ID: 1195768279

View in Genome Browser
Species Human (GRCh38)
Location X:108319785-108319807
Sequence CTGTAGCCAGAGAGGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195768267_1195768279 26 Left 1195768267 X:108319736-108319758 CCAGGATAGCCAATTATCTAAAG 0: 1
1: 0
2: 2
3: 8
4: 177
Right 1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG 0: 1
1: 0
2: 1
3: 22
4: 222
1195768271_1195768279 17 Left 1195768271 X:108319745-108319767 CCAATTATCTAAAGGGGTATTGG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG 0: 1
1: 0
2: 1
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195768279 Original CRISPR CTGTAGCCAGAGAGGGACAT GGG Intronic
900534654 1:3170857-3170879 CTGCAGACAGAGAAGGCCATGGG - Intronic
901633142 1:10657606-10657628 CTGAAGACAGAGTGGGACAGGGG + Intronic
901844592 1:11973871-11973893 CTGTGGCCTGCAAGGGACATTGG + Intronic
907406116 1:54254474-54254496 CTCTAGCCAGGGAGGCAGATGGG + Intronic
907731677 1:57072605-57072627 CTGTGACCAGAGAGAAACATAGG + Intronic
908285238 1:62590635-62590657 CTGCAGCCAGACAAGGACCTGGG + Intronic
909603933 1:77489838-77489860 CTGGAGCCAAAGATTGACATGGG - Intronic
911175690 1:94815619-94815641 CTGGAGCAGGAGAGAGACATGGG - Intergenic
912182471 1:107235787-107235809 CTGCAGCCAGGGAAGGATATTGG + Intronic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912800507 1:112716922-112716944 CTTTAGGCAGAGAGAGACAGAGG + Intergenic
914254157 1:145947329-145947351 CTGAAGCCAGATTGGAACATGGG + Intronic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
918661120 1:187090271-187090293 CTGAAGCCATAGAGGGAGAGAGG + Intergenic
918852386 1:189708775-189708797 CTGTAGCCAGACAGGAACCCTGG - Intergenic
920533204 1:206720086-206720108 CTGGAGCCAGAGAGGGACACAGG - Intronic
922240990 1:223755457-223755479 CTGCAGCCAGAAAGGGGCAGAGG - Intronic
924909321 1:248493068-248493090 CCAAAGCCAGAGAAGGACATGGG + Intergenic
924914783 1:248554993-248555015 CCAAAGCCAGAGAAGGACATGGG - Intergenic
1064722571 10:18244910-18244932 TTGGAGTCAGAGAGGGAGATAGG + Intronic
1068881702 10:62056186-62056208 CTGTAGGCAGACAGGGAACTTGG - Intronic
1069317277 10:67121835-67121857 CTGTTGCCAAACAGGGATATAGG + Intronic
1069639962 10:69948310-69948332 CTGTTGCCAGATAGGAGCATAGG - Intronic
1072236619 10:93459248-93459270 CTGTAACCAGAGAGGAGGATTGG - Intronic
1073608709 10:104922090-104922112 TTGTATCCAGAGAGCGACATTGG - Intronic
1073635023 10:105189025-105189047 ATGTAGCCAGAGTGGGTCACTGG + Intronic
1075316528 10:121457901-121457923 CTGAAACCAGAGAGGGAAACTGG + Intergenic
1075557990 10:123447239-123447261 CTGTAGCCAGGGAGAGTCAGTGG + Intergenic
1077221827 11:1421311-1421333 CTGCAGCCAGAGATGGGCAAGGG - Intronic
1077366286 11:2162608-2162630 CTGAGGCCAGGGTGGGACATAGG - Intergenic
1077634266 11:3831287-3831309 CTGTAGCCTGGGAGGGAGGTGGG - Intronic
1077981330 11:7303433-7303455 TTGTTGCCAGAGAGGGGAATGGG - Intronic
1078484215 11:11706771-11706793 CAGGAGCCAGTGAGGGAAATAGG + Intergenic
1078537193 11:12184773-12184795 CTGAAGCTAGACAGGGGCATTGG - Intronic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1084150779 11:67287007-67287029 CTGAAGCCAGAGATGGCCAAGGG - Intergenic
1084372304 11:68751694-68751716 CTGTTGCCAGAGCGGGTCAGGGG + Intergenic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084455329 11:69264959-69264981 ATGGGGCCAGTGAGGGACATGGG - Intergenic
1085761325 11:79243863-79243885 CTGTAGGCACCGCGGGACATGGG - Intronic
1088264172 11:107973957-107973979 CTCTACCCAGAGAGGATCATTGG - Intergenic
1089278083 11:117353110-117353132 CTGAAGAGAGGGAGGGACATAGG + Intronic
1094117686 12:26935326-26935348 CTCTAGCCAAAAAGGAACATGGG - Intronic
1094158864 12:27368619-27368641 CTGGAGTCAGAAAGAGACATAGG + Intronic
1094201063 12:27794848-27794870 GAGTCACCAGAGAGGGACATTGG - Intronic
1095485500 12:42680216-42680238 CTGTAGCCAGAGTGGTAAATGGG + Intergenic
1096426609 12:51509452-51509474 AGGCAGCCAGAGAGGGACAAGGG - Exonic
1099551014 12:84043471-84043493 CTGTAGCCAGACAGCCTCATTGG - Intergenic
1100981704 12:100167239-100167261 CTATAGCCAGAGTTGGTCATGGG - Intergenic
1102571376 12:113828959-113828981 CTGTATCAATAAAGGGACATTGG - Intronic
1102596242 12:113994630-113994652 CAGAAGCCAGAGAGAGGCATGGG + Intergenic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1103448182 12:121008567-121008589 CTGAAGCCAGAGAGTCACAAAGG + Intronic
1104428984 12:128701210-128701232 CAGAAGCCAGAGAGTGACCTTGG + Intronic
1104696351 12:130866973-130866995 CTGTAGCCAGGGAGGTACTATGG - Intergenic
1105576690 13:21659898-21659920 CTGGACTCAGAGAGGGAGATGGG + Intergenic
1106294311 13:28396356-28396378 CTGTACCCATTGAGGGACATAGG + Intronic
1107621347 13:42233638-42233660 TTGTAGCCAGTGTGGGACACAGG + Intronic
1108058560 13:46509670-46509692 ATGGAGCAAGAGAGGGAGATGGG - Intergenic
1108291485 13:48966218-48966240 TTGTAGCCAGGGAGAGAGATTGG + Intergenic
1112873867 13:104011335-104011357 CTATAGATAGATAGGGACATAGG + Intergenic
1113607056 13:111616330-111616352 CTGGAGCCAGGAAGAGACATGGG + Intronic
1115803219 14:37019747-37019769 CTGAGGCTAGAAAGGGACATTGG + Intronic
1118348772 14:64958878-64958900 TTCTAGCCAGAAAGGGACACAGG - Intronic
1118393946 14:65319659-65319681 CTGTGCCCAGACAGGAACATAGG + Intergenic
1118880321 14:69820045-69820067 CGGTAGGCAGAGCTGGACATGGG + Intergenic
1119083622 14:71720235-71720257 ATGTAGCGAGAGAAGGAGATCGG - Intronic
1120227022 14:81802076-81802098 CTGAATCCAGTCAGGGACATGGG + Intergenic
1121257852 14:92544369-92544391 CAGAAGCCAGAGAAGGTCATTGG - Intronic
1122362898 14:101177886-101177908 CTGAGGCCAGAGAGGGGCAGGGG + Intergenic
1124580173 15:30946385-30946407 CTGAAGCCTGAGTGGAACATGGG + Intronic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1128381920 15:67119473-67119495 TGGGAGCCAGAGAGGGACCTGGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128648537 15:69394350-69394372 CTATAGCCAGTTAGGGGCATGGG + Intronic
1131440871 15:92458702-92458724 CTGGAGCCAGGGAAGGACACTGG + Intronic
1131980824 15:97992965-97992987 ATGTAACCAGAGTGGGAGATAGG + Intergenic
1132106982 15:99070084-99070106 CTGTAGCCACACATGAACATGGG - Intergenic
1132684314 16:1155948-1155970 TGGTAGCCCGAGAGGGACTTGGG + Intronic
1132925537 16:2427463-2427485 GTGGAGGCAGAGAGGGGCATGGG - Intergenic
1133453548 16:5923145-5923167 CTGTAACCAGAGAGGAAAAACGG + Intergenic
1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG + Intronic
1136402667 16:30027065-30027087 CTGCAGAGAGAGAGGAACATGGG - Intronic
1136514385 16:30759177-30759199 CTGTGGCCAGAGAGTGAGACGGG - Exonic
1137551417 16:49440156-49440178 CTGTAGGGAGAGAGGGACTCAGG - Intergenic
1137693862 16:50448309-50448331 CTGCAGCCTGAAAGGGACAGCGG - Intergenic
1137962585 16:52897920-52897942 CTGTAGCCAGAGAAAGCCCTTGG - Intergenic
1138100286 16:54246699-54246721 CTGGAGGCAGAGTGGGCCATGGG + Intronic
1138746408 16:59367785-59367807 CTGTCGCAAGAGAGAGGCATCGG - Intergenic
1140094591 16:71864042-71864064 CAGGAGCCAGAGAGAGACAAAGG + Intronic
1140481262 16:75264130-75264152 CTGTAACAAGAGAGGAACAGCGG - Intronic
1141728998 16:85809453-85809475 CTGTAGCCAGGAAGGGAAAGGGG + Intergenic
1141767137 16:86066103-86066125 CTGGAGCGAGGAAGGGACATGGG - Intergenic
1142159507 16:88549798-88549820 CTGAAGCCTGGGAGGGACAAAGG + Intergenic
1143181491 17:4986954-4986976 CTGGAGCCAGAGCGGTAGATGGG - Exonic
1144555546 17:16279634-16279656 CTGGAGCAAGAGAAGGACAATGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144668639 17:17118859-17118881 CTGCAGCCCCAGAGGGACTTTGG + Intronic
1145736035 17:27232277-27232299 CTGTAGCCACAGCGTGACCTTGG - Intergenic
1149066861 17:52490769-52490791 CTGTAGCTAGAGGGGGTCATAGG + Intergenic
1149169552 17:53792778-53792800 CTGTGGCCAGAGTGGGACAGTGG + Intergenic
1151579655 17:74971035-74971057 CTGTAGCCAGGGAAAGACAGAGG + Intronic
1151952808 17:77364564-77364586 ATGTAGCCAGAGATGGTCAGTGG + Intronic
1152594889 17:81233264-81233286 CAGCAGCCAGAGAGAGACAGTGG + Intronic
1152611744 17:81318247-81318269 CTTTAGCAAGGGAGGGAGATGGG - Intronic
1152786148 17:82249087-82249109 CTGTGGCCAGAGAGGACCCTGGG + Intronic
1152814779 17:82401061-82401083 CTGCAGCCCGAGAGGGAGAGAGG + Intronic
1153867006 18:9279887-9279909 CTATAACCAGACAGGTACATTGG - Intronic
1156809854 18:41234552-41234574 CTAGAGGCAGTGAGGGACATTGG + Intergenic
1159312406 18:66726209-66726231 CTGCAGCCAGAAAGAGAAATAGG + Intergenic
1161636736 19:5393882-5393904 GGGTAGCCAGAGGGGGAGATGGG - Intergenic
1162446792 19:10728307-10728329 CTGAGGCCAGAGAGGGAGACTGG + Intronic
1163602984 19:18259813-18259835 CTGAAGCCAGAGAGGGGCTGGGG + Intronic
1164983292 19:32630246-32630268 CTGGAGCCAGAGTGGGTCCTGGG - Intronic
1165426299 19:35747571-35747593 GTGTAGCCTGAAAGGGACATAGG - Intronic
1167467193 19:49656546-49656568 CTCTAGCCAGAGAGCCACGTGGG - Intronic
1167699505 19:51034140-51034162 CTGGAGACAGACAGGGGCATGGG + Intronic
926436758 2:12846044-12846066 CCATTGCCAGATAGGGACATTGG - Intergenic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
928411838 2:31060394-31060416 CTGTGGCAGGAGTGGGACATTGG - Intronic
928456602 2:31428289-31428311 CTGTAAACAGAAAGTGACATAGG - Intergenic
931292295 2:60883308-60883330 CTGTAGGCAGAAAAGGAAATTGG + Intronic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
935078515 2:99769974-99769996 CTGTAGCCAGGGAGTGGCCTTGG - Intronic
937485252 2:122308790-122308812 CGGGAGCCAGAGAGGAGCATGGG - Intergenic
938319541 2:130354014-130354036 CTGTGGCCAGAGAGACACCTGGG + Intergenic
940067821 2:149649443-149649465 ATGTTGCCAGAGTGGGAGATGGG + Intergenic
940089233 2:149897306-149897328 CTATAGCCTGAGAGGGGCCTGGG - Intergenic
944867784 2:203879548-203879570 CTGTAACCAGAGAGGAAAACAGG + Intergenic
945805145 2:214481112-214481134 AGGTAGACAGAGAAGGACATTGG - Intronic
945877286 2:215291712-215291734 GTGTAGCTAGAGAGGAAAATAGG - Intergenic
948838160 2:240636267-240636289 CTGAAGGCAGAGGGGGACAGAGG - Intergenic
1170166489 20:13364874-13364896 CTGTAGCCAGAGTGGCAAACAGG - Intergenic
1172484729 20:35291350-35291372 CTGAGGCCAGAGAGGGGCTTGGG - Intronic
1173847712 20:46198558-46198580 CTGGAGCCTGAGAGGGAAACGGG - Intronic
1174846390 20:53947596-53947618 CTGTAGCCTGAGAGCGACAGTGG - Intronic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1183341099 22:37282316-37282338 CTTTTGCCAGGGAGGGACAGAGG - Intronic
1184172597 22:42768749-42768771 CTGCAGCCAGAGAGGGGCACAGG + Intergenic
1184403902 22:44289270-44289292 TTGAAGTCAGAGAGGGACCTGGG - Intronic
1184675478 22:46040460-46040482 CTGTAGCAGGCCAGGGACATGGG + Intergenic
1184912988 22:47548445-47548467 CTGTTGGCAGAAAGGGACAGGGG + Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949646197 3:6097513-6097535 CTGAAGACAGAGAGAGACAGAGG - Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
950211267 3:11125335-11125357 CTGTGGCCAGTGACTGACATGGG - Intergenic
950329213 3:12143031-12143053 CTGTAGGTAGAGAGGGTAATGGG + Intronic
952195071 3:31066901-31066923 CTGTAGCCATAATGGTACATGGG + Intergenic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
953971049 3:47347250-47347272 CTGTCTCTAGAGAGGGACTTAGG - Intergenic
954714897 3:52522086-52522108 CTGTAGCCAGGTAGGAACAATGG + Exonic
955983193 3:64547489-64547511 CTATAGCCAGGGAGAGAGATAGG - Intronic
956456403 3:69425022-69425044 CTGCAGCCAGACAGTGACTTAGG + Intronic
956594908 3:70956681-70956703 CAGTAGCCAGACAGGGTCATGGG - Intronic
958083126 3:88772347-88772369 TTGAAGCCAGGGAGGGACATGGG + Intergenic
958550478 3:95606485-95606507 GTGTTGCCAGAGAGGCACAGTGG - Intergenic
959971337 3:112413588-112413610 CTGTAGTTAGACAGGGACACTGG + Intergenic
960846319 3:122007345-122007367 CAGCAGCCTCAGAGGGACATAGG + Intronic
962343652 3:134604812-134604834 CTGTGTCCAGAGAGGGTCATGGG + Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962463642 3:135637518-135637540 CTGTAGCCATAGCAGGACAAGGG - Intergenic
965856854 3:173099849-173099871 CTGAAGCTAGAGAGGGGCGTAGG - Intronic
966884723 3:184370648-184370670 GTGAAGGGAGAGAGGGACATGGG + Intronic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
975758450 4:77594621-77594643 CTGATGCCAGTGAGGGCCATGGG + Intronic
977724771 4:100283321-100283343 CTATGGCCAGAGCTGGACATGGG + Intergenic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978285334 4:107071679-107071701 CTGAAGCCAGAGAGGTAAGTGGG - Intronic
984594083 4:181647835-181647857 CTGAAGAGAGAGAGGGAAATAGG + Intergenic
984738784 4:183138694-183138716 CAGTAGCCAGAAAAGGAAATGGG - Intronic
985045800 4:185939424-185939446 CAGCAGTCAGAGAGGGACGTGGG - Intronic
986001404 5:3633683-3633705 CTGTAGCCAGAGAGAGCCACAGG - Intergenic
986684374 5:10263191-10263213 CTGTTTTCAGAGAGGGCCATGGG - Exonic
987021444 5:13877092-13877114 CTATAGCCAGAGAGCGGCAGTGG - Intronic
988377594 5:30457201-30457223 CAATAGCCAGGGAGGGACACAGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990976332 5:61564777-61564799 CTGCAGCCACAGAGGGCCATGGG + Intergenic
992762364 5:79962098-79962120 CTCCAGCCAGAGAGAGACCTGGG - Intergenic
994244322 5:97462144-97462166 CTGCAGCCACCGAAGGACATTGG + Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
996593436 5:125174729-125174751 ATGTAAGCAGTGAGGGACATAGG - Intergenic
996842522 5:127863072-127863094 TTGTTGCCAAAGAGGCACATAGG - Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000136744 5:158360690-158360712 CTGTAGCCACATAGAGCCATTGG + Intergenic
1000189084 5:158891201-158891223 CAGTGGCAAGAGAGAGACATAGG - Intronic
1001256131 5:170184780-170184802 CTGTGGTCAGTGAGGGACAGGGG - Intergenic
1002870936 6:1166809-1166831 GTGTATCCAGAGAGGAACACTGG + Intergenic
1003538473 6:6997146-6997168 CTGTCGCCATGGAGGGGCATGGG + Intergenic
1005601336 6:27429425-27429447 AAGCATCCAGAGAGGGACATAGG - Intergenic
1007114728 6:39335591-39335613 CTGCAGCCAGGGAGGGGCAGCGG - Exonic
1012624065 6:101384946-101384968 CTGTAGCTGAAGAGAGACATGGG + Intergenic
1015016913 6:128424701-128424723 CAGTAGCCTGAGAGTGACTTGGG - Intronic
1016937102 6:149455590-149455612 CTGGAGGCAGAGAGGGACACAGG - Intronic
1018360800 6:163065553-163065575 CTGCAGCCACAGGGGGCCATGGG + Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1024231510 7:47367285-47367307 CAGCAGGCAGAGAGGGGCATTGG - Intronic
1026017976 7:66685777-66685799 CTCTAGCCAGAGACTGACATAGG - Intronic
1027621171 7:80487332-80487354 CTGTAGCCAGAGAGATAGATTGG + Intronic
1028136012 7:87223681-87223703 TGGTAGCCAGAGAGAGACATGGG - Intergenic
1028832314 7:95341434-95341456 CTATAGACAGAGAGGGAAAGAGG - Intergenic
1031963732 7:128012382-128012404 GTGTAGCCAGAGAGGTCCATAGG - Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034536950 7:151731327-151731349 CTGCAGCCAGAGAGGGGTAAGGG + Intronic
1036492087 8:9237143-9237165 GTGGAGCCCAAGAGGGACATTGG + Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037272071 8:17141316-17141338 AGTTAGCAAGAGAGGGACATGGG - Intergenic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037606603 8:20443015-20443037 CAGTAGCTAGAGAGGGAACTGGG + Intergenic
1037759169 8:21730450-21730472 CTGCAGCCAGATGGGGACATGGG + Intronic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1040372214 8:46788215-46788237 CTGTAGCCAGAGTGGGTCCCTGG + Intergenic
1040750573 8:50701357-50701379 CTGAAGCTAGGGAAGGACATGGG - Intronic
1044553494 8:93537344-93537366 GAGCAGCCAGAGAGGGACACAGG - Intergenic
1044724290 8:95180373-95180395 CAGTAGCTAGAGAGGGACAAAGG + Intergenic
1047957045 8:129984182-129984204 CTGCAGCCAGAGAGAGGCAGGGG - Intronic
1048357001 8:133661765-133661787 ATGAAGACAGAGAGGGACAGGGG - Intergenic
1048422801 8:134294099-134294121 AGGTGGCCAGAGAGGGGCATGGG + Intergenic
1049302325 8:141878195-141878217 CTGAAGACTGAGCGGGACATCGG - Intergenic
1049602011 8:143512353-143512375 CGTTAGTCAGAGAAGGACATAGG - Intronic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1051894823 9:21975698-21975720 CTGTAGGCAGATAGGAAAATGGG + Intronic
1052974959 9:34403354-34403376 TTGTAACCAGAGAGGGTCTTCGG - Intronic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1056605010 9:88078299-88078321 TTGTAGCAGGAGATGGACATTGG + Intergenic
1057280527 9:93708137-93708159 CTGTAACCAGAGCTGGATATAGG - Intergenic
1057303386 9:93899213-93899235 CTGGGGCCAGAGCCGGACATGGG - Intergenic
1058506820 9:105674805-105674827 CTGCAGCCTGAGAGAGATATGGG + Intergenic
1060722773 9:125989656-125989678 CTGGGCCCAGAGAGGGACAGCGG + Intergenic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1186028821 X:5345057-5345079 CTATAACCAATGAGGGACATGGG + Intergenic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187614305 X:20976497-20976519 GAGTAGACAGAGAGGGAAATCGG + Intergenic
1187733699 X:22282584-22282606 ATGAAGCCAGAGAGGGAAACAGG - Intergenic
1189498442 X:41530640-41530662 CTGTACCCAGAGAGGGAAGGTGG + Intronic
1190637959 X:52455113-52455135 TCGTAGCTAGAGAAGGACATGGG + Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1196070754 X:111518905-111518927 CTGTTGCCAGAGTGGGAAAATGG - Intergenic
1198587924 X:138143387-138143409 CAGTAGTCAGAAAGGGAAATTGG + Intergenic
1199859660 X:151789882-151789904 CTATAGACAGAGATGGACAAAGG + Intergenic