ID: 1195765972

View in Genome Browser
Species Human (GRCh38)
Location X:108297511-108297533
Sequence ACCAAAAATGTTCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 29, 3: 104, 4: 345}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195765964_1195765972 14 Left 1195765964 X:108297474-108297496 CCCACTAGATGCCAGTATGACCC 0: 2
1: 8
2: 124
3: 495
4: 1155
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765965_1195765972 13 Left 1195765965 X:108297475-108297497 CCACTAGATGCCAGTATGACCCC 0: 2
1: 2
2: 71
3: 389
4: 1015
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765961_1195765972 26 Left 1195765961 X:108297462-108297484 CCCTGTCCTCTACCCACTAGATG 0: 8
1: 195
2: 709
3: 1167
4: 1451
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765968_1195765972 -6 Left 1195765968 X:108297494-108297516 CCCCACCAGTTGTGGCAACCAAA 0: 1
1: 3
2: 57
3: 191
4: 589
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765963_1195765972 20 Left 1195765963 X:108297468-108297490 CCTCTACCCACTAGATGCCAGTA 0: 162
1: 534
2: 943
3: 1307
4: 1428
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765970_1195765972 -8 Left 1195765970 X:108297496-108297518 CCACCAGTTGTGGCAACCAAAAA 0: 3
1: 54
2: 252
3: 533
4: 898
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765962_1195765972 25 Left 1195765962 X:108297463-108297485 CCTGTCCTCTACCCACTAGATGC 0: 5
1: 171
2: 624
3: 1113
4: 1468
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765966_1195765972 3 Left 1195765966 X:108297485-108297507 CCAGTATGACCCCACCAGTTGTG 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345
1195765969_1195765972 -7 Left 1195765969 X:108297495-108297517 CCCACCAGTTGTGGCAACCAAAA 0: 1
1: 8
2: 95
3: 270
4: 588
Right 1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG 0: 1
1: 1
2: 29
3: 104
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195765972 Original CRISPR ACCAAAAATGTTCCCAGACA TGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
903685949 1:25132147-25132169 ATCAAAAATGTTCCTAGGCCCGG + Intergenic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
905750017 1:40454091-40454113 CCCAAAAACGTTCACAAACAGGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907902863 1:58757123-58757145 TTCAAAAATGTTCTCAGACCTGG - Intergenic
908128949 1:61055352-61055374 ACCAAATCTGTTCCCATACATGG - Intronic
910230072 1:84976465-84976487 AATAAAGATTTTCCCAGACAAGG + Intronic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910362072 1:86422928-86422950 CCCAGAAATGTTCCGAGACGGGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911437739 1:97883735-97883757 CCTAAAAATGCTACCAGACATGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913369241 1:118079207-118079229 ATCAAAAATCTTCCCAAATAGGG - Intronic
914239928 1:145846495-145846517 ACCCAAGATGGTCCCAGGCATGG - Intronic
915183122 1:154080526-154080548 ACCAAAAAATTTCCCAAGCACGG + Intronic
915317938 1:155040145-155040167 ACCAAAAAATTAGCCAGACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916513265 1:165492410-165492432 AGCATAAATGCTCCCAGTCAAGG + Intergenic
916775811 1:167962967-167962989 AACAAAAATGTTGCCAGGCGTGG + Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
1063102050 10:2958858-2958880 CCAAAAAATGTGCCCACACAGGG + Intergenic
1063529452 10:6817301-6817323 CCCTAAAATGTTTCCATACATGG + Intergenic
1063856491 10:10259874-10259896 ACCAAAAAAGTTCACAGTCATGG - Intergenic
1064057824 10:12112654-12112676 AACACAATTGTTCCCAAACACGG - Intronic
1064950783 10:20847688-20847710 GCCAGAAATGTTCTCAGAAAAGG + Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065703039 10:28444115-28444137 AAAAAAAATGTTCTCAGGCAGGG + Intergenic
1066367278 10:34789308-34789330 ACCAAAATTTTTGCGAGACATGG + Intronic
1068588315 10:58826329-58826351 ACCACATGAGTTCCCAGACACGG + Intronic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069673102 10:70227089-70227111 ACCAGAAATTTTCCAAAACATGG - Intronic
1071728478 10:88223373-88223395 AGCAAAAATATTCCCACAAAAGG + Intergenic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076269799 10:129141824-129141846 ACCAAAACTGTTTCAAAACAGGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078281252 11:9903422-9903444 ACCAAATATGTTACCAGTCAAGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082108494 11:48245693-48245715 CCCAAAACTGATCACAGACAGGG - Exonic
1082887620 11:58104108-58104130 ACTAATAATATTCCCAGAGAAGG - Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084752300 11:71212377-71212399 CCTAAAAATGTTCTCAGACCTGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086310370 11:85529816-85529838 ACAACAAAGGCTCCCAGACAAGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1087509225 11:99068999-99069021 ACCATGAATGATGCCAGACAAGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089109421 11:116043429-116043451 ACAAAAAAATTACCCAGACATGG + Intergenic
1089226795 11:116930931-116930953 TCCAAACATGTACCCAGACAGGG + Intronic
1089573788 11:119427094-119427116 ACCAATAATGTTCCAAGGCACGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091064240 11:132493618-132493640 TTCAAAAATGTTCCCAAAAAAGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093006403 12:14056233-14056255 ACCAAAAACATTCCAAGAAAGGG + Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093741875 12:22698577-22698599 ATCCAAAATGTTGCCAGAAATGG + Intergenic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1098774185 12:74590142-74590164 TCCAAAAATCTTCCCAGAATAGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101587294 12:106095937-106095959 ATCAAAAAAATTCCCAGACTCGG + Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102295089 12:111730240-111730262 ACCAAAAATCTTCGCAGACCTGG + Intronic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107175201 13:37391837-37391859 ACCAAAAATGGTCCCCCTCATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107782625 13:43920811-43920833 ACGAAAAAAGTTCCTAGAAATGG - Intergenic
1107955927 13:45511269-45511291 AACATAAATGTTCAAAGACAGGG - Intronic
1108289442 13:48943939-48943961 AACAAAAAGTTACCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109009735 13:56925318-56925340 ACAAAAAATGCACCAAGACAGGG + Intergenic
1109206511 13:59488696-59488718 ATAAAATATCTTCCCAGACATGG - Intergenic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1109872337 13:68349543-68349565 ACAAAAAAATTTCCCAGGCATGG + Intergenic
1110133454 13:72036309-72036331 ACAAAAAATGATCTCAGAAATGG + Intergenic
1110383927 13:74886376-74886398 ATCCATAGTGTTCCCAGACAGGG + Intergenic
1110844809 13:80182080-80182102 ACTACAAATGGTCCCAGAGAGGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1111585329 13:90276666-90276688 GCAAAAAATATTCCCAGAAATGG + Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112383200 13:98912993-98913015 GCCAAAACTCTTCCCAGACTAGG + Intronic
1113039579 13:106090358-106090380 AACCAAAATGTTCCCAAATAGGG + Intergenic
1114203185 14:20542149-20542171 CCTCAAAATGCTCCCAGACAAGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114787969 14:25622823-25622845 AACAATAATTTTCCCAGAGATGG - Intergenic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1119925164 14:78486733-78486755 ACCATAAAAGTTCACAGTCATGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1122066826 14:99179636-99179658 ACCAAAGCGGTTCCCGGACACGG - Intronic
1124869900 15:33530359-33530381 ACCAAATCTATTCCCAGAAATGG - Intronic
1125596833 15:40892948-40892970 AAGAAAAGTGATCCCAGACAGGG - Intergenic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129565763 15:76621570-76621592 ACAAGAACTGTGCCCAGACATGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133579989 16:7135222-7135244 AACAAAAAAATTCCTAGACAGGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136143382 16:28301372-28301394 ACCAAAGATGTGCCCCGAGAAGG + Intronic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1138423828 16:56917098-56917120 TCCAAGAATGTTCACAGAAATGG + Intergenic
1139385706 16:66567879-66567901 ACCAAAACTGATCCCAGAATAGG + Intronic
1139567668 16:67789317-67789339 AAAAAAAATGTACCCAGGCATGG + Intronic
1140061882 16:71577627-71577649 AAAAAAAATGTTGCCAAACAAGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1141026041 16:80549344-80549366 ACTAAAATTGTTACCAGAGAGGG + Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141521991 16:84586738-84586760 ACCAAAAAAGTAGCCAGGCATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143835676 17:9690592-9690614 AACTAAAATGTTGCCAGACGTGG + Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145006958 17:19343654-19343676 CCCACAAATGTTCCCAGATGAGG - Intronic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148210485 17:45805680-45805702 ACCAGCAGAGTTCCCAGACAGGG - Intronic
