ID: 1195771079

View in Genome Browser
Species Human (GRCh38)
Location X:108352082-108352104
Sequence TTCACCTGACTCCAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195771079_1195771081 -10 Left 1195771079 X:108352082-108352104 CCTTTTCTTTGGAGTCAGGTGAA 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1195771081 X:108352095-108352117 GTCAGGTGAATGCAGGCATTTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1195771079_1195771082 6 Left 1195771079 X:108352082-108352104 CCTTTTCTTTGGAGTCAGGTGAA 0: 1
1: 0
2: 1
3: 28
4: 279
Right 1195771082 X:108352111-108352133 CATTTGGAGAAGTATTTCTGCGG 0: 1
1: 0
2: 0
3: 34
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195771079 Original CRISPR TTCACCTGACTCCAAAGAAA AGG (reversed) Intronic
902981279 1:20125092-20125114 TCCACCTGAATCAAAGGAAATGG + Intergenic
904483562 1:30808989-30809011 TTCATGTGACTGCAAAGATATGG + Intergenic
905318443 1:37098339-37098361 GTCACCTGACTCCAAAGCCTTGG - Intergenic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
906888183 1:49675623-49675645 TATACCTTACTCCAAACAAAAGG + Intronic
907904767 1:58774357-58774379 TCTTCCTGACTCCAAAGAACTGG - Intergenic
907999157 1:59663692-59663714 TTCACTTGACTCCACAAAAAAGG - Intronic
908143112 1:61208525-61208547 TCTTCCTGACTCCAAAGACAGGG - Intronic
909778068 1:79509117-79509139 TTAAGCTGACTTCAAATAAAAGG + Intergenic
911126173 1:94343137-94343159 TTCACTCCACTCCAAAGAGAAGG - Intergenic
911768220 1:101705158-101705180 GTCACCTGACTCTAAATTAAAGG + Intergenic
912204092 1:107491631-107491653 TTCTACTGCCCCCAAAGAAAGGG - Intergenic
916644425 1:166768810-166768832 TTCAACTGATTTGAAAGAAATGG + Intergenic
916777047 1:167977693-167977715 TTCCCCAGACTACAAAAAAATGG - Intronic
917780420 1:178389619-178389641 TTCACCAGACTGCAACAAAAGGG - Intronic
918744718 1:188184756-188184778 TCCACTTCACTCCAAAGCAAAGG - Intergenic
919256506 1:195131600-195131622 TTTATCTGCCTCCAAAAAAAGGG + Intergenic
920279283 1:204830547-204830569 TTCAGTTGAATCCAAAGACAAGG - Intronic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
923881826 1:238111810-238111832 TTCTCCTGACACCACAGACATGG - Intergenic
923899181 1:238306421-238306443 TTCACATGAAGCCAAAGAGAAGG - Intergenic
1063718892 10:8558416-8558438 ATCTCCTGACTCCAAGGGAAGGG - Intergenic
1065122245 10:22541670-22541692 TCCTCCAAACTCCAAAGAAATGG - Intronic
1068924273 10:62518571-62518593 TTTACCTGAGTCCAAAAGAAGGG + Intronic
1069133246 10:64732031-64732053 GTCCCCTGTCTCCAAAGAAAAGG - Intergenic
1069323249 10:67200004-67200026 TTTTCCTGTCTGCAAAGAAAAGG - Intronic
1070116084 10:73530138-73530160 CTCACCTGAATCCTCAGAAAAGG + Exonic
1071031210 10:81183534-81183556 TTTACCTGACTTAAAAGTAATGG - Intergenic
1071594436 10:86908978-86909000 TTCTCCTCCCTCCAAAGTAATGG + Intronic
1072878980 10:99204550-99204572 AATAGCTGACTCCAAAGAAATGG + Intronic
1073807312 10:107111210-107111232 TATAATTGACTCCAAAGAAATGG + Intronic
1074031048 10:109688419-109688441 TTCACCTCAATAAAAAGAAAAGG - Intergenic
1076221191 10:128734449-128734471 GTGAGCTGAATCCAAAGAAAGGG + Intergenic
1076635871 10:131881524-131881546 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1079312324 11:19377863-19377885 TTCAGCTTACTCCAACAAAAAGG - Intronic
1085089925 11:73703160-73703182 TTCAGGTGAATGCAAAGAAACGG + Intronic
1087226560 11:95607330-95607352 GTGCCCAGACTCCAAAGAAAGGG + Intergenic
1088186819 11:107179612-107179634 ATCATCTGAGTCTAAAGAAAAGG + Intergenic
1088621316 11:111687189-111687211 TTCACTGGAGTCCAAATAAATGG - Intronic
1090344192 11:126054780-126054802 TTCAGCAGAGTGCAAAGAAAGGG + Intronic
1091478492 12:801286-801308 TACACGTGACACCAAAGAACAGG - Intronic
1091988792 12:4937617-4937639 TAGACTTGACTCCACAGAAATGG + Intergenic
1092754644 12:11752199-11752221 TTGACATGAGTCCAAAGTAAAGG + Intronic
1095602188 12:44026420-44026442 TCCACGTGCCTCCAAAGAGACGG + Intronic
1097998758 12:65918873-65918895 TTCACCTCACTCCTAAAAATAGG - Intronic
1098509695 12:71297252-71297274 TTCACATAACTACAAAGAAGTGG + Intronic
1099955560 12:89350285-89350307 TTCCCCTGAGTCCAAAGACTGGG + Intronic
1100614749 12:96222306-96222328 TTCACCAGGCTCCAAAGCTAAGG + Intronic
1100762961 12:97830097-97830119 TTCAGCTGTGTCCAAGGAAAAGG - Intergenic
1100827023 12:98484073-98484095 TTCACCTTACCCCATAGAAGGGG + Intergenic
1102763833 12:115413811-115413833 TTCACCTGCCTTAAGAGAAAAGG - Intergenic
1104292168 12:127480905-127480927 ATCCCCTGTCTCCAAAGAGAAGG + Intergenic
1104293369 12:127489151-127489173 GTCCCCTGTCTCCAAAGAGAAGG + Intergenic
1105932306 13:25063983-25064005 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1106920452 13:34557449-34557471 ATCACCTGAATCACAAGAAAAGG + Intergenic
1107283395 13:38762184-38762206 CTCACCTGACTCTCCAGAAAAGG + Intronic
1109287917 13:60433869-60433891 TTTACCTGCTTTCAAAGAAATGG + Intronic
1110800851 13:79692938-79692960 TTCTCCTGCATCCAAGGAAAGGG - Intergenic
1111052149 13:82898902-82898924 GTCCCCTGTCTCCATAGAAATGG - Intergenic
1111319901 13:86613659-86613681 TTCACATGGCTCCCAGGAAAGGG - Intergenic
1113353631 13:109554605-109554627 AGTAGCTGACTCCAAAGAAATGG + Intergenic
1114929538 14:27450432-27450454 GGCAACTGACTCCAAAGAAATGG - Intergenic
1115756013 14:36526294-36526316 TTGACCAGAGTCCAAAGAAGGGG - Intergenic
1117065466 14:52009621-52009643 TTCCCCAGACTCCAGAGACATGG + Exonic
1118064127 14:62172140-62172162 TGCACATGACTACTAAGAAAAGG - Intergenic
1120222035 14:81745307-81745329 TTCAAATGACTCCAGAGAAGTGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1202830353 14_GL000009v2_random:21506-21528 TTCACCTCTCATCAAAGAAAGGG - Intergenic
1123989019 15:25669438-25669460 GTCAGCTGACTCCAAAGCATAGG + Intergenic
1125210097 15:37204447-37204469 TTTACTTGACCTCAAAGAAACGG - Intergenic
1125361095 15:38865689-38865711 TGAACCTGAATCCAGAGAAACGG - Intergenic
1126097688 15:45100867-45100889 TTCTCCTGGCTGCAAAGACAAGG - Intronic
1126837438 15:52680534-52680556 TTTACCTGAGGCCAAAAAAATGG - Intronic
1127169742 15:56289227-56289249 AGTAGCTGACTCCAAAGAAATGG - Intronic
1127483174 15:59395874-59395896 TTCCCCCAAATCCAAAGAAAGGG + Intronic
1128871706 15:71163133-71163155 ATTAACTGACCCCAAAGAAAAGG - Intronic
1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG + Intronic
1130051139 15:80484863-80484885 TTCATCTGACTCCAAGTACAGGG - Intronic
1132985328 16:2763507-2763529 TTCACCATACCCCAAAGTAAAGG + Exonic
1132997402 16:2830375-2830397 GCCTCCTGACTCCAAAGCAAGGG - Intronic
1133174673 16:4005231-4005253 TTGTCCTGTCTCCAAAAAAAGGG - Intronic
1134352613 16:13451916-13451938 TTCACCTGGCTTCAAGGAGAAGG + Intergenic
1134374940 16:13663163-13663185 TTTTCCTGACTGCAAAGTAATGG - Intergenic
1134485625 16:14656093-14656115 TTCTCCTGCCTCCAAGTAAATGG - Intronic
1135318450 16:21472247-21472269 TTCACTTAACTCCAAAAAAGTGG + Intergenic
1135371343 16:21904042-21904064 TTCACTTAACTCCAAAAAAGTGG + Intergenic
1135440444 16:22466673-22466695 TTCACTTAACTCCAAAAAAGTGG - Intergenic
1136328650 16:29553676-29553698 TTCACTTAAATCCAAAAAAATGG + Intergenic
1136443337 16:30293689-30293711 TTCACTTAAATCCAAAAAAATGG + Intergenic
1137239091 16:46639605-46639627 ATCACCTAACTCTAAGGAAAGGG - Intergenic
1138983702 16:62301073-62301095 TTCTCCTGATTCTAAAGGAAAGG - Intergenic
1139543742 16:67638316-67638338 TGCAGCTGACTCCAAGCAAAGGG - Exonic
1139890063 16:70246112-70246134 TTCACTTAACTCCAAAAAAATGG + Intergenic
1140056336 16:71528957-71528979 TTCTCTTGACTCCTCAGAAATGG + Intronic
1141476384 16:84276363-84276385 TTGAACTGACTCAAAACAAATGG + Intergenic
1141778317 16:86139183-86139205 TTAACCTCACTCCAAGGACAAGG - Intergenic
1143821011 17:9562986-9563008 TTAACCTGTCTCCTAAGGAAAGG - Intronic
1147196299 17:38769068-38769090 TTCACTTGAATCCAAGGGAAAGG + Exonic
1149363745 17:55920122-55920144 TTCACGTAACTCAAAACAAAGGG + Intergenic
1149804485 17:59602367-59602389 TCCACCTGAAACCAAAAAAATGG - Intronic
1150246355 17:63678518-63678540 CCCACCTGACTCCAGAGCAAAGG - Intronic
1150720009 17:67606389-67606411 TTCAACTGCCTTCAAAGAGATGG + Intronic
1151266839 17:72963044-72963066 TTGACTTGACTCCATGGAAAGGG - Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1152769670 17:82159453-82159475 TTCAACTGCCTCGACAGAAATGG + Intronic
1153852574 18:9109827-9109849 TTTACTTGACTCCAACGAAAAGG + Intronic
1153958159 18:10116097-10116119 CACACCTGGCTTCAAAGAAAGGG - Intergenic
1154122089 18:11660255-11660277 ATCATCTGATTCCAGAGAAATGG - Intergenic
1155642096 18:28030675-28030697 GCCACTTGACTCCAAAGAATGGG + Intronic
1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG + Intronic
1157931283 18:51826076-51826098 TTCTACTGACTCCATATAAAAGG + Intergenic
1159902190 18:74057873-74057895 TTCATCTGAAACCAAAAAAAAGG + Intergenic
1163539490 19:17898927-17898949 TGCACCTGGCTGCAAAAAAAGGG + Intergenic
1163595007 19:18216163-18216185 TGCACCTGACACCCCAGAAACGG + Intronic
1164481528 19:28614842-28614864 CTGTCCTGTCTCCAAAGAAAAGG + Intergenic
1164523683 19:28998175-28998197 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1167974584 19:53214489-53214511 TTCTCATGACCCCAAAGACAAGG - Intergenic
1202642336 1_KI270706v1_random:106267-106289 TTCACCTCTCATCAAAGAAAGGG + Intergenic
925054246 2:844021-844043 TTCACTTAACAGCAAAGAAATGG + Intergenic
925488691 2:4368247-4368269 AATAACTGACTCCAAAGAAATGG - Intergenic
925616497 2:5748825-5748847 TTCACCAGACTTGAAGGAAAGGG - Intergenic
925806704 2:7658178-7658200 TTCTCCTGTCTCAAAAGCAAAGG - Intergenic
926453607 2:13037642-13037664 TTGTCCTCACTCCAAAGAGAAGG - Intergenic
928940076 2:36718558-36718580 TTCTCCTGGAGCCAAAGAAAAGG + Intronic
929072870 2:38051206-38051228 TTTGCATGACTCCGAAGAAAGGG - Intronic
929392292 2:41484059-41484081 CTCATCTGACCCCAGAGAAAGGG + Intergenic
929699911 2:44153014-44153036 CTCACCTCACGCCAAAGGAAAGG - Intergenic
930055881 2:47251536-47251558 TGAAACTGACTCCAAGGAAAGGG + Intergenic
935247819 2:101234507-101234529 GTCTCCTGTCTCCAAAGAAAAGG - Intronic
939894899 2:147779662-147779684 GTCACCTAACTCTGAAGAAAAGG + Intergenic
940316259 2:152330682-152330704 TCCATCTGACTCAAAACAAAGGG - Intergenic
940983046 2:160024403-160024425 TCACCCTGCCTCCAAAGAAATGG + Intronic
942251803 2:174053731-174053753 TTCAGCTGACTCTCAAGCAAAGG + Intergenic
942439676 2:176019639-176019661 GTCTCCTGTCTCCAAAGGAAAGG + Intergenic
942825254 2:180168059-180168081 TTCATATGACTCAAAAGAGATGG + Intergenic
943320830 2:186440047-186440069 GTCCTCTGTCTCCAAAGAAATGG - Intergenic
944524395 2:200603769-200603791 GTCCCCAGACTCCAAAGAGAAGG + Intronic
945388982 2:209241013-209241035 CACACATGAGTCCAAAGAAAAGG + Intergenic
948580496 2:238984572-238984594 TTCACCTGTTTTCCAAGAAAGGG + Intergenic
1168906154 20:1405377-1405399 TTCACCTGACCTAAAACAAAAGG + Intergenic
1168956442 20:1837612-1837634 TATAACTGGCTCCAAAGAAAGGG + Intergenic
1170037081 20:12001034-12001056 TTTACCCAACACCAAAGAAATGG - Intergenic
1171415245 20:24973955-24973977 TGAACCTGACTCAAAAGCAAGGG + Intronic
1171889442 20:30696449-30696471 TTCACCTCTCATCAAAGAAAGGG + Intergenic
1171924231 20:31175842-31175864 TTCAACTGACTAGAAAGGAATGG + Intergenic
1172603778 20:36201049-36201071 TTCCCCTCACCCCAGAGAAAGGG - Intronic
1173423393 20:42922825-42922847 TTCACCTGCATACAAAGATAAGG - Intronic
1173998359 20:47357097-47357119 CTCACCTGCCCCCAGAGAAACGG + Intergenic
1175336523 20:58199805-58199827 TCCTCCTGACTACAAAGAGAAGG - Intergenic
1175476879 20:59282327-59282349 TTCAGGTGACCCCAAAGGAAAGG + Intergenic
1176609540 21:8866344-8866366 TTCACCTCTCATCAAAGAAAGGG - Intergenic
1176757114 21:10733748-10733770 TTCAGTGGACTCCAAAGGAATGG - Intergenic
1176946596 21:14989735-14989757 TTTCCCTGACTCCAAAGTCATGG + Intronic
1177053292 21:16266412-16266434 TTGTCCTGACACCAAAGAATTGG - Intergenic
1177312731 21:19418444-19418466 TTGGACTGACTCCAAATAAATGG + Intergenic
1177701486 21:24645108-24645130 TTAACCTCACTTCAGAGAAAGGG + Intergenic
1177744636 21:25196952-25196974 TTGATGTGACTCCACAGAAAAGG + Intergenic
1178193216 21:30311058-30311080 TTTACTTGAATCCAAAGGAAGGG - Intergenic
1178390957 21:32197873-32197895 TGCATCTAATTCCAAAGAAATGG + Intergenic
1178695033 21:34785672-34785694 TTCCCCCGACCCCCAAGAAATGG + Intergenic
1178772164 21:35515605-35515627 TTCACATGCCTATAAAGAAATGG - Intronic
1179257276 21:39727677-39727699 TCCAAATGACTCCAAAGAGAAGG - Intergenic
1180171965 21:46064203-46064225 TTCATCGGACTCGAGAGAAAGGG + Intergenic
1181715844 22:24727528-24727550 GTCATCTAACTACAAAGAAATGG + Intronic
1181936037 22:26439510-26439532 TCAGCCTGACTCCAAAGAACAGG - Intronic
1182295358 22:29308888-29308910 TATACCTGACCCCAAGGAAATGG + Intronic
1182635699 22:31725088-31725110 TTCAACACACTCAAAAGAAAGGG + Intronic
1183813668 22:40280089-40280111 TCCACCTAATTCCAAAGACATGG + Exonic
1185414320 22:50701371-50701393 CTGACCTTACTGCAAAGAAAGGG - Intergenic
949592345 3:5507681-5507703 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
949665945 3:6339813-6339835 TCCATCTGACTCCAAAGACAAGG + Intergenic
949726613 3:7055393-7055415 TTAGCCTGACTCCAACAAAACGG - Intronic
950149653 3:10676789-10676811 TACACCTGAATCCAAAATAAAGG + Intronic
953938343 3:47067190-47067212 TTCACATGACAATAAAGAAATGG + Intronic
954800741 3:53185737-53185759 TCCCCCTGAGGCCAAAGAAAGGG + Intronic
955041603 3:55322794-55322816 TTCATCAGACTCCACAGAAAAGG + Intergenic
955643240 3:61109409-61109431 TTCACTTAACCCCAAACAAAGGG - Intronic
957021748 3:75136207-75136229 GTCCCCTGTCTCCAAATAAAAGG + Intergenic
957022957 3:75144501-75144523 GTCCCCTGTATCCAAAGAAAAGG + Intergenic
958129136 3:89395256-89395278 ATCTCTTGACTACAAAGAAAAGG - Intronic
959266538 3:104147346-104147368 TACACCTGAGTAAAAAGAAAAGG + Intergenic
960283834 3:115805169-115805191 CTCACCCGACCCCAAAGCAAGGG - Exonic
960834768 3:121894518-121894540 TTCACCTGTCTCCATTGAAGAGG + Exonic
961971824 3:130976490-130976512 ATCCCCTGTCTCCAAGGAAATGG + Intronic
962960115 3:140303369-140303391 TTAACTTGAATCCAAAGGAAAGG + Intronic
963297739 3:143565025-143565047 GTTAGCTGACTCCAAGGAAATGG - Intronic
966250773 3:177863127-177863149 CTCACCTGACTTCATAGCAAAGG - Intergenic
966632189 3:182089174-182089196 TCTCCCTGACTCAAAAGAAAGGG + Intergenic
967486873 3:190042679-190042701 TTGACCTGAATTCAAAGGAATGG + Intronic
968096385 3:195933594-195933616 TTCACTTTACCCCAAACAAATGG - Intergenic
1202736220 3_GL000221v1_random:1113-1135 TTCACCTCTCATCAAAGAAAGGG - Intergenic
968866139 4:3213196-3213218 TCCACCTCACACCAAAGAAAGGG + Intronic
970163703 4:13214670-13214692 TCCACCTCCCTCCAAATAAAAGG + Intergenic
970291884 4:14581916-14581938 TGCAACTGACCCCAAAGAAAAGG + Intergenic
970684658 4:18553200-18553222 AACAACTGACTCCAAAGAAATGG - Intergenic
970781938 4:19748033-19748055 ATCAGTTGATTCCAAAGAAAGGG + Intergenic
971075355 4:23141688-23141710 TTCACCCCACTCCACAGATAAGG - Intergenic
972618021 4:40718893-40718915 TTCAACTGACTTCAATAAAAAGG - Intergenic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
973218749 4:47701172-47701194 TTCACCTTGCTGCAAAGACAAGG + Intronic
973798804 4:54455857-54455879 TTTACCTGTCTCCAGAGAATGGG + Intergenic
974619210 4:64334353-64334375 TTTACAAGACTGCAAAGAAATGG - Intronic
974685033 4:65216315-65216337 AGTATCTGACTCCAAAGAAATGG + Intergenic
975293814 4:72708743-72708765 TGCACCAGAATCAAAAGAAAAGG - Intergenic
976005053 4:80419851-80419873 TTCTCTTGCCTCCTAAGAAAAGG - Intronic
977294636 4:95197491-95197513 TTCATCTGACTCTGATGAAAAGG - Intronic
977352355 4:95904492-95904514 TTTTCCTGACCACAAAGAAAAGG + Intergenic
977381453 4:96279328-96279350 TTCACCAGACTCCAAGGAGTTGG - Intergenic
977904903 4:102466139-102466161 TTCTATTAACTCCAAAGAAAAGG - Intergenic
980545554 4:134257140-134257162 TTCCCCTTACTCAAGAGAAATGG + Intergenic
983154520 4:164329803-164329825 TTCACCTAACACCAAGGAGATGG + Intronic
983434045 4:167688787-167688809 TTCACCTGACCCAAAAGATGTGG - Intergenic
983708880 4:170690272-170690294 GTCTCCTGTCTCCAAAGAAAAGG + Intergenic
983934124 4:173487790-173487812 TTCTCCTTTCTCCATAGAAATGG + Intergenic
983979039 4:173972253-173972275 AGTAACTGACTCCAAAGAAATGG - Intergenic
984196986 4:176669894-176669916 AACACCTAACTCCAAAGAACAGG + Intergenic
984663515 4:182399833-182399855 TTCACCTGACTACAGTAAAAGGG + Intronic
1202769701 4_GL000008v2_random:192157-192179 TTCACCTCTCATCAAAGAAAGGG + Intergenic
987576704 5:19737571-19737593 AACACCTGACTCCTAGGAAATGG + Intronic
987890074 5:23864846-23864868 GTCCGCTGTCTCCAAAGAAAAGG + Intergenic
988581745 5:32474554-32474576 TGCCTCTGACTCCAGAGAAACGG + Intergenic
989049124 5:37301254-37301276 TTCATCTGACTCCTAGAAAAAGG - Intronic
990621413 5:57563533-57563555 TCCATCAGACTCCAAAGACATGG + Intergenic
992047337 5:72907429-72907451 TTCTCCTGCCTCTGAAGAAAAGG - Intronic
993293010 5:86099853-86099875 TGCACCTGAGTATAAAGAAAGGG - Intergenic
994043063 5:95279760-95279782 ATCAGCTTATTCCAAAGAAAGGG - Intronic
994135405 5:96280892-96280914 TTCACCTGGCTTCAAAGTACAGG - Intergenic
994169985 5:96648866-96648888 TTCACCTGACTCCAGCTAATAGG + Intronic
996135092 5:119831915-119831937 TCAAGTTGACTCCAAAGAAAGGG - Intergenic
999234374 5:150081683-150081705 ATCACCTGTCACCAAATAAATGG + Intronic
999885459 5:155918112-155918134 TTCACCTTCCTCAAAATAAATGG + Intronic
999961802 5:156763854-156763876 TTCAACTGTTTCCAAATAAAAGG - Intronic
1002656833 5:180755076-180755098 TGTAGCTGACCCCAAAGAAAAGG + Intergenic
1002868715 6:1147044-1147066 TTCTCCTGACTGGAAAGGAAAGG + Intergenic
1004715370 6:18211891-18211913 TTCTCCTGACTCCATAGTTAGGG + Intronic
1004979426 6:21006798-21006820 TTGACCAGACTACAAGGAAATGG - Intronic
1005545461 6:26864135-26864157 GTCAGCTCACTCCAAAGAATTGG - Intergenic
1005727143 6:28660583-28660605 ATCAGCTGACTTGAAAGAAAAGG + Intergenic
1007204590 6:40138452-40138474 GTCCCCTGTCTCCAAAGAAGAGG + Intergenic
1009016164 6:57904899-57904921 GTCAGCTCACTCCAAAGAATTGG - Intergenic
1013152898 6:107463146-107463168 TTCACCTCAGTGTAAAGAAATGG - Intergenic
1014758538 6:125328940-125328962 TTCAACTTTCTCCAAAGAAAAGG + Intergenic
1015694261 6:135962790-135962812 GTCACCTGACCCCAAACAAATGG + Intronic
1017251131 6:152281000-152281022 TTCCTCTGAGTCCAAAAAAAAGG + Intronic
1017291267 6:152741222-152741244 TTCACTTCACTCAAAAGCAAAGG - Intergenic
1019100312 6:169624583-169624605 GTCACCTGACTCCCTGGAAACGG - Intronic
1020603726 7:10308643-10308665 CTCACCTGTCTCCAAAGAGATGG + Intergenic
1021553115 7:21892909-21892931 TTTACCTGATTCCAAATATATGG + Intronic
1025292341 7:57741354-57741376 TTTATGTGACTCCAAAGAGAAGG - Intergenic
1027712316 7:81620634-81620656 TTCCCTTGACTGAAAAGAAAGGG - Intergenic
1028730118 7:94137440-94137462 TTCACCTGTCTCCATAGAAAGGG - Intergenic
1028757391 7:94453138-94453160 TTCTCCTGTCTCCCAAGAACTGG - Intergenic
1029647283 7:101865851-101865873 TTCCCCTGAATCCACTGAAATGG - Intronic
1030688998 7:112513685-112513707 TTCACCTGTCTGCAAAGAGAAGG - Intergenic
1031726468 7:125246073-125246095 ATCATCTGACTCCAAAGTACTGG + Intergenic
1031894504 7:127333178-127333200 TTCTACTGACTTTAAAGAAATGG + Intergenic
1031895494 7:127343594-127343616 TTCTCCAGACCCCAAAGAATAGG + Intergenic
1031946367 7:127845589-127845611 TACAACTGACTCCTAAGAAGTGG - Intronic
1032170188 7:129578190-129578212 GTCTCCTGTCTCCAAAGAAAAGG + Intergenic
1032171236 7:129586303-129586325 GCCTCCTGTCTCCAAAGAAAAGG + Intergenic
1032392686 7:131566326-131566348 TTCACCTGCCACCAGAGAAGTGG + Intergenic
1032734303 7:134676830-134676852 GTCACCTGACTCCAAACAACAGG + Intronic
1032903055 7:136333053-136333075 TTCATTTGATGCCAAAGAAATGG - Intergenic
1032992205 7:137406054-137406076 CTCACCTAACTCCAGAGAGAGGG + Intronic
1033620621 7:143059069-143059091 TTCAACTTAATCAAAAGAAATGG + Intergenic
1033908999 7:146242698-146242720 TTCACTTTACTCCAAAAATAAGG - Intronic
1034912874 7:155011923-155011945 TTCACCAGGCTCCTCAGAAAAGG + Intergenic
1035139761 7:156747275-156747297 TTTTCCTGAATCCAAAGAGACGG - Intronic
1035357848 7:158289655-158289677 AGCAGCAGACTCCAAAGAAATGG - Intronic
1035450680 7:158974895-158974917 TTAACATGATTCCAAACAAAAGG - Intergenic
1037342951 8:17866648-17866670 TTTACCTGACTTTAAAGAAATGG - Intronic
1037604221 8:20423833-20423855 TTCAGCTGTCTCCAATGAACAGG - Intergenic
1038281526 8:26169696-26169718 TTGGGCTGAATCCAAAGAAATGG - Intergenic
1039278845 8:35959841-35959863 GTCCCCTGTCTCCAAAGAGATGG + Intergenic
1042312327 8:67391478-67391500 TCCACCTGCCTCCAAAGTACAGG - Intergenic
1042867900 8:73371667-73371689 TCCACCTAATTCCTAAGAAATGG + Intergenic
1043452411 8:80381361-80381383 TTGATCTGACAACAAAGAAAAGG - Intergenic
1046919414 8:119712306-119712328 TTAAACTGACCCAAAAGAAATGG - Intergenic
1047995011 8:130326336-130326358 TTCACCTGCCTGCAATGTAAGGG + Intronic
1050788784 9:9439644-9439666 TTTATCTGACACCAAAGTAAGGG - Intronic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1053462549 9:38281823-38281845 TTCTCCTGGCTCCAAACATAAGG + Intergenic
1054887398 9:70213336-70213358 CCCACCTGAATCCAAAGTAAAGG - Intronic
1055404319 9:75958659-75958681 TTCTTCTGACTCCAAATCAAGGG - Intronic
1059575969 9:115488821-115488843 TACAACTGACTCCAAATTAAAGG - Intergenic
1059710555 9:116864095-116864117 TCCAGCTGAGTCCAAAGAGAAGG + Intronic
1060244939 9:121937437-121937459 TTCATCTGACTCCAAAACCAGGG + Intronic
1060878838 9:127103570-127103592 TGCACCTGACTCCCAGCAAATGG - Intronic
1060921570 9:127424133-127424155 TCCACCAGAATCCAACGAAATGG - Intergenic
1061056330 9:128224755-128224777 TTCACCTGTCTCCAAGGCTAAGG - Intronic
1062614358 9:137389281-137389303 TTCACCTCACTCCCCAGACACGG - Intronic
1203694603 Un_GL000214v1:85880-85902 TTCACCTCTCATCAAAGAAAGGG + Intergenic
1203704947 Un_KI270742v1:31552-31574 TTCACCTCTCATCAAAGAAAGGG - Intergenic
1203559057 Un_KI270744v1:34259-34281 TTCACCTCTCATCAAAGAAAGGG + Intergenic
1203641670 Un_KI270751v1:18183-18205 TTCACCTCTCATCAAAGAAAGGG - Intergenic
1187200726 X:17131404-17131426 TTCCTCTGACTCCACTGAAATGG - Intronic
1188072734 X:25737080-25737102 TTCACCTGGCTTCAAGAAAACGG - Intergenic
1188284195 X:28307580-28307602 AACACCTCACTGCAAAGAAATGG + Intergenic
1189084539 X:38007726-38007748 TTCACTAGAGTCCAAACAAATGG - Intronic
1189361425 X:40355842-40355864 TTCTCCTGATCTCAAAGAAAAGG - Intergenic
1190314300 X:49139918-49139940 GTCCCCTATCTCCAAAGAAAAGG - Intergenic
1190315667 X:49148960-49148982 GTCCCCTGTCTCCAAAGAAAAGG - Intergenic
1191607073 X:63074264-63074286 GTCCCCTGTCTCCAAAGAAAAGG + Intergenic
1193656901 X:84209596-84209618 GTCTCCTGTCTTCAAAGAAAAGG - Intergenic
1194353366 X:92850684-92850706 TTCTCCTTACTAGAAAGAAAGGG - Intergenic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1199614481 X:149646093-149646115 TACAGCTGACTCCACTGAAATGG - Intergenic
1200661722 Y:5967755-5967777 TTCTCCTTACTAGAAAGAAAGGG - Intergenic
1202036602 Y:20643144-20643166 GTCCCCTGTCTCCAAAGAACAGG + Intergenic