ID: 1195766679

View in Genome Browser
Species Human (GRCh38)
Location X:108303528-108303550
Sequence ACAGATATGCAGAGTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195766678_1195766679 -1 Left 1195766678 X:108303506-108303528 CCAAAATTTGTGATTTGTGCACA 0: 1
1: 0
2: 1
3: 29
4: 217
Right 1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG 0: 1
1: 1
2: 2
3: 14
4: 271
1195766677_1195766679 0 Left 1195766677 X:108303505-108303527 CCCAAAATTTGTGATTTGTGCAC 0: 1
1: 0
2: 4
3: 21
4: 222
Right 1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG 0: 1
1: 1
2: 2
3: 14
4: 271
1195766676_1195766679 1 Left 1195766676 X:108303504-108303526 CCCCAAAATTTGTGATTTGTGCA 0: 1
1: 0
2: 2
3: 18
4: 260
Right 1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG 0: 1
1: 1
2: 2
3: 14
4: 271
1195766675_1195766679 2 Left 1195766675 X:108303503-108303525 CCCCCAAAATTTGTGATTTGTGC 0: 1
1: 1
2: 1
3: 26
4: 239
Right 1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG 0: 1
1: 1
2: 2
3: 14
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195766679 Original CRISPR ACAGATATGCAGAGTGAGCA TGG Intronic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
902134771 1:14295543-14295565 ACAGACATGCAGAGAGACCCAGG + Intergenic
902605492 1:17566839-17566861 AAAGATTTGCTGAATGAGCAAGG + Intronic
903252207 1:22063210-22063232 ACAGATTTTCAGAGTAAACATGG - Intronic
903321843 1:22548022-22548044 AGAGAGATGGAGAGAGAGCAGGG - Intergenic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905123391 1:35699858-35699880 ACAGAGACTTAGAGTGAGCAGGG - Intergenic
906325311 1:44842097-44842119 GCAGATATACAGGGTGAGAAGGG - Intronic
906685728 1:47761892-47761914 ACAGATGTGTAGAGAGAGAAAGG - Exonic
908522873 1:64961666-64961688 GCAGAGATACAGTGTGAGCAAGG - Intronic
909263451 1:73525913-73525935 ACAGATATGTAGAATAAACAAGG - Intergenic
910765135 1:90774557-90774579 ACATTCATGCAGAGTGAGAATGG + Intergenic
911540096 1:99147189-99147211 AGACAAATGCAGGGTGAGCAAGG - Intergenic
911860878 1:102946737-102946759 ACACATATGCAGAGAGAATACGG + Intronic
912164362 1:107024669-107024691 ACAGATGTGCAAAGTCAGCCAGG - Intergenic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912465748 1:109872489-109872511 ACTGATGTGCAGAGAGAACAAGG + Intergenic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
913080173 1:115377019-115377041 AAAGATATGTAGAGTTAGAAGGG - Intergenic
913201772 1:116500635-116500657 ACAGATATGCTGAGGAAGAAAGG - Intergenic
913386947 1:118268515-118268537 CCAGACATTCAGATTGAGCAAGG + Intergenic
916046624 1:161004868-161004890 ATAGATATGGAGGCTGAGCACGG + Intronic
917601326 1:176577275-176577297 GCAGATTTGCAGGGAGAGCATGG - Intronic
917717244 1:177750990-177751012 ACAGAGATTCAGAGAGATCAAGG + Intergenic
918077384 1:181180860-181180882 ACATATATGAAGAGTGGCCAGGG - Intergenic
920840084 1:209546725-209546747 ACAAACATGCAACGTGAGCAGGG + Intergenic
921063964 1:211609670-211609692 ACAGCTATGCAGAGAAGGCAGGG - Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
922050541 1:221985993-221986015 ATAAATATGCAAAGTGACCACGG + Intergenic
1067942922 10:50671024-50671046 ACAGTGATGCAGAATGACCAGGG + Intergenic
1068426160 10:56867125-56867147 ACGGACATGCAGTGTGAGCAAGG + Intergenic
1069529518 10:69206054-69206076 GGAGCTATGCAGAGAGAGCAGGG - Intronic
1070105420 10:73426459-73426481 ACAGGTTGGCAGAGTGAACATGG - Intronic
1070864164 10:79695990-79696012 ACAGTGATGCAGAATGACCAGGG + Intergenic
1070869806 10:79741282-79741304 TCACATATGCAGAATGAGCTTGG - Intergenic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1071631062 10:87218216-87218238 ACAGTGATGCAGAATGACCAGGG + Intergenic
1071636731 10:87263502-87263524 TCACATATGCAGAATGAGCTTGG - Intergenic
1071658518 10:87474452-87474474 TCACATATGCAGAATGAGCTTGG + Intergenic
1072033170 10:91540485-91540507 ACAGAGATTCAGAATGAGCCTGG + Intergenic
1072742421 10:97917481-97917503 ACAGGTATGCAGAGTGACATGGG - Exonic
1078856921 11:15213664-15213686 ACATATAGGCAGAGAAAGCAGGG - Intronic
1078918280 11:15801511-15801533 ACAGATATTCAGAGTGTTTAGGG + Intergenic
1079843897 11:25438863-25438885 ATAGATTTGCAGATTGAGGACGG - Intergenic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1082794036 11:57367307-57367329 CCAAATAAGCAGAGTGAGCTGGG + Intronic
1083514727 11:63246337-63246359 ACAGAGAAGCAGGGTGAACAGGG + Intronic
1085840410 11:80005248-80005270 ACAGCTATGCAGAATGAGAGAGG - Intergenic
1086853446 11:91838627-91838649 ACAGATGTGCTGTGGGAGCAGGG + Intergenic
1088213471 11:107481943-107481965 ACAAAGATGCAGACTGAGCCTGG + Intergenic
1088516502 11:110641046-110641068 TTAGATAAACAGAGTGAGCAAGG + Intronic
1088983803 11:114887942-114887964 ACAGATTAGCTGAGTGACCATGG + Intergenic
1088999844 11:115042689-115042711 ACAGATATGAAGTCTTAGCATGG - Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1090605094 11:128413632-128413654 ACAGATATACAGAGAGCCCATGG - Intergenic
1091100878 11:132872502-132872524 CCAGATATGCAGACTGGGCCAGG - Intronic
1091524757 12:1287916-1287938 ACATACATGGAGGGTGAGCATGG + Intronic
1091649452 12:2299078-2299100 TCACATAAGCAAAGTGAGCAGGG - Intronic
1091777693 12:3195284-3195306 ACAGAGAGGCAGAGAGAGCTTGG + Intronic
1091909109 12:4214523-4214545 AAAGAAATGGAGAGGGAGCAGGG + Intergenic
1093282599 12:17212578-17212600 ACAGATATCCAGAGAGAGAGAGG - Intergenic
1093705772 12:22273501-22273523 AGAAATTTGAAGAGTGAGCAAGG - Intronic
1093796019 12:23312114-23312136 ACAGCTATGTAGAGTTTGCATGG - Intergenic
1096648679 12:53051467-53051489 ACCTGTGTGCAGAGTGAGCAGGG - Intronic
1096672058 12:53205932-53205954 ACAGGCATGCAGAGCAAGCAGGG - Intronic
1096780938 12:53991735-53991757 ACAGATCAGCTGAGCGAGCAGGG - Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1100886526 12:99076997-99077019 ACAGATATGCTCAGTGCTCAGGG - Intronic
1101591456 12:106129003-106129025 TCAGCTCTGCAGAGTGTGCAAGG - Intronic
1103003983 12:117407268-117407290 ACAGAAAAGCAGAATGATCAGGG - Intronic
1103033978 12:117641521-117641543 ACAGAGATGCACAGGGAGAAAGG - Intronic
1104917009 12:132270904-132270926 GCAGAGATTCAGAGAGAGCAAGG + Intronic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105509260 13:21037781-21037803 AGAGACAGGCAGAGTGGGCAGGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106638371 13:31556323-31556345 TCAGACATGCAGACTGAGCAAGG - Intergenic
1111911711 13:94320629-94320651 TCAGATTTGCAGGGTGGGCAAGG - Intronic
1116866023 14:50032328-50032350 ACAGATGCACAGAGAGAGCAGGG + Intergenic
1117793042 14:59361396-59361418 CCAGATAAGCAGAGTGATTACGG + Intronic
1119292138 14:73503921-73503943 AAAGACATGCAGAGCTAGCAGGG - Intronic
1121954176 14:98198957-98198979 GCAGATGTGCAAAGTGAGGATGG + Intergenic
1121963934 14:98287253-98287275 ACAGATATTCAGTGTGTGTAAGG + Intergenic
1122174981 14:99910082-99910104 ACAGAAATGCAAGGTGTGCAGGG + Intronic
1125579131 15:40773492-40773514 CCAGATATGGAGAGAAAGCAAGG + Intronic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1127292585 15:57583447-57583469 ACAAATATGCTGAGACAGCAGGG + Intergenic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1128184314 15:65631508-65631530 AGAGATCTGCAGAATGAGAAGGG + Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128806394 15:70534193-70534215 AGAGATATTCACAATGAGCATGG + Intergenic
1129270399 15:74416565-74416587 CCAGTTGTGCAGGGTGAGCAGGG - Exonic
1130759229 15:86800547-86800569 CCAGTTATGCAAAGTGAGAAAGG - Intronic
1131718200 15:95136749-95136771 AAAGATGTGAAGAGTGAGAAAGG + Intergenic
1131732055 15:95292461-95292483 ACATATATTCAGAGAAAGCATGG + Intergenic
1132519533 16:381086-381108 ACAGAAATGCAAAGGGAGCCCGG + Intronic
1133617198 16:7488288-7488310 AGAAAAATGCAGAGTGAGAAAGG - Intronic
1134812751 16:17181304-17181326 ACAGAAATGCAGATTGGGCAGGG - Intronic
1137783985 16:51122439-51122461 TCAAATATACAGAGCGAGCATGG + Intergenic
1139322596 16:66127541-66127563 GCAAAGATGCAGAGAGAGCAGGG - Intergenic
1140125834 16:72118341-72118363 CCAGAAATGCAGTGTGAGCTAGG - Intronic
1140186435 16:72776794-72776816 ACAGATAAGTATAGTGAGAAAGG + Intergenic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1141542570 16:84737297-84737319 AGACAAATGCAAAGTGAGCAAGG - Intronic
1144736573 17:17558987-17559009 GCAGGGATGCAGAGAGAGCAGGG - Intronic
1146647634 17:34585566-34585588 ACAAACTTGCAGAGTGAGCTTGG - Intronic
1147570824 17:41569795-41569817 GCAGAAATGCAGAGACAGCAGGG - Intronic
1148726395 17:49794162-49794184 ACAGATATGAAAATTGATCATGG + Intronic
1148778441 17:50108790-50108812 ACACAGAAGCTGAGTGAGCAGGG - Intronic
1150468396 17:65415020-65415042 ACAGACAAGCTGGGTGAGCATGG + Intergenic
1150930433 17:69578986-69579008 ACAGACATGAAGAATGGGCAAGG - Intergenic
1151023902 17:70654805-70654827 ACAGATGTGCAGAGAGAGAAAGG - Intergenic
1151775797 17:76200912-76200934 ACAGAAAACCAGAGTAAGCATGG - Intronic
1152499465 17:80698216-80698238 CCAGGTAGGCCGAGTGAGCAGGG + Intronic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1154502363 18:15003199-15003221 ACAGACATGCAGAGTGAAACAGG + Intergenic
1156419400 18:36934203-36934225 ACAGATACCAAGAGTGAGGAGGG - Intronic
1156731803 18:40203410-40203432 ACTGATATCCAGAGAGGGCAAGG + Intergenic
1157393908 18:47326053-47326075 AGAGAGATGGAGAGGGAGCAGGG + Intergenic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1158733448 18:60052575-60052597 ACAGATATGGAGAATCACCAGGG - Intergenic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1165105498 19:33467485-33467507 AAAGATGTGTAGAGAGAGCAGGG + Intronic
1167791962 19:51688802-51688824 ACAGATGTGCAGAGACAGAAGGG + Intergenic
1202664623 1_KI270708v1_random:106737-106759 ACAGATAGGCAATGTAAGCAGGG - Intergenic
925258992 2:2513160-2513182 ACTGCTATGCTGAGGGAGCACGG - Intergenic
925276722 2:2655115-2655137 AAAGAAATGGAGAGTGATCAAGG + Intergenic
925923079 2:8650996-8651018 ACACAGATGCAGTGGGAGCACGG + Intergenic
926300160 2:11596547-11596569 ACAGGTGTGCACAGTGAGAAGGG + Intronic
926827609 2:16922935-16922957 ACACACATACAGAATGAGCAGGG - Intergenic
928807606 2:35179489-35179511 ACAGATATGCTGAGAGCGAATGG - Intergenic
930000962 2:46861228-46861250 ACAGAGATGGAGAGGGAGAAGGG - Intergenic
932072608 2:68636136-68636158 GTAGATATGCATTGTGAGCATGG + Intergenic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
932918827 2:75886212-75886234 ACAGATTGGCAGAGTTATCAGGG + Intergenic
934742794 2:96737968-96737990 CCAGATATGCAAAGTAAACAGGG - Exonic
937448338 2:121977234-121977256 ACAGAAAAGCAGAGTGGGTAAGG - Intergenic
937485429 2:122310353-122310375 TCATATATGAAGAGTGAGCTGGG - Intergenic
937485964 2:122314973-122314995 TCACATATGAAGAGTGAGCTGGG + Intergenic
938083258 2:128381373-128381395 GCAGGAATGCAGAGTGAGCAGGG + Intergenic
939014434 2:136885889-136885911 AGGGATATGCAGTGGGAGCAGGG + Intronic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
944573959 2:201073300-201073322 ACAAATATGGATAATGAGCAAGG - Intronic
945114482 2:206397859-206397881 AGAAATAGGCAGAGTGAGGAGGG + Intergenic
945432879 2:209785368-209785390 ATAGATAAACTGAGTGAGCATGG + Intronic
948252027 2:236537015-236537037 ACAGAAACTCAGAGAGAGCAAGG + Intergenic
948411678 2:237767617-237767639 ACAAATATGGAAAGTGATCAGGG - Intronic
948655060 2:239471386-239471408 ACACATATGGAGAGAGAGAAAGG + Intergenic
1169720624 20:8672578-8672600 CCAGATATGCATACCGAGCAGGG + Intronic
1170896092 20:20415841-20415863 ACAGCTCTGCAGATTCAGCAGGG - Intronic
1171972759 20:31574521-31574543 AAAAAAATGCAAAGTGAGCAGGG - Intronic
1172778919 20:37424205-37424227 AGAGAGATGGAGAGAGAGCAGGG + Intergenic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1175019863 20:55834242-55834264 ACACATATGGAGACTCAGCAGGG - Intergenic
1177347660 21:19894371-19894393 ACAGAGAGACAGAGAGAGCATGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178459093 21:32784994-32785016 ACAGGTATGCAATGTGATCATGG + Intergenic
1178572668 21:33754712-33754734 ACACATAAGCAGAGTGGGAATGG - Intronic
1179217431 21:39379701-39379723 AAATGTATGCAAAGTGAGCAGGG - Intergenic
1179517893 21:41921902-41921924 AGAAATGTGAAGAGTGAGCATGG - Intronic
1179563109 21:42229154-42229176 AGAGAAATGCAGAGTGAGGCTGG - Intronic
1179903025 21:44404462-44404484 ACACAGGTGCTGAGTGAGCAGGG + Intronic
1180625336 22:17190352-17190374 ACAGAGATGCAGGGAGAGCTGGG - Intronic
1184479239 22:44737375-44737397 ACAGAAATACAAAGTGACCAAGG - Exonic
950772546 3:15323808-15323830 ACAGCTATGAAGAGGGAGCTGGG + Intronic
951027406 3:17844588-17844610 ACAGATAAGCACAGTGTACAGGG + Intronic
951314342 3:21170087-21170109 ACAATTATGGACAGTGAGCATGG + Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
953494379 3:43373542-43373564 CCAGATGTGCAGAGAAAGCAGGG - Intronic
954137968 3:48590888-48590910 ACAGGGACGCAGAGTGAGAAGGG + Intronic
954540214 3:51388665-51388687 ACAGATATGCAGCGTGAACAAGG - Intronic
954683294 3:52357571-52357593 ACAGAAATGGGCAGTGAGCATGG - Intronic
955757064 3:62235852-62235874 ACAGATATGAGGAGAGAGAAAGG - Intronic
955863984 3:63362161-63362183 TCAGAGACACAGAGTGAGCATGG - Intronic
956573751 3:70727594-70727616 ACAGATTTGCTGTGAGAGCAGGG - Intergenic
956576849 3:70761307-70761329 ACAGGCAAGCAGAGTGAGAAGGG + Intergenic
956593951 3:70946296-70946318 ACAGCTAAGCAGAGCGAGCGGGG - Intergenic
957549690 3:81687732-81687754 ACAGATTTACAAGGTGAGCACGG + Intronic
958566677 3:95821233-95821255 GGAGAGATGCAGAGTGAACAGGG + Intergenic
960710540 3:120523132-120523154 AAAGATAGGCAGAGAGATCAGGG + Intergenic
962401210 3:135060299-135060321 ACACATATGCTAAGTGAACAAGG - Intronic
962827484 3:139110572-139110594 ACAGGTATGAAGAATGGGCAGGG + Intronic
964637865 3:158877480-158877502 GGAGATATGCAGATGGAGCAAGG - Intergenic
965868433 3:173235608-173235630 ACAGATATGCAATGTGGGCTGGG - Intergenic
967860408 3:194147288-194147310 ACAAGTATCCAGAGAGAGCAGGG - Intergenic
968064902 3:195753225-195753247 CCAGAGCTGCAGAGTGAGTAGGG + Exonic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
969891636 4:10265192-10265214 ACACATCTGCAGAAAGAGCAAGG - Intergenic
970237019 4:13969203-13969225 ACAGGTTTGCAGAGTAAGAATGG + Intergenic
971068318 4:23060376-23060398 ACAGATCTGCACACTGAGAATGG - Intergenic
971330641 4:25678448-25678470 ACATATATACAGAGTGGGCGGGG - Exonic
973962035 4:56120437-56120459 ACAAATATGCTGAGAAAGCATGG + Intergenic
974815495 4:66998448-66998470 AAAGATGTACAGAGTGAGAAGGG + Intergenic
975808194 4:78135453-78135475 ACTGATCTGCAGAGAAAGCATGG + Intronic
976657695 4:87506523-87506545 ACAGATAGGCAGAGAGAGAGAGG - Intronic
977748089 4:100575593-100575615 ACATATATGTCAAGTGAGCAGGG - Intronic
978405697 4:108376590-108376612 GCAGCTACGCAGACTGAGCAAGG - Intergenic
979710702 4:123775935-123775957 ATATATTTGCAGAGTGAGAATGG - Intergenic
980424186 4:132605067-132605089 ACACATTTGCAGAGTTAGAAAGG - Intergenic
980569849 4:134600440-134600462 ACAGATTTGCAGAGTGAGCAGGG + Intergenic
983826885 4:172273620-172273642 ACAGATAGGTAGAGTTAGCTAGG + Intronic
983939186 4:173523455-173523477 ACAGATTTGCAGAGAGAACCCGG - Intergenic
986000478 5:3627209-3627231 AGACATATGCAGAGTAAGAAAGG + Intergenic
988352141 5:30122631-30122653 ACATATATGCAGAGAGAGCAAGG - Intergenic
989080152 5:37609998-37610020 ACAGATATATAGATTGGGCACGG + Intronic
990513468 5:56510587-56510609 AAAGGGATGCAGAATGAGCAAGG - Intergenic
991214613 5:64148206-64148228 ACAGATAGGAAGAGAGAGAAAGG + Intergenic
993158723 5:84260776-84260798 ACAGAAATGGAGAGAGGGCAGGG - Intronic
994186092 5:96816850-96816872 ACAGACATGGAGGGTGAGTAGGG - Intronic
995926775 5:117384406-117384428 CCACATATGCAGAGTGAGCCAGG - Intergenic
997090706 5:130853926-130853948 AAAGATAAGCAAAGTAAGCATGG + Intergenic
998481880 5:142469741-142469763 ACACAAAAGCAGAGTGAGAAAGG - Intergenic
998800788 5:145866731-145866753 AGAGAAATGGAGAATGAGCATGG + Intronic
1000015183 5:157269433-157269455 ACAGAGCAGCACAGTGAGCATGG + Intronic
1000094824 5:157962476-157962498 ACAGATATGCAGTTTGAACTGGG + Intergenic
1001123018 5:168995722-168995744 ACAGGGAAGCAGAGGGAGCAGGG - Intronic
1001763582 5:174227020-174227042 ACCGATAGGCTGAATGAGCATGG + Intronic
1001867014 5:175114537-175114559 ATAGAGATGCAGAGTGTGAATGG - Intergenic
1004863766 6:19834205-19834227 ACAAATCTACAGAGTGACCAAGG + Intergenic
1006397595 6:33797196-33797218 ACTGACATCCAGAGAGAGCAGGG - Intronic
1009421067 6:63465470-63465492 ATAGATGTGCAGGCTGAGCATGG - Intergenic
1011580534 6:88859145-88859167 ACAGATTTTCAGACTGAGTACGG - Intronic
1011670586 6:89679599-89679621 ACACAGATGAAGAGTGACCACGG + Intronic
1012100863 6:95084270-95084292 TGAGGTATGCAGAATGAGCAAGG - Intergenic
1012271304 6:97215538-97215560 ACAGATGAGCTCAGTGAGCAGGG - Intronic
1012791482 6:103703602-103703624 ACAAATATGTAAAGTGGGCAAGG + Intergenic
1013404816 6:109833337-109833359 ACAGATATGAAGATGGAGAAAGG + Intergenic
1014678704 6:124400824-124400846 ACTGATTAGGAGAGTGAGCATGG - Intronic
1015305302 6:131700535-131700557 ACAGATAAGGGGATTGAGCATGG + Exonic
1017241162 6:152170701-152170723 ACACATATGCAGTGCAAGCAAGG - Intronic
1018151797 6:160946581-160946603 ACAGGTATGCTGGGGGAGCAGGG - Intergenic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1021789752 7:24192959-24192981 ACAGTCATACAGAGTGTGCAGGG - Intergenic
1022297144 7:29066863-29066885 ACAGAGAGGCAGATTGAGCCAGG + Intronic
1022596304 7:31716372-31716394 ACAAATATGCAGAGAGAGGGAGG + Intergenic
1022869831 7:34464615-34464637 AGAAATATGCAGACTGAGCCTGG - Intergenic
1024551247 7:50564241-50564263 CCAGATAAGCACAGGGAGCAAGG + Intronic
1024930179 7:54660913-54660935 ACAGGCAGGCAGAGAGAGCAGGG + Intergenic
1025988486 7:66476182-66476204 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1026004245 7:66588435-66588457 ACAGAGATGCAGAGGGAGTCTGG + Intergenic
1026026995 7:66753556-66753578 ACAGAGATGCAGAGAGACCCTGG - Intronic
1027211464 7:76152031-76152053 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1027359569 7:77394151-77394173 AGAGATACGCATACTGAGCAGGG - Intronic
1028716499 7:93977299-93977321 ATACATATGCAGAATTAGCAGGG + Intronic
1032264042 7:130358287-130358309 ACACATATGCAGGTTGGGCATGG - Intronic
1032492376 7:132333296-132333318 ACAGGTATGCAGAGTAATAATGG + Intronic
1033545130 7:142392700-142392722 ACAGATCTCCGGAGTGAGGAGGG - Intergenic
1033739413 7:144258762-144258784 ACAGATAAGGGGATTGAGCATGG + Exonic
1035321869 7:158035019-158035041 AAAGAAATGGAGAGTGAGCCTGG - Intronic
1036451109 8:8868514-8868536 ACAGATATGCACAGTAGGCCTGG + Intronic
1038650536 8:29399054-29399076 ACCGATATAAAGAGAGAGCAAGG - Intergenic
1038905058 8:31891870-31891892 AGAAATATGCTGAGTGAGAAAGG + Intronic
1040907701 8:52485915-52485937 ATACAAATGCACAGTGAGCAAGG - Intergenic
1041313529 8:56539647-56539669 ACACACATGCAGAGAGAGAAAGG + Intergenic
1041715004 8:60924494-60924516 ACAGATAGCCAGACTGAGCTAGG - Intergenic
1042883772 8:73524424-73524446 ACGGATATGCAAAATGATCAGGG - Intronic
1045810438 8:106214939-106214961 ATAGACATGCAGAAAGAGCAGGG + Intergenic
1046183355 8:110681814-110681836 AGAGCTCTGGAGAGTGAGCAAGG - Intergenic
1051828835 9:21252937-21252959 ACAGCTATGTAGAGAGAGAAAGG - Intergenic
1052641086 9:31166492-31166514 GGAGATGTGAAGAGTGAGCAAGG + Intergenic
1053474496 9:38372344-38372366 ACAGAGAGGCAGGGTGGGCACGG + Intergenic
1055568733 9:77594854-77594876 ACAGGTGTTTAGAGTGAGCATGG - Intronic
1056555913 9:87686861-87686883 ACTGATATTCAGAGTGAGCCAGG + Intronic
1056564826 9:87761869-87761891 GCAGATGTGAAGAGAGAGCACGG + Intergenic
1057319038 9:93995228-93995250 GCAGATGTGCAGAGGGATCAGGG + Intergenic
1058514812 9:105759955-105759977 ACAGCTATGCAAAGTGAACTCGG + Intronic
1058565720 9:106283043-106283065 AAAGGAATGCAGAGTGTGCAGGG + Intergenic
1058610520 9:106770925-106770947 ACAGAAATGTAGTGTGAGCCAGG - Intergenic
1059156918 9:111998205-111998227 ACAGAAATGCAGCAAGAGCAGGG + Intergenic
1059890158 9:118792982-118793004 ACAGAAATGCAGAGAAAGAAGGG - Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060039701 9:120289308-120289330 ACAGCTTTGCATATTGAGCAGGG - Intergenic
1060986175 9:127820153-127820175 ACAAAAATGAAGAGGGAGCAGGG - Intronic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1187738925 X:22334087-22334109 ACAGAGAGGCAGAGAGAGCCAGG + Intergenic
1190380341 X:49834608-49834630 ACATATATTCATGGTGAGCATGG - Intergenic
1193536537 X:82723409-82723431 ACAGATCTGGAGAATGAACAAGG - Intergenic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1196488138 X:116237944-116237966 ACAGATGTCAAGAGTGTGCAAGG + Intergenic
1198075170 X:133187201-133187223 ACAGATATCTAGAATGAGAAGGG + Intergenic
1198811890 X:140544227-140544249 ACACATGTGCAGCCTGAGCAGGG + Intergenic
1200219185 X:154382670-154382692 ACATATATGTAGACTGGGCACGG - Intergenic
1200281346 X:154779597-154779619 ATAGCTATGCAGAGACAGCATGG + Intronic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic
1200887974 Y:8290578-8290600 ACAGATATGCACAGTAATCAAGG + Intergenic