1148580733 17:48741844-48741866 AAAAAAAATGTACCCAGGCATGG - Intergenic
1148601088 17:48894791-48894813 TCAAGGAATGTTCCCAGACAGGG + Intronic
1149963554 17:61138843-61138865 AAAAAAAATATTCCAAGACATGG - Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151860551 17:76758019-76758041 ACAAAAAATGTTCTCAAAGAAGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152470104 17:80486407-80486429 ATGAAAAATCTTCCCAGAAAAGG - Intergenic
1153633071 18:7090113-7090135 ACCAAACATGTTCCCATAACAGG + Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154987171 18:21563641-21563663 ATGAAAAATGTTCCCAGGCCAGG - Intronic
1155540628 18:26864578-26864600 ACTAAAAATATTCCCAAAGACGG + Intronic
1156357617 18:36355857-36355879 ACCACAAATGTTCCTAGGAAAGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157905783 18:51568709-51568731 ACCATAAATGGTACCATACAGGG + Intergenic
1158927991 18:62290109-62290131 ATAAAAATTGTTCACAGACATGG - Intronic
1159131871 18:64288803-64288825 ACCATAAACGTTCTAAGACATGG - Intergenic
1159736144 18:72100313-72100335 ACCAAAACTGCTACCAGAAATGG - Intergenic
1159982833 18:74806898-74806920 AGCAAAAATTTTCTCAGGCATGG + Intronic
1160224257 18:76999834-76999856 ACCAAAAATGTTCACAGTTTTGG - Intronic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161263598 19:3352039-3352061 ACAAAAATTCTTGCCAGACATGG + Intergenic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161279894 19:3440301-3440323 ACCGTAAATGTCCCCAGACCTGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161340077 19:3736557-3736579 ACAAAAAATGAACCCAGATAAGG - Intronic
1161429530 19:4223561-4223583 AACAAAAAATTTCCCAGGCAAGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164113689 19:22195324-22195346 ACCCAAAATGTGCCAAGACGGGG - Intronic
1164144511 19:22503745-22503767 CTCAAAAATGTTGGCAGACATGG + Intronic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1167996004 19:53402713-53402735 ACTAAAAAAGTTGCCCGACATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
927278073 2:21278806-21278828 TCCAAACATGTTCTCAGAAAAGG + Intergenic
927372903 2:22378289-22378311 ACCAAAACTGTTGCCCAACACGG + Intergenic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
931192898 2:60022845-60022867 TACACAAATGTTCCAAGACAAGG + Intergenic
933230727 2:79804129-79804151 CTCAATAATGTTCCCAGATATGG + Intronic
933516130 2:83304868-83304890 AACAAAAATGTGCCTAGAGATGG - Intergenic
935024059 2:99259485-99259507 AACAAATATATTCCTAGACATGG - Intronic
935670790 2:105555570-105555592 ACCGAACATGTTCCCAGATGAGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938656108 2:133435841-133435863 ACCAAAAAGGAACCCCGACATGG - Intronic
938779081 2:134568369-134568391 ACAAAAAAATTACCCAGACATGG + Intronic
939461628 2:142503640-142503662 GACAAAAAGCTTCCCAGACAAGG - Intergenic
939608350 2:144279805-144279827 AGCCAAAATGTTCCCAGAGCAGG + Intronic
940123962 2:150302139-150302161 ACAGAAAATGTTCTCTGACAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
946178834 2:217937941-217937963 ACAAAAACTGCTCCCATACAGGG + Intronic
946972753 2:225113422-225113444 AACAAAAATGTTCCTGTACATGG - Intergenic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947018876 2:225652308-225652330 ATCAGAAATGTTCTCAGAAAGGG + Exonic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948118418 2:235511052-235511074 ACCGAAAATTGCCCCAGACATGG - Intronic
948789409 2:240369632-240369654 ACCAACACTGTGCCCAGTCAGGG + Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169441456 20:5637202-5637224 AAAAAAAAAGTTACCAGACATGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174492301 20:50908989-50909011 GCCAAAAATTGTCCCAGAGATGG + Intronic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174949462 20:55028563-55028585 AACAAAAATGTGCCCAGGTAGGG + Intergenic
1174992774 20:55530628-55530650 AGCAAAATTGTTCCCAGAGAAGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949560778 3:5200220-5200242 AACATAAATGTACCCAGGCATGG - Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952412459 3:33061968-33061990 GCCCTAAATGTTCTCAGACAGGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955802850 3:62704044-62704066 ACCTAAAATCTTGCCTGACATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956622928 3:71239251-71239273 ACCAAAAAGCTGCCCAGGCACGG + Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958882045 3:99683267-99683289 ACCAAAATTTTACCCAGCCAGGG + Intronic
959563203 3:107806219-107806241 GGCAAATATTTTCCCAGACAGGG + Intronic
959776335 3:110168449-110168471 ATAAAAAATTTTCCCAGAGAAGG - Intergenic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960932354 3:122866329-122866351 AACAAAAATCTTGCCAGGCATGG - Intronic
961444956 3:126976017-126976039 ACCAAAGATGTTCCCAAGTATGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961930493 3:130528233-130528255 AACAAAAAGGTTGCCAGAGAGGG + Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962583249 3:136817581-136817603 TCCAAGAATGTTCCCAAAGAGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963974425 3:151464971-151464993 TCCAAAACTGTACCCATACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
966422647 3:179748577-179748599 ACTAATATTCTTCCCAGACATGG - Intronic
966464436 3:180214300-180214322 ACCAAAAATAGTACCAGGCAGGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
968409972 4:381933-381955 AAAAAAAAAGTTCCCAGAGATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
970297697 4:14648645-14648667 ATCAAAAAATTTCCCAGGCATGG - Intergenic
973125552 4:46579728-46579750 GTCAAAAGTGTTCCCAAACAAGG + Intergenic
973129017 4:46626159-46626181 ACCATAAATGTGCTCAGAAATGG - Intergenic
975164503 4:71162902-71162924 AAAAAGAATGTTCCCAAACATGG - Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
981111964 4:140945410-140945432 GCCAAAAATGTTCCCAAATAAGG + Intronic
981285728 4:143016836-143016858 ACCAAAAAACTTCTCAGGCATGG + Intergenic
981546456 4:145899175-145899197 ATGACAAATGTTCCCATACAGGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984455747 4:179965924-179965946 AACAAAAATGTTCTCATAAAAGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985088876 4:186343305-186343327 CCCAAAATCCTTCCCAGACAAGG + Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
986640968 5:9871687-9871709 TCCAAAATGGTGCCCAGACAAGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988384187 5:30539861-30539883 ACCCAAAACATTCCCAGCCATGG + Intergenic
988634561 5:32969152-32969174 TACAAAGATGTTCCCTGACAGGG - Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989388143 5:40873360-40873382 ACCAAAAAATTAGCCAGACATGG + Intergenic
990507260 5:56456942-56456964 ACAAATAATGTTCTCAGAAATGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991073371 5:62511654-62511676 ATTTAAAATGTTCCCAGAAAGGG - Intronic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992354375 5:75965881-75965903 ACCAAAAATGCTCACATATAAGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995936462 5:117521589-117521611 AACTATAATGTTCCCAAACACGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999144552 5:149383658-149383680 ACCAACAATGTTCCCGTCCAGGG - Intronic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001209362 5:169795811-169795833 ACCCAAAATTCTCCCAGGCAGGG - Intronic
1002374871 5:178781445-178781467 AGCAAAAATGTTAACACACATGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1003346743 6:5276208-5276230 ACAATAAATCTTCCCAGACACGG - Intronic
1003763208 6:9205973-9205995 AACAAAAATTTTCACAGATAAGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005369011 6:25110534-25110556 CCCCAAAATGGTCCGAGACATGG - Intergenic
1006593429 6:35175099-35175121 ACCAAAAAAGTAGCCAGGCATGG + Intergenic
1006643768 6:35502480-35502502 AAAAAAAATGTTGCCAGCCATGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007182736 6:39942086-39942108 TCCAAAATGGTTCCCATACATGG - Intergenic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1008380292 6:50833545-50833567 AACAAAAACCTTCCCAGAGAGGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009500320 6:64404899-64404921 CCCATCAATGTTCCCACACATGG - Intronic
1011282258 6:85688870-85688892 ACCAAAAGAATACCCAGACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014195417 6:118552542-118552564 ACCAAACATGTTGCCTAACATGG + Intronic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1015657848 6:135540045-135540067 CACAAAACTGATCCCAGACAAGG - Intergenic
1016286797 6:142482816-142482838 AGAGAAAATGTTCCCAGAAAAGG - Intergenic
1016555469 6:145331335-145331357 GCCAAAAAGTTTCCCAGACAAGG - Intergenic
1017578915 6:155838781-155838803 ACAAAAAATGTTAGAAGACAGGG - Intergenic
1019548994 7:1592965-1592987 TCCGAAGATGTTCCCGGACAAGG - Intergenic
