ID: 1195782357

View in Genome Browser
Species Human (GRCh38)
Location X:108479897-108479919
Sequence AGTTTTTTGCAGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 15, 3: 230, 4: 409}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195782350_1195782357 22 Left 1195782350 X:108479852-108479874 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG 0: 1
1: 0
2: 15
3: 230
4: 409
1195782354_1195782357 4 Left 1195782354 X:108479870-108479892 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG 0: 1
1: 0
2: 15
3: 230
4: 409
1195782349_1195782357 25 Left 1195782349 X:108479849-108479871 CCGCCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG 0: 1
1: 0
2: 15
3: 230
4: 409
1195782352_1195782357 15 Left 1195782352 X:108479859-108479881 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG 0: 1
1: 0
2: 15
3: 230
4: 409
1195782351_1195782357 16 Left 1195782351 X:108479858-108479880 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG 0: 1
1: 0
2: 15
3: 230
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195782357 Original CRISPR AGTTTTTTGCAGAGGATGGC AGG Intronic
900474158 1:2868540-2868562 AATATTTTGCCGAGCATGGCTGG + Intergenic
900545673 1:3227775-3227797 AGCTTCTTGCAGGGGGTGGCCGG + Intronic
901299489 1:8189115-8189137 AATTTTTTGTAGAGGTTGGTGGG + Intergenic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901876071 1:12167605-12167627 AGTCTTTTGAAGAGGGTGCCCGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903159562 1:21476389-21476411 ACGTTTTTGCAGTGGCTGGCTGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904820183 1:33237656-33237678 AGTCGTTGGCAGAGGATGGCTGG + Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905867337 1:41383140-41383162 AGTTTTCCGCAGAGGGTTGCTGG - Exonic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
906491131 1:46269660-46269682 AGTTTTTTGGTGGGTATGGCAGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
908030197 1:59990859-59990881 GGTTTTTTAAAGAGGATGGAGGG + Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910141286 1:84029987-84030009 AGTTATTTGTGAAGGATGGCAGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911429925 1:97772885-97772907 AGATTTCTGAAGAGGATGGATGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913583635 1:120251416-120251438 ATTATTTTGCAGAGGATGATGGG + Intergenic
913624541 1:120646904-120646926 ATTATTTTGCAGAGGATGATGGG - Intergenic
914565623 1:148863252-148863274 ATTATTTTGCAGAGGATGATGGG + Intronic
914607202 1:149267000-149267022 ATTATTTTGCAGAGGATGATGGG - Intergenic
915693938 1:157720023-157720045 AATTTTTGGCATAGGAAGGCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917878969 1:179314595-179314617 ATTTTTTTGTAGAGAATGGGGGG + Intronic
918747479 1:188223537-188223559 AGTATTGTGGAGAGGATGGAGGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919069444 1:192735220-192735242 AGATTTTACCAGATGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920353934 1:205356559-205356581 TGTCTTTTGCAGATGATCGCCGG - Exonic
920525256 1:206661433-206661455 GGCTTTTGGTAGAGGATGGCAGG + Intronic
920807850 1:209251830-209251852 AGCTTTTTGCACTGGCTGGCTGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924800064 1:247322902-247322924 AGCTTTGTGCAGACGATAGCAGG - Intronic
924814733 1:247431696-247431718 ACTTTTGTGCAGAGAATGGTCGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062837325 10:644283-644305 AGTTTCTGCCAGAGGCTGGCGGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064935920 10:20679037-20679059 AGCTTTGTCCAGAGGATGGGAGG - Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072271903 10:93784758-93784780 AGATCTTTGCAGAGGAAGGAGGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073825171 10:107312620-107312642 AGTTGTTTGCAAAGCCTGGCAGG - Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076494735 10:130889570-130889592 AGTGCTTTTCACAGGATGGCAGG + Intergenic
1076516652 10:131049041-131049063 ACTTTTGAGCAGAGGTTGGCAGG - Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078016383 11:7618482-7618504 AGTTTGTTGGAGAGGGTGTCAGG - Intronic
1078212679 11:9283443-9283465 AGTTTTTTTTGGAAGATGGCTGG + Exonic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080095369 11:28399428-28399450 AGTTTTCTGCAAAGGATGAAAGG - Intergenic
1080592904 11:33738949-33738971 AGTCTTGTGCTAAGGATGGCAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082180774 11:49116601-49116623 AGTTTTATCCAGATGAAGGCAGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082830698 11:57614764-57614786 AGTGGTTTGGAGAGCATGGCAGG - Exonic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1084657064 11:70525810-70525832 AGTTTTGTGGAGGTGATGGCGGG + Intronic
1084990126 11:72915126-72915148 AGTTTTTTTCATATGATTGCTGG - Intronic
1085279256 11:75319611-75319633 ATTTTTGTGCAGTGAATGGCTGG - Intronic
1085385966 11:76158564-76158586 AGCTTTATCCTGAGGATGGCGGG - Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085772079 11:79334598-79334620 GGTTTTTTCCTGAGGATGGTTGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089181292 11:116584585-116584607 TTTTGTTTGCAGGGGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093312616 12:17609057-17609079 TGTTTGTTGCTGAGGATGGGGGG + Intergenic
1093415775 12:18918975-18918997 CGTTCTTTGCAGGGCATGGCTGG + Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093878506 12:24377016-24377038 CGTTTAGGGCAGAGGATGGCTGG - Intergenic
1093878659 12:24378894-24378916 GGTTTGGGGCAGAGGATGGCTGG - Intergenic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094573449 12:31662321-31662343 GGTTTTTTGTAGAGGTTGGAGGG - Intronic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095964180 12:47855859-47855881 AGGTTTTTGCAGGGTCTGGCAGG - Intronic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097168603 12:57099396-57099418 GGTCTTTGGCAGAGAATGGCTGG + Exonic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100822179 12:98441878-98441900 AGGTTTTTGCAGAGTAGGACTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102260364 12:111439699-111439721 AGTTTTGAGCAGAGGAGGGTAGG + Intronic
1102286700 12:111663495-111663517 AATTTTTTGCAGAGAAAGGCAGG - Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104694659 12:130853960-130853982 AGGTTTTTGAGGAGGAAGGCAGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108018730 13:46103225-46103247 TGGTTGTTGCAGAGGTTGGCGGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109197842 13:59398340-59398362 CCTTTTTTCCAGAGGCTGGCTGG - Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116168597 14:41368107-41368129 AGTTGTGTACAGAGGATGACAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120480285 14:85040885-85040907 AGTTGCATGCTGAGGATGGCAGG - Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1122022483 14:98850448-98850470 TGTTTCTTGCAAAGGATGTCTGG + Intergenic
1124048876 15:26176857-26176879 ACTTTTTTGAAGAGGTTGGAGGG - Intergenic
1124859990 15:33430057-33430079 TGTTTTTTGCTGATGTTGGCTGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127556438 15:60092092-60092114 AGTTCTTTGCAGAGAATTGTGGG - Intergenic
1127644903 15:60948172-60948194 AGTTCTTTCCAGAGGATGGATGG + Intronic
1128333261 15:66770147-66770169 AGTTTGTAGCAGATGATGGTAGG - Intronic
1129542679 15:76363792-76363814 AGTTTTGTGGAGAGGAATGCAGG - Intronic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134182926 16:12062033-12062055 ACTTTTCTGCACAGGGTGGCAGG - Intronic
1134358915 16:13511963-13511985 AGTTTTTTGCTCTGGCTGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140840563 16:78834607-78834629 AGTTTGTTGCAGATGAAGACAGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143167468 17:4904195-4904217 TGTTTTTTGCAGGGGGTGGGGGG + Intergenic
1143684422 17:8502810-8502832 AGTTTTTTGCAAGGGTTGGATGG + Intronic
1143981609 17:10874884-10874906 AGGTTTTTGCAGAGTACAGCTGG + Intergenic
1144717688 17:17445794-17445816 ATTTTTCTGCAGAGGCAGGCGGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147868521 17:43570596-43570618 AGATATTTGCAAGGGATGGCTGG - Intronic
1149831939 17:59880047-59880069 AATTTTTTTAAGAGAATGGCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152028376 17:77826424-77826446 AGTCTCTTGCAGAGGAATGCTGG - Intergenic
1152646759 17:81472703-81472725 ATTTTTTTGTAGAGTTTGGCGGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153184388 18:2470716-2470738 AATTATTTGTGGAGGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153441178 18:5121233-5121255 TGTATTTTGCTGAGGATTGCTGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156216193 18:35000465-35000487 AGTCTTTGCCAGAGGATGGGGGG + Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156762456 18:40609699-40609721 AGTGTTTTGAAGAGGGTGACAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158409132 18:57188994-57189016 AGCTTTTTGCAGAGGATGTCTGG - Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160816758 19:1039629-1039651 CGGCTTCTGCAGAGGATGGCAGG - Intergenic
1161982088 19:7635216-7635238 AGTTTTGAGCAGGGGAAGGCGGG - Intronic
1162655557 19:12126420-12126442 AGTTTTTCACAGAGGAGGGTGGG + Intronic
1163082453 19:14953863-14953885 AGTGTTTTCCAAAGCATGGCTGG - Intronic
1163721828 19:18901541-18901563 AGTTGTTTGCAGAGCGGGGCTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1164486227 19:28657934-28657956 AGGTCTTTGCAGGGGATGGGAGG - Intergenic
1164940569 19:32250058-32250080 AATTTTTTGCAGTGGAGGGGAGG + Intergenic
1165381651 19:35485906-35485928 AGATCTTTGCAGTGGATGGATGG + Intergenic
1167384234 19:49154851-49154873 AGGTCTTTGCAGAGCATGGTGGG - Exonic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927816397 2:26221349-26221371 AGTTATTCACAGAGGATGGTAGG - Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929000012 2:37338245-37338267 AGTTTTTTCCTCTGGATGGCTGG + Intergenic
929572615 2:43032163-43032185 AGTTGTTGGCTGAGGAAGGCAGG - Intergenic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
929978306 2:46655845-46655867 ATTTTTTTGTAGAGGCAGGCTGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
932167203 2:69519158-69519180 AGTTTGCGGCAGAGGCTGGCTGG + Exonic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933364361 2:81330609-81330631 AGTGTTTTGTAGAGGGTGGAAGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937006947 2:118525555-118525577 GGCTGTTTGAAGAGGATGGCAGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939254133 2:139720750-139720772 AGTTCTTTGCAGAGGATAAGTGG + Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939731770 2:145793491-145793513 AGGTTTTTGCAGAGACTGGAGGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940012864 2:149073145-149073167 AGTTTTTTGAGTAGAATGGCAGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942357850 2:175138595-175138617 GGTGATTTTCAGAGGATGGCAGG - Intronic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943324742 2:186484847-186484869 AGTTCTTGTCAGAGGATGGAGGG - Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944213130 2:197227060-197227082 TGTTTTCTGCTGAGGATGGCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
946943286 2:224792833-224792855 AGTTTTTTGCAGAGTAAGTTGGG + Intronic
947198711 2:227595828-227595850 ACTTTTTTGCACAGTATGGTAGG + Intergenic
947284251 2:228494203-228494225 ACTTTTTTGCGGAGGTGGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948433397 2:237935174-237935196 AGTTTTTTGCAGAGATGGGAGGG - Intergenic
1168911359 20:1449808-1449830 ATTTTTGTGGAGAAGATGGCTGG - Intronic
1169240445 20:3973845-3973867 AATCTTTTGCAGAGAATGGGAGG + Intronic
1169279046 20:4251537-4251559 AGGTTTTAGCAGTGGAGGGCTGG + Intergenic
1169579762 20:7006995-7007017 GGTTGTTAGCAGAGGCTGGCAGG + Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170301285 20:14887018-14887040 GATTTTTGGCAGAGGATGGGAGG + Intronic
1171061897 20:21972750-21972772 AGTGTGTTACAGAGGATGGGAGG + Intergenic
1172966665 20:38840340-38840362 AGTTGTTTCCAGAGAAAGGCAGG + Intronic
1173222166 20:41139136-41139158 AGTTTGTAGCTGAGGATGGTTGG - Intronic
1175501218 20:59452596-59452618 TGTTGTTTTCAGAGGCTGGCAGG - Intergenic
1175881504 20:62262096-62262118 AGTTTTAGGCAGAGGGTGACGGG - Intronic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178961346 21:37068984-37069006 TGTTTTCTGCAGGGGAGGGCAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180100610 21:45582277-45582299 ATTTTTCTGGAGAGTATGGCGGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180659263 22:17451652-17451674 AGTTCTTTCCAGTGTATGGCTGG + Intronic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182855710 22:33516071-33516093 AGTTTGTTGCAGAGGATGCAGGG + Intronic
1184508897 22:44920423-44920445 AGCTCCTTGCAGAGGTTGGCCGG - Exonic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950103973 3:10376838-10376860 AGGTTTGAGCAGAGGAGGGCAGG + Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951047774 3:18060314-18060336 AGTGGTTTACAAAGGATGGCAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951178337 3:19628751-19628773 AGTTTTCTGAAGAGGGTAGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951593331 3:24290324-24290346 CGTTGTTTGCAGAACATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953716851 3:45322978-45323000 AATTTCTTGCAGAGAATGGGGGG - Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954910190 3:54099075-54099097 AGTGGTTAGCAGAGGATGGGGGG - Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955817881 3:62865169-62865191 AGCTTTTTGGTGAGGATGGTAGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956437999 3:69253197-69253219 TTTTTTTTGCAGATGATGGGAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957643258 3:82886175-82886197 AGTTTTCTGCACAGGAAAGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960690030 3:120336792-120336814 AGATTTTTGCAGGGGGTAGCAGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
963600329 3:147372930-147372952 ATTTTTTTGCAGAGAATGCCGGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964030453 3:152132618-152132640 AGAGGTTAGCAGAGGATGGCTGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964509877 3:157438437-157438459 AGTTTCTTGCTGAGAATGGGTGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969233599 4:5849577-5849599 ATGTGTTTGCAGAGGCTGGCAGG - Intronic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971001327 4:22326090-22326112 AGGTTTGTGCAGAGAGTGGCTGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972762204 4:42117783-42117805 TGGTTTTTGCAGAAGATGACAGG + Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972932042 4:44083718-44083740 ACTTTCTTGCAGAGAAAGGCTGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
973969396 4:56196618-56196640 AGTTTAGTGCAGAGGACGGATGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
974986838 4:69037917-69037939 AGCTTTTTGCATATGATGGTTGG + Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977266422 4:94861469-94861491 AGAATCTTGCAGAGGATGGATGG - Intronic
977354248 4:95925575-95925597 TTTTTTTTGCAGGGGAGGGCGGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979466682 4:121047696-121047718 AGTTTTTTGAAGAGTTTGGATGG + Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
979907902 4:126319807-126319829 ATTTTTTTGTTGAGGTTGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982722161 4:158870128-158870150 AGTTTTTTAAAGTGGAAGGCTGG - Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983584188 4:169338287-169338309 ATTATCTGGCAGAGGATGGCAGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984310818 4:178055705-178055727 AGTCTTTTGTAGAGGATGGATGG - Intergenic
984541847 4:181048365-181048387 ACTGTGTTGCAGAGAATGGCAGG + Intergenic
986042605 5:4008191-4008213 AGTCCTTTGCAGAGCAGGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986809719 5:11343507-11343529 ATTTTTTTTCAGAGGATGAATGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987962139 5:24824125-24824147 AGTTCTTTGCATAGGATGATGGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991038948 5:62156722-62156744 AGTATGTGGCAGAGGCTGGCTGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992856551 5:80867471-80867493 ACTCCTTAGCAGAGGATGGCAGG + Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993485228 5:88475812-88475834 AGTTTGTTGTAGAGGGTGGCTGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994385395 5:99125204-99125226 AGCTTTTTGCAGGGTAAGGCTGG - Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995388691 5:111615658-111615680 TGTTTTATGCACAGGAAGGCTGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
996887011 5:128369185-128369207 AATTTTTTGCAGGGCATGGCTGG + Exonic
998554966 5:143114428-143114450 AGTATATAACAGAGGATGGCGGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000325397 5:160168261-160168283 AGATTTTTGCAAAGTATCGCTGG - Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001585152 5:172828987-172829009 TGTTTTAAGCAGAGAATGGCTGG - Intergenic
1002567178 5:180118733-180118755 AGTTCTGTCCAGGGGATGGCCGG + Intronic
1002676057 5:180913789-180913811 AGTTATTCGTAGAGAATGGCAGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005114494 6:22320311-22320333 ATTTTTTTTCAGAGAATGGAAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005873200 6:29992795-29992817 GCTTTTTGGCAGGGGATGGCAGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008090987 6:47293715-47293737 AGTTTTAAGCAGAGGATGAAAGG - Intronic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009805624 6:68598457-68598479 AGTTCTTTGCAGAGGAAGCATGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017572761 6:155764970-155764992 AGATTTTTGAAGAGAATGGGAGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018090579 6:160344036-160344058 ATTTTTGTGCAGAGAATGGTGGG - Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022471424 7:30683823-30683845 AGGTTTATGTGGAGGATGGCAGG - Intronic
1023926292 7:44672273-44672295 TGTTCTTTGCAGAGGAGGGTGGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030479471 7:110084029-110084051 AGTTTTCTGCAAAGGATGCCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031904638 7:127447160-127447182 AGGTTTCTGCACAGGAGGGCTGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032840499 7:135709755-135709777 GGTTTTTTCTAGAGGATGCCAGG - Intronic
1033681211 7:143598464-143598486 AGTTTGTAGCAGAGGGTGGCGGG + Intergenic
1033703680 7:143863349-143863371 AGTTTGTAGCAGAGGGTGGCGGG - Exonic
1036392496 8:8336363-8336385 AGGTTTTTGCAGGGAATGGATGG - Intronic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042084081 8:65088851-65088873 AGTTTTATGCACAGGCTGCCTGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045810613 8:106216048-106216070 ACTTGTGTGCAGAGTATGGCTGG + Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046883810 8:119340504-119340526 TGCATTTTGCAGAGGATGTCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051486397 9:17613333-17613355 AGTTTTCAGCAGAGCATGGATGG - Intronic
1051762951 9:20488893-20488915 ATTTTATTACAGAGGCTGGCTGG - Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052002683 9:23305997-23306019 AATTTTTTTCAGGGGATGGGTGG + Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052577239 9:30305954-30305976 AGTTGTGTGCAGAGGATTACAGG - Intergenic
1053293898 9:36899729-36899751 AGTGACTTGCAGAGGATGCCTGG - Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062079076 9:134610098-134610120 AGTTTTTTACATAGGATGTGTGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186317495 X:8386613-8386635 ATTTTTTTGTAGAGGATTCCAGG + Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188556964 X:31423273-31423295 AATTTTTTTGAGAGGATGTCAGG + Intronic
1189124926 X:38436142-38436164 TGTTTTTTGCTGTGGATGGCAGG - Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189899276 X:45689271-45689293 AGTTATTTTCAGAGGAAGGAGGG - Intergenic
1189933352 X:46038660-46038682 AGTTTATGGAAGAGGAGGGCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191912373 X:66164508-66164530 ACGTTTTTGCACAGGAAGGCAGG - Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193927952 X:87513320-87513342 ATTTTTTTGTAGAGGATGTGTGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194597489 X:95876640-95876662 AGTTGTTGGCAGAGGTTTGCAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196333957 X:114507779-114507801 AGTTATTTCCAGAGGCTGGGAGG + Intergenic
1196723101 X:118873118-118873140 AGTTGCTTCCAGATGATGGCTGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199772992 X:150986039-150986061 TGTTCTTTGCAGACGATGTCCGG + Exonic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic