ID: 1195781492

View in Genome Browser
Species Human (GRCh38)
Location X:108470470-108470492
Sequence CTCCATTTAAAAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15601
Summary {0: 4, 1: 85, 2: 752, 3: 3178, 4: 11582}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195781492_1195781495 22 Left 1195781492 X:108470470-108470492 CCTTTGCCCATTTTTAAATGGAG 0: 4
1: 85
2: 752
3: 3178
4: 11582
Right 1195781495 X:108470515-108470537 ATTAAGTTATTTGTAGATTCTGG 0: 2
1: 188
2: 3199
3: 6715
4: 16579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195781492 Original CRISPR CTCCATTTAAAAATGGGCAA AGG (reversed) Intronic
Too many off-targets to display for this crispr