1019794678 7:3041069-3041091 ACCAAAAAATTAGCCAGACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020227372 7:6290835-6290857 GCCAAAAATGTTCCCAGCAGAGG + Intergenic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020517826 7:9146206-9146228 ACCAGAAATTCTCCCAGACATGG - Intergenic
1020814950 7:12893972-12893994 AGGAAAAAAGATCCCAGACATGG + Intergenic
1021253539 7:18360951-18360973 TACAAAACTGATCCCAGACAAGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022898281 7:34774849-34774871 ACCAAAAATATTCCTAGATGTGG + Intronic
1023142823 7:37119305-37119327 CCCTTCAATGTTCCCAGACATGG - Intronic
1023993318 7:45143628-45143650 ACCAAAGATGGTCCCTGTCAGGG - Intergenic
1024757202 7:52548768-52548790 AACAAAAATGTTACTAAACAAGG - Intergenic
1024880288 7:54077807-54077829 TCCAGAAATCTTCCCACACAAGG - Intergenic
1026101287 7:67386549-67386571 ACCAAACATGTTCCCACCGAAGG - Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1026389063 7:69881309-69881331 ATCAAAAATCTTCCCACACAAGG - Intronic
1026411319 7:70126126-70126148 ACCAAATATGTGGCCAGGCATGG + Intronic
1027520870 7:79205072-79205094 AGCAAAAAACTTCCCAAACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028409479 7:90512920-90512942 AACACAAATATTCCCAGAAAGGG - Intronic
1028898204 7:96065531-96065553 ACCAAAAATTTAGCCAGGCATGG - Intronic
1029329099 7:99836514-99836536 AACAAAATAGTTCCCAGAAAAGG - Exonic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031192832 7:118576598-118576620 ACTAACAATGTTCTCAGCCAGGG - Intergenic
1031351166 7:120732926-120732948 ACCAAAAATCTTCCCTGCTATGG - Exonic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032513024 7:132486944-132486966 TCCAAATCTGTTCCCCGACAGGG - Intronic
1032558376 7:132861514-132861536 TCCAACTATGTTCCAAGACATGG - Intronic
1032672141 7:134094433-134094455 ACCAAAAAATATCCCAGACCGGG + Intergenic
1033352166 7:140570431-140570453 AAAAAAAAAGTTCCCAGGCAGGG + Intronic
1034146416 7:148876880-148876902 ACCAAAAATGATCCCTGGCTGGG + Intronic
1034713696 7:153219739-153219761 AGCAAAATTGTTCCCACACAGGG - Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035415076 7:158676601-158676623 CCCAAATATGTTTCAAGACAGGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036570717 8:9977713-9977735 ACAAAAAAATTTCCCAGTCATGG - Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1039622197 8:39008324-39008346 ACCAAAAAATTAGCCAGACATGG - Intronic
1041710214 8:60887496-60887518 ACCAAAATTCTTCCCAGTGAAGG - Intergenic
1042144605 8:65715086-65715108 ACTAAAAATTTTCACACACATGG - Intronic
1043203818 8:77409908-77409930 ACAAAAAATGTTCTCAGAACTGG - Intergenic
1043550964 8:81372189-81372211 AATAAAAACCTTCCCAGACACGG - Intergenic
1044986869 8:97763544-97763566 AATAACAATGTTCCCAGAAAGGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046514289 8:115238570-115238592 ACCAACAAAGTACCAAGACAAGG + Intergenic
1047567680 8:126063320-126063342 ACCAAAAAAATTGCCAGGCATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050919000 9:11175353-11175375 AAAAAAAATGTTACCAAACATGG + Intergenic
1051838392 9:21366103-21366125 ACCAAAAATTTGGCCAGGCATGG - Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056589177 9:87951814-87951836 AGCCAAAGTGTTCCCAGGCAAGG + Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1057843268 9:98503001-98503023 ACCAAAAATGTTCACTGTCCTGG + Intronic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1059899515 9:118907602-118907624 GCCAAAAATTTTGACAGACAAGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061958776 9:133977470-133977492 ACACAGAATGTTGCCAGACAAGG + Intronic
1062329675 9:136032860-136032882 ACAAAAAAATTACCCAGACATGG + Intronic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188281120 X:28270863-28270885 ATCAAAAATGTTCCTAGATTAGG - Intergenic
1188544500 X:31288942-31288964 AGCAAAAATGTTGACAGAGAGGG - Intronic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1193716046 X:84935515-84935537 ATCAAAAACTTTCCCAGCCAGGG - Intergenic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1197880282 X:131159124-131159146 ACCAAAAATGATCCTAGAAGCGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199290791 X:146102846-146102868 ACCAAAAACGTAGCCAGAGAAGG - Intergenic
1199885637 X:152019250-152019272 ACCAAGTATGATCCAAGACAAGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic