAAAAGAAAAGCTGAAGG + Intronic
965421289 3:168462439-168462461 GCCCCTAAAAAAAAAACTGATGG - Intergenic
965758480 3:172050076-172050098 CCTCACAAAAAAAAAACAGAGGG - Intronic
966105828 3:176332709-176332731 CGAGCCAAAAACAAAACTTAGGG - Intergenic
967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG + Intergenic
967166828 3:186787615-186787637 CCCCCCAAAAAGCTAACTTTTGG - Intronic
968147805 3:196314093-196314115 CATCTCAAAAAAAAACCTTATGG + Intronic
968285168 3:197504341-197504363 CCGCCCAAAAAAAGAAACTAAGG + Intergenic
968320622 3:197764844-197764866 CCCCCCAAAAAAAAAAAGTATGG - Intronic
969852070 4:9965557-9965579 TTCCCCAAAGAAGAAACTTATGG + Intronic
970598108 4:17618305-17618327 CCACTCAAGAAAAAAATTTAGGG - Intronic
971104962 4:23514443-23514465 CCCCCCAAAAATAAAAATAAAGG - Intergenic
971977236 4:33706564-33706586 CCCCCCCAAAAAAAAATTAAAGG - Intergenic
972393711 4:38637660-38637682 CCTCCCACAAAAAAACCTTGAGG - Intergenic
972592423 4:40500313-40500335 CCCCCCAAAAAAAAAAGGGCTGG + Intronic
972685263 4:41346305-41346327 CCCCCCAAAAAATAAAAAGAAGG + Intergenic
974051227 4:56944065-56944087 CCCCTCAAAAACAGAACTTTGGG + Intergenic
974855670 4:67457847-67457869 CCCCCAAAATAAAAAACTTCTGG + Intergenic
975435556 4:74346752-74346774 CCCCCCAAAAAAAATTCTAGAGG + Intergenic
975663281 4:76708493-76708515 TCCCCCAACAAACAAAGTTAGGG + Intronic
976603584 4:86961658-86961680 ACCCAAAAAAAAAAAAATTAAGG + Intronic
977159480 4:93615634-93615656 CACCCCAAAAAAAAAAAAAAAGG + Intronic
977352297 4:95904090-95904112 CCAGCCAAAAAAAAAGCTTGAGG + Intergenic
978396128 4:108281945-108281967 CCCCACAAAAAAAAACCAGAAGG + Intergenic
978553027 4:109948479-109948501 CCCCCCAAAAAAAAATCCGAAGG - Intronic
978797547 4:112723347-112723369 CCCCACAAAAAAAAATCTTGAGG - Intergenic
978922601 4:114202409-114202431 CCTGCAAAAAAAAAAAATTAAGG + Intergenic
979468341 4:121067752-121067774 TCCCCCAATAAAAAAAGTTGTGG - Intronic
979504626 4:121481590-121481612 CCCCTCAAAAAAAAAATCGAAGG - Intergenic
979538776 4:121855312-121855334 CCCCCCAAAAAAGAAAAAAACGG + Intronic
979557135 4:122061961-122061983 CCCCCAAAAAAAAAATCATAAGG - Intergenic
979582952 4:122381050-122381072 TCCTCCAAAAAAAATACCTAAGG + Exonic
979585731 4:122414258-122414280 CCCCCAAAAAAAAAGACATTTGG - Intronic
979884966 4:126015228-126015250 CACCCCAAAAAAAAGAGGTAAGG + Intergenic
980291702 4:130853248-130853270 CCCCCAAAGAAAAAGACTCAAGG + Intergenic
981508639 4:145530735-145530757 CCCCCAAAAAAACAAACAGAAGG + Intronic
982487338 4:155982000-155982022 CCCCCAAAAAAGTAAATTTAAGG + Intergenic
982647953 4:158047605-158047627 CCCCAAAATAAAAAAAATTAGGG + Intergenic
983066258 4:163212965-163212987 CCCCCCCAAAAAAAAAGTGGGGG - Intergenic
983800090 4:171917278-171917300 CCAAACAAAAAAAAAAATTAAGG + Intronic
983958051 4:173720004-173720026 CCAACCAAAAAAAAAAGTTCAGG + Intergenic
984733883 4:183092692-183092714 CCATCTAAAAAAAAAAATTATGG + Intergenic
987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG + Intronic
987168800 5:15231015-15231037 CATTCCAACAAAAAAACTTAAGG + Intergenic
987460897 5:18208457-18208479 CGCCCCAAAAAAACAACTACAGG + Intergenic
988039066 5:25864638-25864660 CCCCACACACAAAAAAATTAAGG - Intergenic
988203161 5:28096113-28096135 CCTTCCAAAAAAAAAATCTAGGG + Intergenic
989048987 5:37300020-37300042 CCCGCCAAAAAAAAAAAAAAAGG + Intronic
990050936 5:51499742-51499764 CCCTCCAAAAAAAAATACTAAGG - Intergenic
990293075 5:54374659-54374681 CCCCCCTAAAAAAGACCTGATGG - Intergenic
990409305 5:55524809-55524831 CCCCCCCAAAAAAAAGTTTTAGG + Intronic
990806372 5:59667223-59667245 CCCCCCCAAAAAAAAATTCTAGG - Intronic
990917432 5:60925204-60925226 CCCCCCAAAAAAAATTTTTAAGG - Intronic
991176395 5:63691977-63691999 CCCTTCAAAAAGAAAACTTTTGG + Intergenic
991593179 5:68275824-68275846 ACACCTAAAAAAAAAAATTATGG + Intronic
992083555 5:73258143-73258165 CCCCCAAAAAAAAAAAAAAAAGG - Intergenic
993322683 5:86493008-86493030 CCCCCTAAAAATAAATCTTCAGG - Intergenic
993451513 5:88076558-88076580 CACACCAAAAATAAAACTTCAGG + Intergenic
994315355 5:98326783-98326805 CCTGTCAAAAAAAAAAATTACGG - Intergenic
994593007 5:101795537-101795559 CAACCAAAAAAAAAAACTTGAGG - Intergenic
995131516 5:108635716-108635738 CCCCCCAAAAAATATAGATAGGG + Intergenic
995168909 5:109082966-109082988 CCCCCCAAAAAAAGAAAAAAAGG + Intronic
995231667 5:109771875-109771897 CCCCCCAAAAAAAGAACAAAGGG - Intronic
995569553 5:113465090-113465112 CCCCACAAAAAAAAAAATCTTGG - Intronic
995631053 5:114133196-114133218 CCCACAAAAAAAAAATCTGATGG - Intergenic
996206924 5:120750661-120750683 CATCTCAAAAAAAAAAATTATGG + Intergenic
996655135 5:125926236-125926258 AGCCCCAAGAAAAAAACTTGAGG + Intergenic
996866385 5:128127564-128127586 CCTGCCAAAAAAAAAACTATAGG - Intronic
997298057 5:132781847-132781869 CCCACCCCTAAAAAAACTTAAGG - Intronic
997708887 5:135986377-135986399 CCCCCCAAAAAAGAATCAAATGG - Intergenic
998192560 5:140039689-140039711 CCCCTCCAAAAAAAAACCCACGG + Intronic
998685449 5:144518832-144518854 AATTCCAAAAAAAAAACTTAGGG - Intergenic
999138823 5:149343323-149343345 TCCCTTAAAAAAAAAAATTAAGG + Intergenic
999162745 5:149518212-149518234 CCCCCCAAAAAAATATTGTACGG + Intronic
1000015779 5:157274222-157274244 CACCCCAAAAAGAAATCTCATGG + Intronic
1000125490 5:158239606-158239628 CCCCCCAAAAGAGGAACTTATGG - Intergenic
1000307204 5:160005658-160005680 CCCCCCAAAAAAAAAAAAGAGGG + Intergenic
1000628194 5:163563348-163563370 GCTCCCAAAATAAAAGCTTAAGG + Intergenic
1000745154 5:165023680-165023702 TCCCCCCCAAAAAAAACTAAAGG + Intergenic
1001466286 5:171969275-171969297 CCCCCAAAAAAAAGAATGTATGG + Intronic
1002137970 5:177119988-177120010 CCCCCAAACAAAAAAACATAAGG + Intergenic
1002404662 5:179020827-179020849 CCCCCCAAAAAAAAAAGGCCGGG - Intergenic
1002537515 5:179885588-179885610 CCCCCCCAAAAAAAAAAAGATGG + Intronic
1002708003 5:181175895-181175917 CCCCCCGAAAAAAAGAATTCGGG + Intergenic
1004017590 6:11746406-11746428 CCCCCCACCACAAAGACTTATGG - Intronic
1005352833 6:24953330-24953352 CCCCCCCCCAAAAAAAATTAAGG + Intronic
1006031768 6:31181233-31181255 CCCCCCAAAAAAATAATTTGGGG + Intergenic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1006487485 6:34355673-34355695 CCCCCCAAAAAAACAGCTGTAGG - Intronic
1007631551 6:43275804-43275826 ACCCCCGAAAATAAAACTCAGGG + Intronic
1007651758 6:43427018-43427040 CCCCCCCCAAAAAAAAGTTGAGG + Intergenic
1007954589 6:45904736-45904758 CCCCCCAAAAAAAAGAGGGAAGG - Intronic
1008527196 6:52419095-52419117 CCCCCCAAAAAAAATGTTTCAGG + Intergenic
1008601686 6:53102186-53102208 TCCCACAAAAAAAAGACCTACGG + Intergenic
1008685097 6:53916954-53916976 CCCCAGAAATAAAAAACTTGTGG - Intronic
1008745149 6:54660776-54660798 CTCACGAAAAAAAAAAATTAAGG - Intergenic
1008934386 6:56974243-56974265 CCCCCCAGAAAAAGAAATGAAGG + Intronic
1009457055 6:63869912-63869934 CCCCCCATAAAAAAAATCTCAGG + Intronic
1009957995 6:70479673-70479695 CCCACCAATAATAAAACTTCAGG - Intronic
1010306893 6:74335158-74335180 CCCCCCCAAAAAAAATGTAAGGG - Intergenic
1010986529 6:82431619-82431641 CCTGCCAAAAACAAAACTTATGG + Intergenic
1011188988 6:84711059-84711081 CCCCCCAAAAAATCCACATACGG - Intronic
1011575542 6:88793797-88793819 CCCACCAAAAAAAGAAATCATGG + Intronic
1011577812 6:88823636-88823658 CACCCCAAAAAATAGACTAATGG + Intronic
1011933730 6:92747725-92747747 CCACCAAAAAAAAATTCTTAAGG - Intergenic
1012337029 6:98072868-98072890 CCCCCAAAGTATAAAACTTAAGG - Intergenic
1012368415 6:98471388-98471410 CCCCCAAAAATAAAAATCTAAGG + Intergenic
1012637452 6:101562214-101562236 TTCCCTAAAAAAAAAACTTTAGG + Intronic
1012929869 6:105305838-105305860 CCCCCCAAAAAAAAAAGAAAAGG - Intronic
1013248643 6:108312760-108312782 ACAACCAAAAAAAAAACATAAGG - Intronic
1015992442 6:138960345-138960367 CCCACAAAAACAAAAACTTAGGG - Intronic
1016037041 6:139394016-139394038 ACACTTAAAAAAAAAACTTATGG - Intergenic
1016381098 6:143481011-143481033 CCCCCCCAAAAAAAGAAGTAAGG + Intronic
1016720898 6:147296057-147296079 ACCCCCCAAAAAAAAACAGATGG + Intronic
1016841263 6:148527970-148527992 CCCCAAAAAAAAAAAGCTTTAGG - Intronic
1017030653 6:150218480-150218502 CCCCCCAAAAAAAAATTCTGAGG + Intronic
1017134339 6:151134934-151134956 CACCTCAGAAAAAAAAGTTAGGG + Intergenic
1017432646 6:154386074-154386096 CCCCCCAAAAAACAGCATTATGG + Intronic
1017500487 6:155018776-155018798 CCCATCAAAAAAAAAAGTGATGG - Intronic
1017758230 6:157548099-157548121 CTCCCCAAAAAAAAAAAATCTGG + Intronic
1018673721 6:166201045-166201067 CCCCCTAAATCAAAATCTTAGGG + Intergenic
1019491764 7:1317432-1317454 CCCCCCAAAAAAAAAGAGTCCGG + Intergenic
1020470810 7:8532452-8532474 CCCCCCAAAAAAAATATGAAAGG - Intronic
1021048451 7:15952717-15952739 CCCGCCAAAAAAAAAAAGAATGG + Intergenic
1021088784 7:16456093-16456115 CCCCCAAAAGAAAAAACAAATGG - Intergenic
1021242885 7:18226518-18226540 CCTTCCATAAAAAAAACTAAAGG + Intronic
1021300541 7:18967501-18967523 CCCCCCAAAAAAAAAAAAGCAGG + Intronic
1021300543 7:18967502-18967524 CCCCCAAAAAAAAAAAAGCAGGG + Intronic
1022720384 7:32937272-32937294 CCCCCCAAAAAGAAAAACGAAGG + Intergenic
1022893732 7:34728049-34728071 CACCTCAAAAAAAAAAATAAAGG - Intronic
1023932180 7:44712676-44712698 CCAACCAAACAAAAAACCTAGGG - Intergenic
1024046619 7:45589785-45589807 CCCTTCAAAAAAAAAACCCACGG - Intronic
1024121599 7:46247293-46247315 ACACCCAAAAAAAAAAATCACGG - Intergenic
1024197748 7:47076167-47076189 CCCACCAAAAAAAAAAAAGAAGG + Intergenic
1024600330 7:50975004-50975026 GGCTCCAAGAAAAAAACTTACGG - Intergenic
1025984270 7:66434150-66434172 TCACACAAAAAAAAAACATATGG + Intergenic
1026028873 7:66771554-66771576 ACTCCTAGAAAAAAAACTTAGGG - Intronic
1026209880 7:68294702-68294724 CCCCTCAAAAAAGAAATTCAGGG + Intergenic
1026553498 7:71387312-71387334 CCCCCCAAAAAAAGAACACCAGG - Intronic
1026841775 7:73673316-73673338 CCCACCCAAAAAAAAAGTTAGGG + Intergenic
1027008119 7:74714800-74714822 CCCCCCCAAAAAAAAATGTGGGG - Intronic
1027186766 7:75976836-75976858 CCACCACCAAAAAAAACTTAGGG - Intronic
1027380205 7:77599907-77599929 CCCCCAGAAACAAAAACTTTGGG - Intronic
1027621227 7:80487807-80487829 CCACCCAAAAAAAAGAGTAACGG - Intronic
1028084048 7:86615229-86615251 CCTCCCAGAAAAAAAACATTAGG + Intergenic
1028236557 7:88369773-88369795 CCCCCCTCAAAAAAATCTTTAGG - Intergenic
1028262698 7:88685022-88685044 CCCCTCAAAAAAAAAAAAAATGG + Intergenic
1028819179 7:95186245-95186267 CCCTCCTAAAAAAATATTTAGGG - Intronic
1029256259 7:99271695-99271717 CCACTCAAAAATAAAATTTAAGG - Intergenic
1029876669 7:103761612-103761634 CCCCCCAAAAAAAAATTTACTGG - Intronic
1030423531 7:109340645-109340667 CCCCCATAATAAAATACTTATGG - Intergenic
1031657661 7:124378441-124378463 CTCTCCTAAAATAAAACTTATGG + Intergenic
1031665934 7:124482075-124482097 CTCCCCAAATGATAAACTTACGG - Intergenic
1031963231 7:128008463-128008485 CCCTCCAAAAAAAAAAAAAAAGG - Intronic
1032512286 7:132481511-132481533 ACCCCCAAAAAAAAACATTGAGG + Intronic
1032647720 7:133844114-133844136 CACAACAACAAAAAAACTTAAGG - Intronic
1032704593 7:134410956-134410978 CCACCCAAACCAAAAACATATGG + Intergenic
1032711916 7:134468240-134468262 CCCCCCAAAAAAAACACCCATGG + Intergenic
1033116633 7:138631570-138631592 CTTCCCAAAAAAAAAGCTTTGGG - Intronic
1033459259 7:141530507-141530529 CCCCCCAAAAGAGAAAATTAGGG + Intergenic
1033561199 7:142533276-142533298 CCCCCCAAAAAAGAAAGATTTGG - Intergenic
1034226109 7:149484074-149484096 TTCCCCACAAAGAAAACTTAAGG + Intronic
1034599379 7:152234422-152234444 CCCCCCACAAAGAAAATTTCAGG + Intronic
1035984914 8:4417671-4417693 CTCTCCAAAATAAAAACTAATGG + Intronic
1036249325 8:7148074-7148096 CCACCTAAAAAAAAATCTTCAGG - Intergenic
1036368123 8:8138967-8138989 CCACCTAAAAAAAAACCTTCAGG + Intergenic
1036882762 8:12526680-12526702 CCACCTAAAAAAAAACCTTCAGG - Intergenic
1038096941 8:24323600-24323622 CCACCCAAAAAAGAAGTTTACGG + Intronic
1038502041 8:28053084-28053106 CCAGCCAAAAAAAAAAGTGATGG + Intronic
1039566978 8:38558809-38558831 CCCCCAAAAAAAAAATTCTAAGG - Intergenic
1040580334 8:48693753-48693775 CCCACCAAAAGAAAAAGTTAGGG - Intergenic
1042555313 8:70029476-70029498 CCCGCCAAAAAAAAAAAATAAGG - Intergenic
1043023680 8:75039459-75039481 CCCCCCAAAGAAAAAAAAAAAGG - Intergenic
1043713986 8:83458039-83458061 CACCCCACAAAAAAATCATAGGG - Intergenic
1043844444 8:85148626-85148648 CGTCTCAAAAAAAAAATTTAAGG + Intergenic
1043868456 8:85402357-85402379 CCCCCCCAAAAAAAAAAGTCTGG - Intronic
1043873502 8:85461405-85461427 CCCCAGAAAAAAAAAAATTCAGG - Intergenic
1043998231 8:86845049-86845071 CCCCCCAAAAAACTACCTCAAGG + Intergenic
1044045777 8:87430120-87430142 CACCAGAAAAAAAAATCTTAAGG - Intronic
1045124723 8:99077095-99077117 CACCCTAAAAGAAAAGCTTAGGG - Intronic
1045134361 8:99197874-99197896 CACCCCAAAAAGAAATCTTGGGG - Intronic
1045505794 8:102777537-102777559 CCTCAAAAAAAAAAAAATTAAGG + Intergenic
1046169622 8:110487922-110487944 CACCTCAAAAAAAATACTAAAGG + Intergenic
1046564702 8:115884487-115884509 CCCCTTAAAAAAAAAACAAACGG - Intergenic
1047477436 8:125247328-125247350 GTCTCCAAAAAAAAAAGTTAAGG + Intronic
1048139476 8:131779261-131779283 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic
1048927341 8:139282688-139282710 CCCCCCACAAAAAAAAATCAGGG + Intergenic
1049926969 9:418883-418905 CCTCCAAAAAAAAAGACTGAAGG + Intronic
1050477239 9:6052932-6052954 CCCCCCACAAAAAAAACACTGGG + Intergenic
1050833152 9:10039655-10039677 CCCCCAGAAAAGAAAACTGAGGG - Intronic
1050928233 9:11293182-11293204 CCCACCAAAAAAGGAACTTGAGG - Intergenic
1051271355 9:15358364-15358386 ACCCCCAAAACAAAAACTACTGG - Intergenic
1051288998 9:15526936-15526958 CCGCCCAAAAAAAAGAATTCTGG - Intergenic
1052100251 9:24437211-24437233 CCTCCCAAATAAACAACTCAAGG + Intergenic
1052320098 9:27158659-27158681 CCCCCCAAAAAAAAAAAAAAAGG - Intronic
1052809892 9:33048272-33048294 CACCCCAAGAAAAAAACATCAGG + Intronic
1053241780 9:36501930-36501952 CCCCCCGCAAAAAAAACCTCTGG - Intergenic
1053328407 9:37178404-37178426 CCCACCAAAAAAAAAAAAAAAGG + Intronic
1053565562 9:39246746-39246768 CCCCCTAAAAAAAAAAGAGATGG + Intronic
1054131587 9:61372293-61372315 CCCCCTAAAAAAAAAAGAGATGG - Intergenic
1057261795 9:93588588-93588610 CCCCCCAGAAAAACACTTTATGG + Intronic
1057459894 9:95251642-95251664 CCCCACCAAAAAAAATTTTAAGG + Intronic
1058168787 9:101652924-101652946 CCCCCCTAAAAAAAATCACAAGG - Intronic
1058320798 9:103628080-103628102 CCCTCCAAAAGAAAAAATAAAGG + Intergenic
1060533357 9:124362724-124362746 CACCACAAAAAAAAAATTTGAGG + Intronic
1060689403 9:125643193-125643215 CCCCCCAAAAAAAAAACGCTGGG - Intronic
1061648141 9:132023204-132023226 CCCCCCCAAAAGAAAACAGATGG + Intronic
1061944804 9:133902636-133902658 CCCCTCAAAAAAGATACATAGGG + Intronic
1203584089 Un_KI270746v1:46964-46986 CCCCCCACAAAGAAAATTTCAGG + Intergenic
1185632110 X:1522766-1522788 GCCCCTAAAAATAAAAATTAAGG + Intronic
1186341132 X:8647136-8647158 CCCCCCACAACAAAGGCTTATGG - Intronic
1186669414 X:11755038-11755060 CCCCCCAAAAGAAATACATCTGG - Intergenic
1187538164 X:20163471-20163493 CCCCCCAAAAAAAAATCTGATGG + Intronic
1187797549 X:23020951-23020973 CCCCCCAGAAAAAAATCATGGGG - Intergenic
1187840937 X:23486827-23486849 CAGCCCAAAATGAAAACTTAGGG - Intergenic
1189206227 X:39241518-39241540 CCTTCTATAAAAAAAACTTAGGG - Intergenic
1190295722 X:49026234-49026256 CCCCCCCAAAAAAAAACCTCTGG + Intergenic
1190295724 X:49026235-49026257 CCCCCCAAAAAAAAACCTCTGGG + Intergenic
1190302164 X:49063348-49063370 CACCTCAAAAAAAAAAAATATGG + Intronic
1190313714 X:49135756-49135778 CGACCAAAAAAAAAACCTTAAGG + Intergenic
1190526655 X:51334864-51334886 CATCTCAAAAAAAAAAGTTAAGG - Intronic
1191243104 X:58204852-58204874 CCGTCAAAAAAAAAAACTTGTGG + Intergenic
1192119835 X:68445158-68445180 CCCCCCCAAAAAAAACTTCAAGG + Intergenic
1193456057 X:81732988-81733010 CCCAGAAAAAAAAAAACTGAGGG + Intergenic
1193576295 X:83201872-83201894 TCCCCCAGAAACAAAACTTGCGG - Intergenic
1194080223 X:89453525-89453547 CACAGCAAAAAAAAAACTTCAGG + Intergenic
1195376326 X:104231439-104231461 CCTTCCAAAAAAAAAAATCAAGG - Intergenic
1195453931 X:105046820-105046842 CCCCCCAAAAAAAAAAAAAAAGG - Intronic
1195764682 X:108283572-108283594 CCCCCCAAAAAAAAAACTTAGGG - Intronic
1195764684 X:108283573-108283595 CCCCCCCAAAAAAAAAACTTAGG - Intronic
1195804706 X:108751083-108751105 CCCTCCTAAAAAAATACTTGGGG - Intergenic
1196106269 X:111899227-111899249 CCGCCCCACAAAAAAACTCATGG + Intronic
1196933754 X:120708285-120708307 CCTACCAAAAAAAAAACCCAGGG - Intergenic
1196945539 X:120821426-120821448 ACACACAAAAAAAAAACTTCAGG - Intergenic
1197238392 X:124094929-124094951 CATCTCAAAAAAAAAACTCATGG - Intronic
1197346685 X:125332672-125332694 CCTCCTTAAAAAAAAATTTAGGG + Intergenic
1197360031 X:125490358-125490380 ACACCCAGAAAAAAAACTTATGG - Intergenic
1199547942 X:149027798-149027820 CCCTCCCCAAAAAAAACTTTGGG + Intergenic
1199645159 X:149902173-149902195 CCCCCCACAAAAAAAAAATTTGG + Intergenic
1200109441 X:153732859-153732881 CCCCTCCAAAAAAAAACAGACGG - Intronic
1200437533 Y:3170381-3170403 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic
1200582005 Y:4962370-4962392 CCCCCCACAAAAAAAAAAAAAGG - Intergenic
1200661741 Y:5967978-5968000 CCCCCCCAAAAAAAGAGTGATGG - Intergenic
1201580924 Y:15511513-15511535 CCCCTCAGAAAAAATACTTAGGG - Intergenic
1201718783 Y:17075089-17075111 TACCTCAAAAAAAAAAGTTAGGG - Intergenic