ID: 1195784560

View in Genome Browser
Species Human (GRCh38)
Location X:108505038-108505060
Sequence ATGCTACTCAACCACAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1409
Summary {0: 1, 1: 1, 2: 14, 3: 166, 4: 1227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195784555_1195784560 28 Left 1195784555 X:108504987-108505009 CCCATCAACCAAGGAGTAGATAA 0: 1
1: 39
2: 359
3: 1403
4: 2052
Right 1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG 0: 1
1: 1
2: 14
3: 166
4: 1227
1195784556_1195784560 27 Left 1195784556 X:108504988-108505010 CCATCAACCAAGGAGTAGATAAA 0: 1
1: 41
2: 397
3: 1597
4: 2908
Right 1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG 0: 1
1: 1
2: 14
3: 166
4: 1227
1195784557_1195784560 20 Left 1195784557 X:108504995-108505017 CCAAGGAGTAGATAAAGAAAATG 0: 2
1: 57
2: 387
3: 593
4: 1020
Right 1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG 0: 1
1: 1
2: 14
3: 166
4: 1227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195784560 Original CRISPR ATGCTACTCAACCACAAAAA AGG Intronic
900746511 1:4364488-4364510 ATACTATGCAGCCACAAAAAAGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901707306 1:11083961-11083983 ATACTACGCAGCCATAAAAAAGG - Intronic
903118037 1:21194202-21194224 ATACTACTCAGCCATAAAAAAGG - Intergenic
904298352 1:29538425-29538447 ATGCTACTGTGACACAAAAAAGG + Intergenic
905049526 1:35038173-35038195 AAGCTACTCAACTACAAATATGG + Intergenic
905051441 1:35054470-35054492 ATACTACACAGCCATAAAAAAGG - Intergenic
905112637 1:35607853-35607875 ATACTATTCATCCATAAAAAAGG + Intronic
906092523 1:43193388-43193410 ATGATACACACACACAAAAATGG - Intronic
906611113 1:47204057-47204079 ATACTATTCATCCATAAAAAAGG + Intergenic
906876654 1:49546216-49546238 ATACTACTCAGCCATAAAAAAGG - Intronic
906911647 1:49958501-49958523 ATACTATTCAGCCATAAAAAAGG + Intronic
907711587 1:56887790-56887812 ATACTATGCAGCCACAAAAAAGG + Intronic
908083587 1:60607102-60607124 ATACTACGCAGCCATAAAAAAGG + Intergenic
908451341 1:64258655-64258677 ATACTATGCAACCATAAAAAAGG - Intronic
908504527 1:64783064-64783086 ATACTACGCAGCCATAAAAAAGG - Intronic
908602007 1:65749949-65749971 ATACTACTCAGCCATAAAAAAGG + Intergenic
908619990 1:65967676-65967698 ATACTACGCAGCCATAAAAAAGG + Intronic
908797826 1:67848699-67848721 ATACTACTCAACAATAAAAAAGG - Intergenic
908922769 1:69216240-69216262 ATACTATGCAGCCACAAAAAAGG - Intergenic
909098494 1:71320204-71320226 ATACTATTCAGCCATAAAAAGGG - Intergenic
909123059 1:71628748-71628770 ATACTACTCAGCCATAAAAAAGG - Intronic
909230407 1:73081970-73081992 ATACTACGCAGCCATAAAAAAGG - Intergenic
909310258 1:74137750-74137772 ATACTATTCAGCCATAAAAAAGG + Intronic
909396469 1:75176005-75176027 ATACTATGCAGCCACAAAAAAGG - Intergenic
909449602 1:75784084-75784106 ATACTATGCAACCATAAAAAAGG + Intronic
909498960 1:76311614-76311636 ATACTACACAGCCATAAAAAAGG - Intronic
909524906 1:76612131-76612153 ATTCTATACAATCACAAAAAGGG - Intronic
909634203 1:77797131-77797153 ATGTTACTCATCAACAAAAAAGG - Intronic
909676757 1:78247094-78247116 ATACTATTCAGCCATAAAAAAGG - Intergenic
909689737 1:78393905-78393927 ATACTATTCAGCCATAAAAAAGG - Intronic
910523724 1:88153558-88153580 ATACTATGCAACCATAAAAAAGG + Intergenic
910531703 1:88243575-88243597 ATACTATGCAACCATAAAAAAGG + Intergenic
910744321 1:90556952-90556974 ATACTATGCAACCATAAAAAAGG + Intergenic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
911313607 1:96328516-96328538 ATACTATTCAGCCATAAAAAAGG + Intergenic
911678394 1:100685262-100685284 ATACTATGCAACCATAAAAAAGG - Intergenic
911823993 1:102457639-102457661 ATACTACGCAGCCATAAAAAAGG + Intergenic
911891397 1:103377117-103377139 ATACTACACAGCCATAAAAAAGG + Intergenic
912162015 1:106996744-106996766 ATACTACGCAGCCATAAAAAAGG - Intergenic
912609873 1:111031944-111031966 ATCCTACTATACCACAAAAGTGG - Intergenic
912636705 1:111301387-111301409 ATGCTATGCAGCCATAAAAAAGG + Intronic
912719970 1:112011859-112011881 ATGCTACTCACCCACCACAATGG + Intergenic
912872219 1:113318831-113318853 ATACTATGCAACCATAAAAAAGG + Intergenic
913152554 1:116059469-116059491 ATATTAGTCAACAACAAAAAAGG + Intronic
913154843 1:116085835-116085857 ATACTACTCTGCCATAAAAAGGG - Intergenic
913401072 1:118433620-118433642 ATGCTAATCAACAAATAAAATGG - Intergenic
913558991 1:119999023-119999045 ATACTATTCAGCCATAAAAAAGG - Intronic
913638864 1:120791454-120791476 ATACTATTCAGCCATAAAAAAGG + Intergenic
913712707 1:121501982-121502004 ATACTATGCAGCCACAAAAAAGG + Intergenic
914219516 1:145666887-145666909 ATACTATCCAGCCACAAAAAAGG - Intronic
914279594 1:146158499-146158521 ATACTATTCAGCCATAAAAAAGG - Intronic
914540635 1:148609429-148609451 ATACTATTCAGCCATAAAAAAGG - Intronic
914626005 1:149461789-149461811 ATACTATTCAGCCATAAAAAAGG + Intergenic
915020269 1:152772399-152772421 ATACTATGCAACCACAAAAAAGG - Intronic
915047228 1:153028428-153028450 ATACTATACAACCATAAAAAAGG + Intergenic
915191828 1:154157324-154157346 TTGCTACAAAACAACAAAAAAGG + Intronic
915807541 1:158870461-158870483 ATACTATACAACCAAAAAAAAGG + Intergenic
915995407 1:160557779-160557801 AAGCTACTGAACCACAGAGATGG - Intronic
916314382 1:163432252-163432274 ATACTACGCAGCCATAAAAAAGG - Intergenic
916381962 1:164221831-164221853 ATACTATGCAACCATAAAAAAGG + Intergenic
916549367 1:165835005-165835027 CTGCTAGTCAGCCAAAAAAAAGG - Intronic
916906514 1:169291317-169291339 ATACTATGCAACCATAAAAATGG + Intronic
917079899 1:171247017-171247039 ATACTACTCAGCCATAAAAAGGG - Intergenic
917129278 1:171724130-171724152 ATACTACGCAGCCATAAAAAAGG + Intronic
917169061 1:172149315-172149337 ATGCTACTGAAATATAAAAATGG - Intronic
917424125 1:174895776-174895798 ATACTATGCAGCCACAAAAAAGG - Intronic
917501485 1:175589654-175589676 ATACTACACAGCCATAAAAAAGG + Intronic
917560932 1:176154445-176154467 ATGCTATGCAGCCATAAAAAAGG + Intronic
917617102 1:176757041-176757063 ATACTATGCAGCCACAAAAAAGG - Intronic
917715490 1:177732841-177732863 ATACTACTCAGCCTAAAAAAAGG + Intergenic
917764009 1:178198033-178198055 ATACTAAGCAGCCACAAAAAAGG - Intronic
917907481 1:179601599-179601621 ATACTACTCAGCCATAAAAAAGG - Intronic
917957200 1:180111701-180111723 GTGCTGCTCAACTACAATAATGG - Exonic
918088536 1:181266306-181266328 ATACTATGCAGCCACAAAAAAGG - Intergenic
918178572 1:182066691-182066713 ATGCTCCTCACCCATAAAATGGG + Intergenic
918428215 1:184432326-184432348 ATACTATGCAACCATAAAAAAGG + Intronic
918642317 1:186857936-186857958 ATACTATGCAGCCACAAAAAAGG - Intronic
918666899 1:187162606-187162628 ATACTACTCAGCCATAAAACGGG - Intergenic
918742159 1:188145881-188145903 ATACTATTCAGCCATAAAAAAGG - Intergenic
918773159 1:188590513-188590535 CTACTACTCAGCCATAAAAAAGG - Intergenic
918832030 1:189410969-189410991 ATACTATTCAGCCATAAAAAAGG - Intergenic
919052757 1:192531771-192531793 ATACTATGCAACCATAAAAAAGG - Intergenic
919073946 1:192791376-192791398 ATGCTATGCAGCCATAAAAAAGG + Intergenic
919150467 1:193690642-193690664 ATACTATGCAACCATAAAAAAGG - Intergenic
919164640 1:193876661-193876683 ATACTACGCAGCCATAAAAAAGG + Intergenic
919293832 1:195668771-195668793 ATACTATGCAACCATAAAAAAGG - Intergenic
919517524 1:198545386-198545408 ATACTACACAGCCACTAAAAAGG - Intergenic
919986684 1:202680640-202680662 ATCCTACTTAACCACACAATTGG + Intronic
920383992 1:205554600-205554622 ATACTATTCAGCCATAAAAAAGG + Intergenic
920600525 1:207320322-207320344 ATACTACACAGCCATAAAAAAGG + Intergenic
921191606 1:212713891-212713913 ATACTACTCAGCAACAAAAAAGG - Intergenic
921819234 1:219597777-219597799 ATACTACGCAGCCACAACAAAGG + Intergenic
921915488 1:220605848-220605870 ATACTACGCAGCCATAAAAAAGG - Intronic
921980921 1:221257787-221257809 ATACTACGCAGCCATAAAAAAGG - Intergenic
922186924 1:223283888-223283910 ATACTACGCAGCCATAAAAAAGG + Intronic
922187021 1:223284663-223284685 ATACTATTCATCCATAAAAAAGG + Intronic
922622382 1:226999756-226999778 ATACTATGCAACCATAAAAAAGG + Intronic
923192883 1:231637138-231637160 ATACTATGCAACCATAAAAAAGG - Intronic
923193912 1:231645846-231645868 ATACTACGCAGCCATAAAAAAGG - Intronic
923202889 1:231729175-231729197 ATACTACGCAGCCATAAAAAAGG - Intronic
923451485 1:234121897-234121919 ATACTATTCAGCCATAAAAAAGG - Intronic
923476733 1:234340870-234340892 ATATTATTCAACCATAAAAAAGG + Intergenic
924011070 1:239665851-239665873 ATACTATGCAACCATAAAAAAGG - Intronic
924203168 1:241681455-241681477 ATACTACTTAGCCATAAAAAGGG - Intronic
924243101 1:242058370-242058392 ATACTATGCAACCATAAAAAAGG - Intergenic
924321610 1:242856087-242856109 ATACTACTCAGCCATAAAAAGGG - Intergenic
924636928 1:245797334-245797356 ATACTATGCAGCCACAAAAAAGG + Intronic
1062788386 10:284405-284427 ATATTACTCAGCCATAAAAAAGG + Intronic
1062987594 10:1783664-1783686 ATACTACGCAGCCATAAAAAAGG - Intergenic
1063470965 10:6284922-6284944 ATGTTATTCAACCTTAAAAATGG - Intergenic
1064521448 10:16207101-16207123 ATACTACTAAGCCATAAAAAGGG - Intergenic
1064796409 10:19016774-19016796 ATACTATGCAGCCACAAAAAAGG + Intergenic
1064797780 10:19032948-19032970 ATACTATGCAGCCACAAAAAAGG + Intergenic
1064910592 10:20397643-20397665 ATACTATTCAGCCATAAAAAAGG + Intergenic
1065355059 10:24832615-24832637 ATACTATGCAACCATAAAAAAGG - Intergenic
1065465303 10:26013929-26013951 ATACTACTCAGCCATTAAAAGGG + Intronic
1065803955 10:29377952-29377974 ATACTACTCAGCCATTAAAATGG - Intergenic
1066086984 10:31980664-31980686 ATACTACGCAGCCATAAAAAAGG - Intergenic
1066089241 10:32001642-32001664 CTGTTCCTCAACCACAATAAGGG - Intergenic
1066155006 10:32666709-32666731 ATAATACGCAACCATAAAAAAGG - Intronic
1066169071 10:32821618-32821640 ATACTATGCAACCATAAAAAAGG + Intronic
1066295852 10:34053914-34053936 ATACTACACAGCCATAAAAAAGG - Intergenic
1066442569 10:35452121-35452143 CTGGTACTCAACAGCAAAAAAGG - Intronic
1066471661 10:35703663-35703685 ATGTTACACAAAAACAAAAATGG - Intergenic
1066525672 10:36276555-36276577 ATACTACGCAGCCATAAAAAAGG + Intergenic
1066699415 10:38111140-38111162 ATGCTATGCAGCCATAAAAAAGG + Intronic
1068154563 10:53181574-53181596 AAACTACTCAGCCACTAAAAGGG + Intergenic
1068345704 10:55775448-55775470 ATACTACACAGCCATAAAAAAGG + Intergenic
1068407681 10:56612418-56612440 ATACTACACAGCCATAAAAAAGG + Intergenic
1068566686 10:58583552-58583574 ATACTACTCAGCCATAAAAAAGG - Intronic
1068640444 10:59399087-59399109 ATACTATGCAACCATAAAAAAGG - Intergenic
1068979725 10:63049505-63049527 ATACTATGCAACCATAAAAAAGG - Intergenic
1069038016 10:63665478-63665500 ATGTTACTAAAACACAACAACGG + Intergenic
1069039528 10:63680714-63680736 ATACTATGCAGCCACAAAAAAGG - Intergenic
1069710901 10:70488061-70488083 ATACTACTCACCAATAAAAAAGG - Intronic
1069734042 10:70639813-70639835 ATACTATGCAACCATAAAAAAGG - Intergenic
1070246216 10:74733803-74733825 ATAGTATTCAGCCACAAAAAAGG - Intergenic
1071149067 10:82611602-82611624 ATACTACGCAGCCATAAAAAAGG - Intronic
1071350261 10:84733549-84733571 ATGCTATGCAGCCATAAAAAGGG + Intergenic
1071487720 10:86113917-86113939 AAGCTACCCAACAACAAAATAGG + Intronic
1071585081 10:86812354-86812376 ATGATAATCAACCACAGAAAGGG - Intronic
1071668125 10:87580328-87580350 ATACTACACAGCCATAAAAAAGG - Intergenic
1071669147 10:87590879-87590901 ATACTATACAACCATAAAAAAGG - Intergenic
1071932043 10:90483455-90483477 ATACCACTCAGCCATAAAAAAGG - Intergenic
1072387490 10:94946170-94946192 ATACTACACAGCCATAAAAAAGG + Intronic
1072739536 10:97901187-97901209 AAGCCACACTACCACAAAAAGGG - Intronic
1072891269 10:99327429-99327451 ATGCTACTCAGCCATACAAAAGG + Intergenic
1073840179 10:107489848-107489870 ATAGTATTCAACAACAAAAAAGG + Intergenic
1073850281 10:107608644-107608666 ATACTACTCAAATACAAAAAGGG + Intergenic
1074031075 10:109688777-109688799 ATGTTACTCAACTATACAAAGGG - Intergenic
1074194321 10:111167726-111167748 ATACTATGCAGCCACAAAAAAGG - Intergenic
1074280208 10:112044396-112044418 ATACTACACAGCCATAAAAAAGG + Intergenic
1074370526 10:112897567-112897589 ATACTACTCAGCCATAAAGAAGG + Intergenic
1074548550 10:114421714-114421736 ATATTACTCAACAACAAAAAGGG - Intergenic
1074794962 10:116933501-116933523 ATACTACACAGCCATAAAAAAGG - Intronic
1074887928 10:117709229-117709251 ATACTATTCAGCCACAAAAAAGG + Intergenic
1074959632 10:118430374-118430396 ATACTACGCAGCCATAAAAACGG + Intergenic
1075486827 10:122829347-122829369 ATTCTACTCAACTCCTAAAAGGG - Intergenic
1075982272 10:126750257-126750279 ATACTACTCAGCCATAAAAAGGG - Intergenic
1077276449 11:1712874-1712896 ATACTGCTCAGCCATAAAAACGG - Intergenic
1077574341 11:3369543-3369565 ATATTACTCAGCCATAAAAAAGG + Intronic
1077696300 11:4395991-4396013 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1077759552 11:5077267-5077289 GAGTTACTCTACCACAAAAAGGG + Intergenic
1077840897 11:5973724-5973746 AGCCTGCTCAACCACAAAATAGG - Intergenic
1078644847 11:13131506-13131528 ATTCTATGCAACCATAAAAAAGG + Intergenic
1078711870 11:13800356-13800378 ATACTATGCAACCACAAAAAAGG + Intergenic
1078780521 11:14434726-14434748 ATACTATGCAGCCACAAAAATGG + Intergenic
1078813552 11:14796209-14796231 ATACTACGCAGCCATAAAAAAGG - Intronic
1079704643 11:23598879-23598901 ATACTACTCAGCCATAAAAAAGG - Intergenic
1079749931 11:24184677-24184699 ATACTATGCAGCCACAAAAAAGG + Intergenic
1079756260 11:24267765-24267787 ATACTACGCAGCCATAAAAAAGG - Intergenic
1079929844 11:26544219-26544241 ATACTACTTAACCTTAAAAAAGG - Intronic
1080324586 11:31055658-31055680 ATACTACTCAGTCATAAAAAAGG + Intronic
1080884259 11:36350873-36350895 ATACTACTCAGCCGTAAAAAGGG - Intronic
1081225646 11:40518901-40518923 ATACTATGCAGCCACAAAAAAGG + Intronic
1081227210 11:40538466-40538488 ATACTAAGCAGCCACAAAAAAGG - Intronic
1081267560 11:41044974-41044996 ATGTTAATGAACTACAAAAAGGG - Intronic
1081507691 11:43735106-43735128 ATATTATTCAGCCACAAAAAGGG - Intronic
1081586867 11:44391194-44391216 ATACTATGCAACCATAAAAAAGG - Intergenic
1081618724 11:44605871-44605893 ATGCCACTCACCCACAAATGAGG + Intronic
1081629454 11:44678975-44678997 ATACTACTCAGCCGTAAAAAAGG - Intergenic
1082111184 11:48276363-48276385 ATTCTTCTAATCCACAAAAATGG + Intergenic
1082135296 11:48542320-48542342 ATACTATGCAACCATAAAAAAGG - Intergenic
1082149794 11:48723288-48723310 ATACTAATCAACCAAAAGAATGG - Intergenic
1082196533 11:49313372-49313394 ATGCTATGCAGCCATAAAAACGG + Intergenic
1082304932 11:50560651-50560673 ATACTATGCAGCCACAAAAAAGG - Intergenic
1082673088 11:56059113-56059135 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1082714886 11:56600106-56600128 ATACTACTCAGCCATAAAAAGGG - Intergenic
1082885828 11:58081151-58081173 ATACTATGCAGCCACAAAAAAGG - Intronic
1082951575 11:58821747-58821769 ATACTATTCAGCCATAAAAAGGG + Intergenic
1083003151 11:59315804-59315826 ATACTACGCAGCCATAAAAAAGG - Intergenic
1083917647 11:65759607-65759629 ATACTACTCAGCAATAAAAAAGG - Intergenic
1084311048 11:68316580-68316602 ATATTATTCAGCCACAAAAAGGG - Intronic
1084379457 11:68801947-68801969 ACACTATTCAGCCACAAAAAGGG + Intronic
1084467266 11:69332928-69332950 ATAATACTCAATCACAAAGAAGG - Intronic
1084570603 11:69957373-69957395 GTGTTATTCAGCCACAAAAAAGG - Intergenic
1084740509 11:71136298-71136320 ATACTACTCAGCCATAAAAAAGG + Intronic
1084792457 11:71483165-71483187 ATATTATTCACCCACAAAAAGGG - Intronic
1086328772 11:85732399-85732421 ATACTATGCCACCACAAAAAAGG + Intronic
1086333439 11:85776584-85776606 ATACTATGCAGCCACAAAAAAGG - Intronic
1086382370 11:86269837-86269859 ATACTACTCAGCAATAAAAAAGG - Intronic
1086789341 11:91016004-91016026 ATACTATTCAGCCATAAAAAAGG - Intergenic
1086846050 11:91750889-91750911 ATACTACTCAGCCATAAAAAGGG - Intergenic
1087052585 11:93901326-93901348 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1087228066 11:95626656-95626678 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1087260980 11:96012118-96012140 ATGCTACTGCAGCTCAAAAACGG - Intronic
1087356251 11:97098015-97098037 AGGCTACTGAACCAGAATAATGG - Intergenic
1087359030 11:97134692-97134714 ATACTATGCAGCCACAAAAAAGG + Intergenic
1087408176 11:97755170-97755192 ATGCTGCTCACCCACAGAGAGGG + Intergenic
1087733277 11:101802585-101802607 ATACTACGCAGCCATAAAAAGGG + Intronic
1087956868 11:104299308-104299330 ATGCTAAGCAGCCATAAAAAAGG - Intergenic
1088122607 11:106387681-106387703 ATACTACGCAGCCATAAAAAAGG - Intergenic
1088148970 11:106721030-106721052 ATGCTTCTCCACCAATAAAAAGG + Intronic
1088150351 11:106737732-106737754 ATACTATGCAACCATAAAAAAGG - Intronic
1088162029 11:106883847-106883869 ATACTACGCAGCCATAAAAAAGG + Intronic
1088800560 11:113303097-113303119 ATACTATTCAGCCACAAAAAAGG + Intergenic
1089106957 11:116018303-116018325 ATATTACTCAACCTTAAAAAAGG - Intergenic
1090125921 11:124084108-124084130 ATACTACTCAGCCTCAAAAAGGG + Intergenic
1090148240 11:124351643-124351665 ATACTATTCAGCCATAAAAAAGG + Intergenic
1090559033 11:127909864-127909886 ATACTACTCAGCCATAAAAATGG - Intergenic
1090724274 11:129509243-129509265 ATACTACACAGCCATAAAAAAGG - Intergenic
1090752165 11:129756577-129756599 ATACTACGCAGCCATAAAAAAGG + Intergenic
1090911533 11:131123716-131123738 ATATTATTCAACCAGAAAAAAGG - Intergenic
1090974218 11:131668039-131668061 CAGCTTCTCAACCACAAAATAGG - Intronic
1091012694 11:132020171-132020193 ATACTACGCAGCCATAAAAAAGG - Intronic
1091282281 11:134388790-134388812 ATACTACACAGCCATAAAAAAGG - Exonic
1091767164 12:3129102-3129124 ATATTACTCAGCCATAAAAAGGG - Intronic
1091944436 12:4523616-4523638 ATACTACGCAGCCATAAAAAAGG + Intronic
1091994955 12:4986262-4986284 AGGTTACCCAACCACCAAAATGG - Intergenic
1092661522 12:10743620-10743642 ATACTATGCAGCCACAAAAAAGG - Intergenic
1092798998 12:12144720-12144742 ATACTATGCAACCATAAAAAAGG + Intronic
1093210196 12:16298796-16298818 ATGCTATTCAGACATAAAAATGG + Intergenic
1093419465 12:18958185-18958207 GTGCTATTCAGCCATAAAAAAGG - Intergenic
1093553624 12:20445378-20445400 ATGCTACTTAACTCCAAAAAGGG - Intronic
1093744771 12:22727865-22727887 ATGCTACTCAGCAACACAATGGG + Intergenic
1094037171 12:26083851-26083873 ATACTATGCAGCCACAAAAAAGG + Intergenic
1094261017 12:28499678-28499700 ATACTATGCAACCATAAAAAAGG - Intronic
1094312326 12:29097967-29097989 ATACTAGTCAGCCATAAAAAAGG + Intergenic
1094345681 12:29465904-29465926 ATACTACACAGCCATAAAAAAGG + Intronic
1094858094 12:34427356-34427378 AAGCTACTCAATCAAAAGAAAGG + Intergenic
1094876839 12:34657064-34657086 AAACTACTCAATCACAAGAAAGG - Intergenic
1094877097 12:34661236-34661258 AAGCTTCTCAATCACAAGAAAGG - Intergenic
1095070888 12:37844272-37844294 ATACTGCTCAATCACAAAACAGG + Intergenic
1095118231 12:38381959-38381981 ATACTACGCAGCCATAAAAAAGG - Intergenic
1095121280 12:38423111-38423133 ATACTACTCAGCCATAAAAAGGG + Intergenic
1095122918 12:38440801-38440823 AAGTTAATCAACCCCAAAAAGGG + Intergenic
1095140942 12:38661265-38661287 ATACTATGCAACCATAAAAAAGG + Intronic
1095157049 12:38870449-38870471 ATGCTATGCAGCCATAAAAAAGG + Intronic
1095239312 12:39838148-39838170 ATACTACGCAGCCATAAAAAAGG + Intronic
1095647325 12:44562973-44562995 ATACTACGCAGCCATAAAAAAGG + Intronic
1095705896 12:45236562-45236584 ATACTATGCAACCATAAAAAAGG - Intronic
1095831795 12:46595626-46595648 ATACTATGCAACCATAAAAAAGG - Intergenic
1095883257 12:47161920-47161942 ATGCTATGCAGCCATAAAAAAGG + Intronic
1096894460 12:54806957-54806979 ATACTATGCAGCCACAAAAAAGG - Intergenic
1097370949 12:58779966-58779988 ATACTATGCAGCCACAAAAAAGG - Intronic
1097426699 12:59454645-59454667 ATACTACTCAGCCATAAAAAAGG + Intergenic
1097729451 12:63111041-63111063 ATACTATGCAACCATAAAAAAGG - Intergenic
1097743173 12:63269391-63269413 ATACTATGCAGCCACAAAAAAGG - Intergenic
1097750090 12:63342657-63342679 ATACTATGCAACCATAAAAAAGG + Intergenic
1098200151 12:68045670-68045692 ATACTATGCAACCATAAAAAAGG - Intergenic
1098277173 12:68824743-68824765 ATTCATCTCAACCAAAAAAAGGG - Intronic
1098303046 12:69074017-69074039 ATACTACTCAGCCATAAAAAGGG + Intergenic
1098529116 12:71520524-71520546 ATACTACGCAGCCATAAAAAAGG + Intronic
1098682226 12:73370394-73370416 ATACTATGCAACCATAAAAAAGG - Intergenic
1098688153 12:73451754-73451776 ATACTATGCAACCATAAAAAAGG - Intergenic
1098717365 12:73847512-73847534 ATACTATGCAACCATAAAAAGGG + Intergenic
1098776690 12:74629390-74629412 ATACTACACAGCCATAAAAAAGG - Intergenic
1098932297 12:76433572-76433594 ATTCTTCTGATCCACAAAAATGG - Intronic
1098982211 12:76968885-76968907 ATACTACTCAGCCATAAAAAAGG - Intergenic
1099070768 12:78043265-78043287 ATACTATGCAACCATAAAAATGG - Intronic
1099168793 12:79339002-79339024 ATACTACGCAGCCATAAAAAAGG - Intronic
1099173444 12:79393138-79393160 ATACTATGCAGCCACAAAAAAGG - Intronic
1099462041 12:82934562-82934584 ATACTACACAGCCATAAAAAAGG - Intronic
1099470994 12:83047864-83047886 TTGCTGTTCAACAACAAAAAAGG - Intronic
1099484281 12:83208907-83208929 ATACTACGCAGCCATAAAAAAGG - Intergenic
1099490273 12:83280555-83280577 ATACTACACAGCCATAAAAAAGG + Intergenic
1099540198 12:83898737-83898759 ATACTACACAGCCATAAAAAAGG - Intergenic
1099710894 12:86223377-86223399 CTGCTACCCAAGGACAAAAAAGG + Intronic
1099753404 12:86807459-86807481 ATACTATGCAGCCACAAAAAAGG - Intronic
1099913361 12:88861044-88861066 TTGCTACTGGACCACAAAAATGG - Intergenic
1100415015 12:94362840-94362862 ATACTATTCAGCCATAAAAAAGG + Intronic
1100554363 12:95677993-95678015 ATACTACGCAGCCATAAAAAAGG + Intronic
1100954673 12:99893823-99893845 ATACTACACAGCCATAAAAAAGG - Intronic
1101075367 12:101123654-101123676 ATACTATGCAACCATAAAAAGGG - Intronic
1101103098 12:101414009-101414031 ATACTATGCAACCATAAAAAAGG + Intergenic
1101195937 12:102382193-102382215 ATGCTACTCAGCCATAAATAAGG - Intergenic
1101299498 12:103463908-103463930 ATACTATGCAGCCACAAAAAAGG - Intronic
1101600724 12:106207132-106207154 ATACTATGCAGCCACAAAAAAGG - Intergenic
1102142787 12:110629898-110629920 ATGCTAAGCAGCCATAAAAAAGG + Intronic
1102540482 12:113615698-113615720 ATACTACTCAGCCATGAAAAGGG + Intergenic
1102937530 12:116910426-116910448 ATACTACTCAGCCATAAAAAAGG - Intergenic
1103796850 12:123509250-123509272 ATGTTACTCAGCCTTAAAAAAGG + Intronic
1104344015 12:127979524-127979546 ATTCTACTCAGCCATAAAAAAGG + Intergenic
1104825518 12:131706022-131706044 ATACTATTTAGCCACAAAAAAGG + Intergenic
1105030839 12:132882442-132882464 ATGGAACTGAACCCCAAAAAAGG + Intronic
1105666521 13:22564147-22564169 ATACTATTCAGCCATAAAAAAGG - Intergenic
1105686234 13:22784935-22784957 ATGCTACACAGCCATAAAAAAGG + Intergenic
1105961354 13:25343769-25343791 ATACTACACAGCCACTAAAAAGG - Intronic
1106561506 13:30850394-30850416 ATACTACACAGCCATAAAAAAGG - Intergenic
1106686937 13:32070047-32070069 ATACTATGCAGCCACAAAAAAGG - Intronic
1106750583 13:32761640-32761662 ATACTACGCAGCCATAAAAAAGG - Intronic
1106831655 13:33590506-33590528 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1107132031 13:36907039-36907061 ATACTACACAACCATTAAAAAGG + Intronic
1107134983 13:36933968-36933990 ATACTACTCAGCAACCAAAAGGG - Intergenic
1107322747 13:39206651-39206673 ATACTATGCAGCCACAAAAAAGG - Intergenic
1107365740 13:39672581-39672603 ATACTATTCAGCCATAAAAAAGG - Intronic
1107406015 13:40114210-40114232 ATGCTGCTCTACGACTAAAATGG + Intergenic
1107504726 13:41022218-41022240 ATGCTACTCAGCAACAAAAAAGG + Intronic
1108134873 13:47345245-47345267 ATACTACTCAGCCATAAAAAAGG + Intergenic
1108661532 13:52592303-52592325 ATACTACGCAACCATTAAAAAGG + Intergenic
1108873810 13:55019780-55019802 ATACTACTCAGCCATAACAAAGG + Intergenic
1109000149 13:56790830-56790852 ATACTACTCAGCAATAAAAAAGG - Intergenic
1109176503 13:59164101-59164123 ATACAACTCAACAATAAAAAAGG + Intergenic
1109216570 13:59596428-59596450 ATACTATGCAGCCACAAAAAAGG + Intergenic
1109317698 13:60769988-60770010 ATACTACGCAGCCATAAAAAAGG - Intergenic
1109816724 13:67594125-67594147 ATACTACACAGCCATAAAAAGGG + Intergenic
1109887431 13:68560132-68560154 ATGCTCTTCATCCATAAAAATGG - Intergenic
1109891730 13:68622918-68622940 ATACTATGCAACCATAAAAAAGG + Intergenic
1109904370 13:68819234-68819256 ATACTATTCAGCCACATAAAAGG + Intergenic
1109905815 13:68839689-68839711 ATACTACTTAGCCATAAAAAAGG - Intergenic
1110023171 13:70501909-70501931 TTGCTACAAAACAACAAAAAAGG + Intergenic
1110122546 13:71901165-71901187 ATACTACTCAGCCATACAAAGGG - Intergenic
1110136003 13:72068049-72068071 ATACTATGCAGCCACAAAAAAGG + Intergenic
1110178765 13:72590257-72590279 ATATTAGTCAGCCACAAAAATGG + Intergenic
1110382883 13:74874882-74874904 ATACTACGCAGCCATAAAAAAGG + Intergenic
1110424165 13:75346481-75346503 ATGCTATGCAGCCATAAAAAAGG - Intronic
1110663094 13:78081781-78081803 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1110727143 13:78838696-78838718 ATGCTACACAGCCATAAAAAAGG - Intergenic
1111281107 13:86026476-86026498 ATACTACTCAGCCATTAAAAAGG - Intergenic
1111323146 13:86656830-86656852 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1111893149 13:94108194-94108216 ATACTACTCAGCCATAAAAAAGG + Intronic
1112828332 13:103418288-103418310 ATACTACGCAGCCATAAAAAGGG + Intergenic
1112860467 13:103824296-103824318 ATACTATGCAACCATAAAAAAGG - Intergenic
1113044270 13:106138001-106138023 ATGCAACTCAACAATATAAAGGG + Intergenic
1113251174 13:108454423-108454445 ATACTAGTCAACCATAGAAAAGG - Intergenic
1113260449 13:108555929-108555951 ATACTATTCAACAACAAAGAAGG - Intergenic
1113676714 13:112212730-112212752 ATACTATTCAGCCATAAAAAAGG + Intergenic
1113720642 13:112553442-112553464 ATGCTGCTTAGCCACAAAGAAGG + Intronic
1114001563 14:18256222-18256244 AAACTACTCAACCAAAAGAAAGG + Intergenic
1114037581 14:18644747-18644769 ATACTATGCAGCCACAAAAAGGG - Intergenic
1114121054 14:19670300-19670322 ATACTATGCAGCCACAAAAAGGG + Intergenic
1114366516 14:22032851-22032873 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1114580742 14:23757049-23757071 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1114818182 14:25984989-25985011 ATACTATGCAGCCACAAAAAAGG + Intergenic
1114914684 14:27248541-27248563 ATACTACACAGCCATAAAAAAGG - Intergenic
1114943621 14:27649771-27649793 ATACTATGCAGCCACAAAAAAGG + Intergenic
1115041679 14:28938243-28938265 ATACTATGCAGCCACAAAAAAGG - Intergenic
1115116760 14:29889546-29889568 ATACTAAGCAGCCACAAAAAAGG + Intronic
1115362811 14:32522983-32523005 ATGCTATGCAGCCACAAAAAAGG + Intronic
1115525271 14:34273885-34273907 ATACTATGCAACCATAAAAAAGG + Intronic
1115584718 14:34799041-34799063 ATACTATGCAGCCACAAAAAAGG + Intronic
1115799924 14:36981495-36981517 ATGCTATGCAGCCATAAAAAAGG + Intronic
1115896677 14:38096240-38096262 ATACTATGCAGCCACAAAAAGGG + Intergenic
1116025503 14:39509370-39509392 ATACTACTCAGCCATAAAAAGGG + Intergenic
1116041702 14:39693831-39693853 ATACTACACAGCCATAAAAAAGG + Intergenic
1116213350 14:41976706-41976728 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1116259398 14:42603366-42603388 ATACTATGCAGCCACAAAAAAGG - Intergenic
1116361619 14:44005385-44005407 ATACTAGTCAGCCATAAAAAAGG + Intergenic
1116554303 14:46283970-46283992 ATACTATGCAACCATAAAAAAGG - Intergenic
1116652330 14:47609400-47609422 ATACTACTCAGCCATAGAAAAGG - Intronic
1116732463 14:48641484-48641506 ATACTACTCAGCCATAAAAAAGG + Intergenic
1117239647 14:53816983-53817005 ATACTATGCAACCATAAAAAAGG + Intergenic
1117272068 14:54154819-54154841 ATACTATGCAACCATAAAAAAGG - Intergenic
1117290090 14:54324044-54324066 ATACTACTCAGCCATAAAAAGGG + Intergenic
1117311047 14:54523541-54523563 ATTCTACTCAAAAAAAAAAAAGG - Intronic
1117489708 14:56234408-56234430 ATACTATACAGCCACAAAAAAGG + Intronic
1117613958 14:57513820-57513842 ATACTACGCAGCCATAAAAAAGG - Intergenic
1117617733 14:57550921-57550943 ATTCTATGCAACCATAAAAAAGG - Intergenic
1118020452 14:61707640-61707662 ATACTATTCAGCCATAAAAAAGG - Intronic
1118545223 14:66879014-66879036 ATGCTATGCAGCCATAAAAAAGG + Intronic
1118891316 14:69911688-69911710 ATACTACTCAGCCAATAAAAAGG - Intronic
1119016734 14:71064951-71064973 ATACTACGCATCCATAAAAAAGG - Intronic
1119131740 14:72179222-72179244 ATGCATTTCAGCCACAAAAAGGG - Intronic
1120041895 14:79763204-79763226 ATACTATGCAACCATAAAAAAGG - Intronic
1120086762 14:80284378-80284400 ATACTATGCAACCATAAAAATGG - Intronic
1120218572 14:81706763-81706785 ATACTACGCAGCCATAAAAAAGG - Intergenic
1120496814 14:85248058-85248080 ATACTACGCAGCCATAAAAAAGG - Intergenic
1120742407 14:88122539-88122561 ATACTACGCAGCCATAAAAAAGG - Intergenic
1121218829 14:92269806-92269828 ATACTAGTCAGCCATAAAAAAGG - Intergenic
1122002522 14:98672092-98672114 ATACTACTCAGCCATAAAAAGGG - Intergenic
1122247449 14:100413884-100413906 ATACTACTCAGCAATAAAAAGGG - Intronic
1122373279 14:101241327-101241349 ATATTACTCAGCCATAAAAAAGG + Intergenic
1123407749 15:20032267-20032289 ATACTACACAGCCATAAAAAAGG - Intergenic
1123453495 15:20391443-20391465 ATTCTACTCAAACACATGAATGG - Intergenic
1123517075 15:21038921-21038943 ATACTACACAGCCATAAAAAAGG - Intergenic
1123772505 15:23542576-23542598 ATATTACTCAGCCATAAAAAAGG - Intergenic
1124442204 15:29694978-29695000 CTTGTACTCGACCACAAAAAAGG + Intergenic
1124802407 15:32846866-32846888 ATACTATGCAACCATAAAAAAGG + Intronic
1124936015 15:34171743-34171765 ATACTACGCAGCCATAAAAAAGG + Intronic
1125119072 15:36131587-36131609 AAAAGACTCAACCACAAAAATGG + Intergenic
1125158289 15:36614493-36614515 TTGCTACAAAACAACAAAAAAGG - Intronic
1125277352 15:38007333-38007355 AGGATACTCTAACACAAAAATGG + Intergenic
1125311164 15:38379454-38379476 ATACTATGCAGCCACAAAAAAGG - Intergenic
1125313334 15:38403993-38404015 ATACTACTCAGCCATGAAAAAGG - Intergenic
1125490071 15:40140638-40140660 ATACTACGCAGCCATAAAAAAGG + Intergenic
1126184097 15:45813990-45814012 ATACTACTCAGCCACAACAAGGG - Intergenic
1126347780 15:47715323-47715345 ATGCTAATAAACCACAACAATGG + Intronic
1126430847 15:48582718-48582740 ATGCAAGTACACCACAAAAATGG - Intronic
1126569284 15:50132767-50132789 ATACTATGCAGCCACAAAAAAGG + Intronic
1126720510 15:51573503-51573525 ATACTACACAGCCATAAAAAAGG + Intronic
1126869100 15:52968570-52968592 AGCCTTCTCATCCACAAAAATGG - Intergenic
1127136858 15:55933337-55933359 ATACTACTCATCCATAAAAAAGG + Intronic
1127167885 15:56266660-56266682 ATACTATGCAACCATAAAAAAGG - Intronic
1127452045 15:59125880-59125902 ATACTATGCAACCATAAAAAAGG - Intergenic
1127749592 15:62020942-62020964 ATACTATTCAGCCATAAAAAAGG + Intronic
1128895326 15:71367617-71367639 ATCCTATGCAGCCACAAAAAAGG - Intronic
1129032110 15:72626718-72626740 ATACTATTCAACAATAAAAAGGG - Intergenic
1129217787 15:74110513-74110535 ATACTATTCAACAATAAAAAGGG + Intronic
1129406880 15:75325456-75325478 ATGCTATTCAACAATAAAAAGGG - Intergenic
1129734942 15:77954814-77954836 ATACTATTCAACAATAAAAAGGG + Intergenic
1129925633 15:79361398-79361420 ACACTACTCAGCCATAAAAAGGG + Intronic
1130302509 15:82690587-82690609 ATACTATGCAACCATAAAAAAGG - Intronic
1131246745 15:90800769-90800791 TTACTTCTCAACCAAAAAAAAGG + Intronic
1131326380 15:91450868-91450890 ATATTACTCAGCCATAAAAAAGG - Intergenic
1131731334 15:95284676-95284698 ATGCTACTCAATGATACAAAAGG - Intergenic
1131902035 15:97098572-97098594 ATACTACTCAACTCCAAAAAAGG + Intergenic
1131994038 15:98117386-98117408 ATACTACGCAGCCATAAAAAAGG + Intergenic
1132206774 15:99991829-99991851 ATACTATGCAGCCACAAAAAAGG + Intronic
1132333928 15:101031089-101031111 ACACTACTCAGCCATAAAAAGGG - Intronic
1132402032 15:101516879-101516901 ATGCTATTCAACCTTTAAAAAGG - Intronic
1133475347 16:6116077-6116099 ATGCTATGCAGCCATAAAAAAGG + Intronic
1133656916 16:7873828-7873850 ATACTACGCAGCCATAAAAAAGG - Intergenic
1133687901 16:8183925-8183947 ATATTACTCAGCCATAAAAAAGG - Intergenic
1133836936 16:9375928-9375950 ATACTACTGAGCCATAAAAATGG - Intergenic
1134343736 16:13369945-13369967 ATACTACTCACCCATAAAAAAGG - Intergenic
1134376222 16:13676947-13676969 ATGTTACTCAGCCATAAAAATGG - Intergenic
1134583644 16:15393208-15393230 ATACTACGCAGCCATAAAAACGG + Intergenic
1134797105 16:17050656-17050678 ATACTACACAGCCACAAACAAGG - Intergenic
1134857354 16:17531473-17531495 ATACTACTCAGCCATAAAGAGGG - Intergenic
1134898495 16:17912210-17912232 ATACTATGCAGCCACAAAAAAGG + Intergenic
1135024937 16:18991930-18991952 ATACTATGCAGCCACAAAAAAGG - Intronic
1135045038 16:19148370-19148392 ATACTACTCAGCCATAAAAAGGG - Intronic
1135152202 16:20018530-20018552 ATACTACGCAGCCATAAAAAAGG + Intergenic
1135796683 16:25450734-25450756 ATACTACACAGCCATAAAAAAGG - Intergenic
1136907014 16:34104513-34104535 AAGCTACTCAATCAAAAGAAAGG - Intergenic
1137075084 16:35951961-35951983 AAGCTACTCAATCAAAAGAATGG + Intergenic
1137355611 16:47760326-47760348 ATACTATGCAGCCACAAAAAAGG + Intergenic
1137493921 16:48954489-48954511 ATACTATGCAACCATAAAAAAGG - Intergenic
1137528893 16:49263698-49263720 ATACTATGCAGCCACAAAAAAGG - Intergenic
1137826941 16:51506125-51506147 ATTCTACACAGCCATAAAAATGG - Intergenic
1137828604 16:51522575-51522597 ATACTACGCAGCCATAAAAAAGG + Intergenic
1137938262 16:52656343-52656365 TTGCTACAAAACAACAAAAAAGG - Intergenic
1137962739 16:52899363-52899385 ATACTATGCAGCCACAAAAAAGG - Intergenic
1138177846 16:54917869-54917891 ATACTACTGAACTAAAAAAAAGG + Intergenic
1139061229 16:63254229-63254251 ATACTACTAAGCCACAAAAAAGG + Intergenic
1139135366 16:64197503-64197525 ATGCTACCCAGCCTTAAAAAAGG + Intergenic
1139144732 16:64309619-64309641 ATATTACTCAGCCATAAAAAGGG + Intergenic
1139151656 16:64388870-64388892 ATACTACGCAGCCATAAAAAAGG - Intergenic
1140042958 16:71421620-71421642 CTGCCACTCACCCACAAAAAAGG - Intergenic
1140150021 16:72353453-72353475 ATACTACGCAGCCAGAAAAAAGG + Intergenic
1140187247 16:72786301-72786323 AATCTACTCAACACCAAAAATGG + Exonic
1140716885 16:77734703-77734725 ATACTATTCAGCCATAAAAAAGG + Intronic
1141036888 16:80634303-80634325 ATACTATGCAACCATAAAAAAGG + Intronic
1141189242 16:81811703-81811725 ATACTATGCAACCATAAAAAAGG - Intronic
1141190386 16:81820502-81820524 ATGCTGCTCAGCAACAGAAAAGG - Intronic
1141245598 16:82303752-82303774 ATCCTATTCAGCCATAAAAAAGG - Intergenic
1141492293 16:84382319-84382341 ATACTACGCAGCCATAAAAAAGG - Intronic
1141553728 16:84823195-84823217 ATATTACTCAGCCATAAAAAAGG - Intronic
1142110921 16:88330828-88330850 ATGAGCCTCATCCACAAAAATGG + Intergenic
1143396639 17:6604446-6604468 ATACTACTCAGCAACAAAAAGGG + Intronic
1143797343 17:9347974-9347996 ATATTACTCAACCACAAAAAAGG - Intronic
1144156054 17:12504312-12504334 ATACTACTCAGCCACAAAAAAGG + Intergenic
1144622633 17:16828120-16828142 ATACTATGCAACCATAAAAAAGG + Intergenic
1144883798 17:18444592-18444614 ATACTATGCAACCATAAAAAAGG - Intergenic
1145148435 17:20499786-20499808 ATACTATGCAACCATAAAAAAGG + Intergenic
1146569817 17:33942526-33942548 ATGTCACCCAACCAGAAAAAGGG - Intronic
1146661973 17:34670861-34670883 ATGCTAAGCAAACACAAACAGGG - Intergenic
1148292665 17:46469141-46469163 ATACTATTCAACAATAAAAAGGG - Intergenic
1148314849 17:46686834-46686856 ATACTATTCAACAATAAAAAGGG - Intronic
1149117494 17:53115389-53115411 ATACTATTCAGCCATAAAAAAGG - Intergenic
1149142092 17:53443722-53443744 ATACTACACAGCCATAAAAAAGG + Intergenic
1149212745 17:54322475-54322497 ATACTACGCAGCCATAAAAAAGG + Intergenic
1149389084 17:56171525-56171547 ATGCCACTCATTCACACAAATGG - Intronic
1149738659 17:59021433-59021455 ATACTATTCAGCCATAAAAAAGG + Intronic
1149779389 17:59385144-59385166 GTACTACTCAGCAACAAAAAGGG + Intronic
1150513543 17:65782646-65782668 ATACTATGCAGCCACAAAAAGGG + Intronic
1150895969 17:69211251-69211273 ATACTACTCAGCCATTAAAAAGG - Intronic
1151048864 17:70953343-70953365 ATACTACACAGCCATAAAAAAGG + Intergenic
1151267078 17:72964909-72964931 ATACTACGCAGCCATAAAAAAGG + Intronic
1153220719 18:2858494-2858516 ATACTACTCAGCTATAAAAAGGG - Intronic
1154271091 18:12920466-12920488 ATACTACTCAACCATAAAAAAGG + Intronic
1154371745 18:13769539-13769561 ATCCTAATCCACCACAAAAATGG + Intergenic
1154396160 18:13991425-13991447 ATACTACTCAGCCTTAAAAAAGG + Intergenic
1154462440 18:14606751-14606773 ATATTATTCTACCACAAAAACGG + Intergenic
1155633760 18:27925887-27925909 ATAGTACACAACCATAAAAAAGG - Intergenic
1155658697 18:28222311-28222333 ATACTACGCAGCCATAAAAAAGG - Intergenic
1155681407 18:28491303-28491325 ATACTATGCAACCATAAAAAAGG + Intergenic
1155706318 18:28818918-28818940 ATACTATTCAGCCATAAAAAAGG - Intergenic
1155723477 18:29049298-29049320 ATGCTACACAGCCATAGAAAAGG - Intergenic
1155867028 18:30978243-30978265 ATACTATGCAACCATAAAAAAGG + Intergenic
1156256661 18:35404331-35404353 ATACTATGCAACCATAAAAAAGG - Intergenic
1156422753 18:36973131-36973153 ATACTACGCAGCCATAAAAAAGG + Intronic
1156581279 18:38379333-38379355 ATGTTACTCAACAATAAAAAAGG + Intergenic
1156710720 18:39941930-39941952 ATACTACTCAATAGCAAAAAAGG + Intergenic
1157072273 18:44422029-44422051 ATACTACGCAGCCATAAAAAAGG + Intergenic
1157219485 18:45816921-45816943 ATACTACTCAGCCATAAAAAAGG + Intergenic
1157561985 18:48654781-48654803 ATACTATGCAACCATAAAAAAGG + Intronic
1157933232 18:51845988-51846010 ATACTACTCAGCCATAAAAAAGG - Intergenic
1158536298 18:58311090-58311112 AAGCCACTCAACTACAGAAAAGG - Intronic
1158944915 18:62439665-62439687 ATACTATGCAGCCACAAAAAAGG - Intergenic
1159328350 18:66953904-66953926 ATACTATGCAGCCACAAAAAAGG + Intergenic
1159430883 18:68351561-68351583 ATACTACTCAGCCATAAAAAGGG + Intergenic
1159614518 18:70565761-70565783 ATACTATACAGCCACAAAAAAGG - Intergenic
1159645324 18:70911445-70911467 ATACTATTCAGCCATAAAAACGG - Intergenic
1160103966 18:75951899-75951921 ATACTATGCAACCATAAAAAAGG - Intergenic
1160133288 18:76249073-76249095 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1160175520 18:76590987-76591009 ATATTACTCAGCCATAAAAAAGG + Intergenic
1160614108 18:80110555-80110577 ATGCTCCTCACCCCCAAAAATGG - Intronic
1161863828 19:6819546-6819568 ATATTACTCAGCCATAAAAAAGG - Intronic
1162222228 19:9187405-9187427 GTACTACTCAGCCATAAAAAAGG - Exonic
1162632072 19:11936041-11936063 ATACTACGCAGCCATAAAAAAGG - Intronic
1162632336 19:11938568-11938590 ATACTATGCAGCCACAAAAAAGG - Intronic
1163067227 19:14806718-14806740 ATACTACGCAGCCATAAAAAGGG - Intronic
1163412792 19:17166838-17166860 ATACTACCCAGCCATAAAAAAGG - Intronic
1163869234 19:19804740-19804762 ATACTATGCAGCCACAAAAAAGG + Intronic
1164132091 19:22372964-22372986 ATACTATTCAGCCATAAAAAGGG + Intergenic
1164145799 19:22511801-22511823 ATGCTAAACAACAACAAAGACGG - Intronic
1164337564 19:24344408-24344430 AGGCTGCTCAATCACAACAAAGG - Intergenic
1164359637 19:27490204-27490226 AAACTACTCAACCAAAAGAATGG - Intergenic
1164420330 19:28086100-28086122 ATACTACTCAACAATAAACATGG + Intergenic
1164488573 19:28685258-28685280 ATACTACGCAGCCATAAAAAAGG + Intergenic
1165725822 19:38111819-38111841 AGGGTCCTCAACCCCAAAAAGGG - Intronic
1165988242 19:39789523-39789545 ATACTATTCAGCCATAAAAAGGG + Intergenic
1166697621 19:44862510-44862532 ATACTACACAGCCATAAAAAAGG + Intronic
1167397309 19:49239085-49239107 ATACTATGCAACCATAAAAAAGG - Intergenic
1168123607 19:54270443-54270465 ATACTACTCAGCCACAAAAAGGG - Intronic
1168180441 19:54659058-54659080 ATACTATGCAGCCACAAAAAAGG + Intronic
925442274 2:3899060-3899082 AGGCTACTGAACCACAGAGAGGG + Intergenic
925522344 2:4761370-4761392 ATACTACGCAGCCATAAAAAAGG + Intergenic
925567757 2:5274558-5274580 ATACTACTCAGCCATAAAAAGGG - Intergenic
925764577 2:7218806-7218828 ATACTACTCAACCATAAAAACGG - Intergenic
926804863 2:16698859-16698881 ATACTACTCAGCCACATAAAAGG + Intergenic
927000436 2:18789207-18789229 ATTCTTCTCATCCACAAAAAAGG - Intergenic
927151242 2:20197569-20197591 ATACTACTCAGCAACAAAAAAGG - Intergenic
927910642 2:26896224-26896246 ATACTGCTCAGCCATAAAAAAGG - Intronic
928127079 2:28624394-28624416 ACACTACTCAGCCATAAAAAGGG - Intronic
928616461 2:33044448-33044470 ATGCTATGCAGCCATAAAAAAGG - Intronic
928754493 2:34508070-34508092 ATACTATGCAGCCACAAAAAAGG + Intergenic
929025228 2:37594525-37594547 ATACTATGCAACCATAAAAAAGG - Intergenic
929235651 2:39602856-39602878 ACACTATACAACCACAAAAATGG - Intergenic
929415756 2:41745497-41745519 ATACTACTCTGCCATAAAAAAGG + Intergenic
929739294 2:44586644-44586666 ATACTACTCAGCAATAAAAAAGG - Intronic
929835851 2:45398099-45398121 ATAATAATCAACCACAGAAAGGG + Intronic
930143720 2:47980004-47980026 ATACTACTAACCCATAAAAAGGG + Intergenic
930286228 2:49431727-49431749 ATACTACACAGCCATAAAAAAGG + Intergenic
930440512 2:51398577-51398599 ATACTACTCAGCCATAAAAAGGG + Intergenic
930466058 2:51751068-51751090 ATACTATGCAGCCACAAAAAAGG - Intergenic
930638871 2:53835138-53835160 ATACTACTCAGCCTTAAAAAAGG + Intergenic
931777784 2:65555025-65555047 ATCCTACTCAACCACAAGTTGGG + Intergenic
932107829 2:68963438-68963460 ATACTACTTAACAATAAAAAAGG + Intergenic
932141438 2:69281634-69281656 ATACTATGCAACCATAAAAAAGG - Intergenic
932444900 2:71773405-71773427 ATACTATGCAGCCACAAAAAAGG - Intergenic
933076468 2:77933834-77933856 ATACTATGCAGCCACAAAAAGGG + Intergenic
933197909 2:79413398-79413420 ATACTATTCAGCCACAAAAAAGG - Intronic
933433038 2:82209327-82209349 ATACTATTCAGCCATAAAAAAGG - Intergenic
933528946 2:83481041-83481063 CTGCTACACATCCTCAAAAAGGG + Intergenic
933871567 2:86570992-86571014 ATCCTACTCAACAGCAACAATGG + Intronic
934068545 2:88362731-88362753 ATACTACTCAGCCATAAAAAAGG + Intergenic
934471631 2:94547681-94547703 AAACTACTCAACCAAAAGAAAGG + Intergenic
934472316 2:94560996-94561018 AAACTACTCAACCAAAAGAAAGG + Intergenic
934511715 2:94949765-94949787 ATACTATGCAGCCACAAAAAAGG - Intergenic
934637890 2:96007779-96007801 ATACTACTCAGCAATAAAAAGGG - Intergenic
934776712 2:96943438-96943460 ATACTATTCAGCCATAAAAAAGG - Intronic
935247128 2:101228458-101228480 ATACTACTCAACAACAAAAAAGG - Intronic
935843488 2:107139602-107139624 ATACTATTCAGCCATAAAAAAGG - Intergenic
935918044 2:107979275-107979297 ATACTATGCAACCATAAAAAAGG + Intergenic
936479513 2:112872394-112872416 AGACTACTCAACAACAACAATGG + Intergenic
936624312 2:114132231-114132253 ATACTATGCAGCCACAAAAAAGG + Intergenic
936720024 2:115239936-115239958 ATACTATGCAACCATAAAAAAGG - Intronic
936728164 2:115347816-115347838 ATACTATGCAGCCACAAAAAAGG - Intronic
936781571 2:116039323-116039345 ATACTATGCAGCCACAAAAAAGG + Intergenic
936798469 2:116236513-116236535 ATACTATGCAACCATAAAAAAGG + Intergenic
936860127 2:117006926-117006948 ATACTATTCAGCCATAAAAAGGG + Intergenic
936884692 2:117296328-117296350 ATGCTAGTAATCCACAAACATGG - Intergenic
936908782 2:117568791-117568813 ATACTATGCAGCCACAAAAAAGG + Intergenic
937063229 2:118995676-118995698 ATACTACACATCCATAAAAAAGG - Intergenic
937744118 2:125390257-125390279 ATACTATGCAACCATAAAAAAGG - Intergenic
938199247 2:129359672-129359694 ATGCTATGCAGCCATAAAAAAGG + Intergenic
938214731 2:129501461-129501483 ATACTACGCAGCCATAAAAAAGG - Intergenic
938217969 2:129537610-129537632 ATACTACACAGCCATAAAAAAGG + Intergenic
938281890 2:130069718-130069740 ATGCTATGCACCCATAAAAAAGG + Intergenic
938332510 2:130458273-130458295 ATGCTATGCACCCATAAAAAAGG + Intergenic
938357296 2:130662395-130662417 ATGCTATGCACCCATAAAAAAGG - Intergenic
938433728 2:131269182-131269204 ATGCTATGCACCCATAAAAAAGG - Intronic
938857440 2:135328396-135328418 ATGCTATGCAGCCATAAAAAAGG - Intronic
938862723 2:135386649-135386671 ATGCTATGCAGCCATAAAAAAGG + Intronic
938951685 2:136260456-136260478 ATACTATGCAACCATAAAAAAGG - Intergenic
939145665 2:138411703-138411725 ATGCTTCTCAGAGACAAAAAGGG + Intergenic
939723866 2:145689489-145689511 ATACTATGCAACCACAAAAAAGG - Intergenic
939972897 2:148682055-148682077 ATACTACGCAGCCATAAAAAAGG - Intronic
940552244 2:155174339-155174361 ATACTACTCAGCCATAAAAAAGG - Intergenic
940594731 2:155776117-155776139 ATACTATGCAGCCACAAAAAAGG + Intergenic
940636521 2:156304521-156304543 ATACTATGCAACCATAAAAAAGG + Intergenic
941117270 2:161486708-161486730 ATACTATTCATCCATAAAAAGGG + Intronic
941222809 2:162805888-162805910 ATACTACTCAGACATAAAAAAGG + Intronic
941552599 2:166935746-166935768 ATACTATGCAGCCACAAAAAAGG - Intronic
942018496 2:171842192-171842214 ATAGTATTCAGCCACAAAAAAGG + Intronic
942039561 2:172045346-172045368 ATGCTCCAAAACCACTAAAAAGG + Intronic
942111869 2:172690658-172690680 ATACTACGCAGCCACGAAAAAGG + Intergenic
942627528 2:177918012-177918034 ATGCAACTAAAACACAAAAGTGG + Intronic
942691077 2:178585772-178585794 ATACTACGCAGCCATAAAAAAGG - Intronic
942915425 2:181300216-181300238 ATACTACGCAGCCATAAAAAAGG + Intergenic
943205138 2:184885494-184885516 ATCCTACACAACCACATAGAAGG + Intronic
943211588 2:184974258-184974280 ATACTATGCAGCCACAAAAAAGG - Intergenic
943215173 2:185024783-185024805 ATACTACTCAGCCATAAAAAAGG + Intergenic
943306210 2:186265641-186265663 ATACTACACAGCCATAAAAAAGG - Intergenic
943347683 2:186759133-186759155 GTACTATTCAACCATAAAAAAGG - Intronic
943413740 2:187572198-187572220 ATACTACACAGCCATAAAAAAGG - Intergenic
943619609 2:190133646-190133668 ATGCTATTCAGCCTTAAAAAAGG + Intronic
943777385 2:191781137-191781159 ATACTACGCAGCCATAAAAAAGG - Intergenic
943820940 2:192320236-192320258 ATACTATGCAGCCACAAAAAAGG + Intergenic
943945193 2:194052116-194052138 ATGCTATGCAGCCATAAAAAAGG + Intergenic
944012252 2:194986140-194986162 ATGATACTCAACATCATAAAAGG + Intergenic
944105646 2:196076499-196076521 GTGCTACTCAGCCATAAAAAAGG - Intergenic
944114139 2:196169780-196169802 ATTCTATTCACACACAAAAAAGG + Intronic
944378123 2:199073062-199073084 ATACTAAGCAGCCACAAAAAAGG + Intergenic
944441073 2:199743975-199743997 AAGCTTCTCAACCATAAAGAAGG + Intergenic
944612679 2:201427505-201427527 ATACTATGCAACCATAAAAAAGG - Intronic
944895295 2:204157848-204157870 ATATTATTCAGCCACAAAAAAGG - Intergenic
944972208 2:205006147-205006169 ATACTACTCAGCCATAAAAAAGG - Intronic
945161340 2:206894539-206894561 ATGCTATGCAGCCATAAAAAAGG - Intergenic
945311256 2:208316209-208316231 ATGCTATGCAACCATAAAAAAGG - Intronic
945716794 2:213367121-213367143 ATACTATGCAACCATAAAAAAGG - Intronic
946088759 2:217200598-217200620 ATACTACTCAGCAATAAAAAAGG - Intergenic
946106959 2:217379354-217379376 ATACTATACAGCCACAAAAAAGG + Intronic
946184349 2:217970553-217970575 ATATTACTCAACCATAAAAAGGG + Intronic
946536518 2:220635656-220635678 ATACTACACAGCCATAAAAAAGG - Intergenic
946638651 2:221758779-221758801 ATACTATTCAGCCATAAAAAAGG - Intergenic
946737624 2:222770281-222770303 ATACTACTCAGCCATTAAAAAGG - Intergenic
946824523 2:223663489-223663511 ATACTACTCAGCTATAAAAAAGG + Intergenic
946847557 2:223872949-223872971 ATACTATGCAACCATAAAAAAGG + Intronic
947171571 2:227318013-227318035 ATACTACACAGCCATAAAAAAGG + Intergenic
947488360 2:230572850-230572872 TTGCTACAAAACAACAAAAAAGG + Intergenic
947674298 2:231962919-231962941 ATACTATGCAGCCACAAAAAAGG - Intronic
948279631 2:236737043-236737065 ATACTATTCAGCCATAAAAAGGG + Intergenic
948646037 2:239405690-239405712 ATACTATGCAACCATAAAAAAGG + Intergenic
948713204 2:239838770-239838792 ATACTATGCAGCCACAAAAAAGG + Intergenic
948722200 2:239908054-239908076 ATACTATGCAGCCACAAAAAAGG + Intronic
948743270 2:240063305-240063327 ATACTATTCAACAATAAAAAGGG - Intergenic
948842297 2:240658503-240658525 ATACTACTCAGCCATAAAAAGGG - Intergenic
949081808 2:242106838-242106860 ATACTACACAGCCATAAAAAAGG - Intergenic
1168742463 20:203813-203835 ATACTATGCAACCATAAAAAAGG - Intergenic
1168897734 20:1335428-1335450 ATACTACTCAGCCATAAAACGGG + Intronic
1169176184 20:3516820-3516842 ATGCTACACAGCCATAAAAAAGG - Intronic
1169571739 20:6913678-6913700 ATACTATTCAGCCATAAAAAAGG - Intergenic
1169975054 20:11315687-11315709 ATGCTACTCGATGATAAAAAAGG + Intergenic
1170096272 20:12649079-12649101 ATACTACTCAGCCACTAAAAGGG - Intergenic
1170177182 20:13484787-13484809 ATACTACGCAGCCATAAAAACGG + Intronic
1170223019 20:13961646-13961668 AAGCTACTCAGTCACAAACATGG + Intronic
1170482418 20:16779553-16779575 ATACTATGCAGCCACAAAAAAGG - Intergenic
1170527647 20:17256955-17256977 ATGCTATGCAGCCATAAAAAAGG - Intronic
1171007436 20:21480323-21480345 ATACTACGCAGCCATAAAAAAGG - Intergenic
1171046544 20:21813518-21813540 ATGCTACTCAACAATAAAAAGGG - Intergenic
1172865862 20:38096750-38096772 ATATTACTCAACCATAACAAGGG - Intronic
1173144959 20:40516407-40516429 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1173206712 20:41000818-41000840 ATACTATTCAGCCATAAAAAAGG + Intergenic
1174293807 20:49529442-49529464 ATGTTATTCAGCCATAAAAAGGG - Intronic
1175068768 20:56313979-56314001 ATATTATTCAGCCACAAAAAAGG + Intergenic
1175136274 20:56826667-56826689 ATGAAACTCAACAATAAAAATGG - Intergenic
1175572236 20:60032655-60032677 ATACTATTCAGCCATAAAAAAGG + Intronic
1175578454 20:60080208-60080230 CTTCTTCCCAACCACAAAAAGGG + Intergenic
1175662577 20:60827205-60827227 ATGCTATTCAGCAACTAAAAGGG - Intergenic
1175751009 20:61497864-61497886 ATACTATTCAGCCATAAAAAAGG + Intronic
1176905408 21:14494367-14494389 ATACTACGCAGCCATAAAAAAGG + Intronic
1177240054 21:18444290-18444312 ATACTACATAACCATAAAAAAGG + Intronic
1177407416 21:20688266-20688288 ATGCTAAACAACCACTAAAATGG - Intergenic
1177557196 21:22707137-22707159 ATACTACACAGCCATAAAAAAGG + Intergenic
1177648333 21:23928527-23928549 ATGCTATGCATCCATAAAAAAGG + Intergenic
1177721642 21:24914935-24914957 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1177756009 21:25348539-25348561 ATACTACGCAGCCATAAAAAAGG + Intergenic
1177848254 21:26317014-26317036 ATACTATGCAGCCACAAAAAAGG - Intergenic
1177955424 21:27592599-27592621 ATATTACACAACCATAAAAAAGG + Intergenic
1178352025 21:31878861-31878883 GTGAGACTCAATCACAAAAAAGG - Intronic
1178623998 21:34200577-34200599 ATATTACCCAACCATAAAAAAGG - Intergenic
1179386373 21:40946765-40946787 ATACTATGCAACCATAAAAAAGG + Intergenic
1179817882 21:43919477-43919499 ATACTACTCAGCCATCAAAAGGG - Intronic
1180461709 22:15571789-15571811 ATACTATGCAGCCACAAAAAGGG - Intergenic
1181454750 22:23052400-23052422 ATACTACTCAGCCATAAAAAAGG + Intergenic
1181710617 22:24684961-24684983 ATACTACTCAGCCATAAAATGGG - Intergenic
1181717547 22:24743494-24743516 ATACTACTCAGCCATAAAAAGGG + Intronic
1181761745 22:25063365-25063387 ATACTACTCAGCCACAAAAAAGG + Intronic
1181810588 22:25401456-25401478 ATATTATTCAGCCACAAAAAGGG + Intronic
1182040494 22:27235439-27235461 ATACTACACAACCATAAAAAGGG + Intergenic
1182205044 22:28615602-28615624 ATACTACACAGCCATAAAAAAGG + Intronic
1182402922 22:30096446-30096468 ATACTACACACCCACCAAAATGG - Intronic
1182592389 22:31391641-31391663 ATAATATTCAACCATAAAAAAGG - Intergenic
1182702357 22:32250762-32250784 ATACTACACAGCCATAAAAAAGG + Intronic
1182916254 22:34035051-34035073 CTACTACTAAACCAAAAAAAAGG - Intergenic
1182921214 22:34081209-34081231 ATACTACACAGCCATAAAAAAGG - Intergenic
1182969845 22:34563524-34563546 ATACTACACAGCCACAAAAAAGG + Intergenic
1183144512 22:35977356-35977378 AAGCTACTCAACAGCAAAAAAGG + Intronic
1185311313 22:50156707-50156729 ATGCTACTCAGCCCCCAAAAGGG - Intronic
949222303 3:1650273-1650295 ATACTATTCAGCCATAAAAAAGG - Intergenic
949622518 3:5830453-5830475 ATGCTATGCAGCCATAAAAAAGG + Intergenic
950277195 3:11672215-11672237 ATGCTAGTTAACTACAAAACTGG + Intronic
950370001 3:12521122-12521144 ATACTAGGCAGCCACAAAAATGG - Intronic
951045566 3:18034192-18034214 ATGTTACTTGACCACAGAAAGGG + Intronic
951182642 3:19677015-19677037 ATACTATGCAGCCACAAAAAAGG - Intergenic
951329791 3:21353305-21353327 ATACTATGCAGCCACAAAAAAGG + Intergenic
951494489 3:23311191-23311213 ATACTACGCAGCCACAAAAAAGG - Intronic
951690578 3:25391231-25391253 ATACTACTCAGCCATAAAAAAGG - Intronic
951852469 3:27156986-27157008 ATACTACTCAGCCATAAAAAAGG + Intronic
952521067 3:34158316-34158338 ATACTATGCAACCATAAAAAAGG - Intergenic
952659458 3:35827768-35827790 ATACTATGCAGCCACAAAAAAGG + Intergenic
952724360 3:36567674-36567696 ATACTATGCAGCCACAAAAAAGG - Intergenic
953047979 3:39312949-39312971 ATGCTATGCAGCCATAAAAAAGG + Intergenic
953117249 3:40005112-40005134 ATACTATTCAGCCATAAAAAAGG - Intronic
953122535 3:40059116-40059138 ATACTATGCAGCCACAAAAAAGG - Intronic
953828518 3:46275714-46275736 ATGCTACGCAGTCATAAAAACGG + Intergenic
953862888 3:46560473-46560495 ATGCTACCCCAACACAGAAAAGG + Intronic
954492323 3:50918093-50918115 ATACTACACAGCCATAAAAAAGG - Intronic
954496321 3:50967347-50967369 ATACTATTCAGCCATAAAAAAGG - Intronic
954500269 3:51006957-51006979 ATACTACACAGCCATAAAAAAGG - Intronic
954513318 3:51147674-51147696 ATACTATTCAGCCATAAAAAAGG - Intronic
954835549 3:53464180-53464202 ATACTACTCAGACATAAAAAAGG - Intergenic
955636827 3:61039510-61039532 ATACTACACAGCCATAAAAAAGG + Intronic
955716214 3:61833040-61833062 ATACTACTCAGACATAAAAAGGG - Intronic
955778324 3:62457742-62457764 ATACTACACAGCCATAAAAAAGG + Intronic
955865253 3:63375378-63375400 ATACTATGCAGCCACAAAAAAGG + Intronic
956047732 3:65214290-65214312 ATACTATGCAGCCACAAAAAAGG - Intergenic
956370661 3:68556772-68556794 ATATTACTCAAGCATAAAAAGGG + Intergenic
956371583 3:68569292-68569314 ATGCTACTGAACAACAAATGGGG - Intergenic
956570698 3:70691081-70691103 ATACTACGCAGCCATAAAAAAGG - Intergenic
957334494 3:78809647-78809669 ATACTATGCAGCCACAAAAAAGG + Intronic
957425171 3:80028804-80028826 ATGCTATGCAGCCATAAAAAAGG - Intergenic
957899826 3:86474913-86474935 ATACTATGCAGCCACAAAAAAGG + Intergenic
957917368 3:86703625-86703647 ATACTATGCAGCCACAAAAAAGG - Intergenic
958654109 3:96979384-96979406 ATACTATGCAGCCACAAAAAAGG - Intronic
958741266 3:98076039-98076061 ATACTACTCAACCACAAAAAGGG - Intergenic
958945461 3:100357077-100357099 ATACTACTCAGCAATAAAAAAGG - Intergenic
959170336 3:102836583-102836605 ATACTATTCAGCCATAAAAAGGG - Intergenic
959374550 3:105572417-105572439 ATACTATTCAGCCATAAAAAAGG - Intronic
959760325 3:109955463-109955485 ATACTATTCAGCCACAAAGAAGG - Intergenic
959953326 3:112206650-112206672 ATACTACGCAGCCATAAAAAAGG + Intronic
960466789 3:118005996-118006018 ATACTATGCAACCATAAAAAAGG - Intergenic
960787186 3:121386738-121386760 ATACTACGCAGCCATAAAAAAGG - Intronic
960835528 3:121902693-121902715 ATACTATGCAACCATAAAAAAGG - Intronic
960856218 3:122104778-122104800 ATGCTACTCAGCAATAAAAAGGG - Intronic
962013482 3:131417080-131417102 ATACTACTCAGCCATAAAAAGGG + Intergenic
962111564 3:132455636-132455658 ATACTACTCAGCAATAAAAAAGG + Intronic
962192381 3:133325137-133325159 GAGCTACTCAGCCATAAAAAAGG + Intronic
962294397 3:134168428-134168450 ATGCTATGCAGCCATAAAAAAGG + Intronic
962326242 3:134435030-134435052 ATACTATTCAACAATAAAAAAGG - Intergenic
962401329 3:135061549-135061571 ATACTACTCAGCCATAAAAAAGG - Intronic
962668447 3:137680034-137680056 ATGCTATGCAGCCATAAAAAAGG + Intergenic
962708234 3:138064891-138064913 AGGCTGAGCAACCACAAAAAAGG + Intronic
963049951 3:141132617-141132639 ATACTACTCAGCCATAAAAAAGG - Intronic
963270294 3:143279748-143279770 ATACTACGCAGCCATAAAAAAGG - Intronic
963701995 3:148638153-148638175 ATACTACTCAGCAATAAAAATGG + Intergenic
963933760 3:151031740-151031762 ATGCCTCTCTACCATAAAAAAGG + Intergenic
964008918 3:151866020-151866042 ATACTACACAGCCATAAAAAAGG - Intergenic
964266051 3:154896722-154896744 ATACTATTCAGCCATAAAAATGG + Intergenic
964273714 3:154986537-154986559 ATACTATGCAACCATAAAAAAGG + Intergenic
964572375 3:158122913-158122935 ATACTACGCAGCCATAAAAAAGG - Intronic
964670886 3:159225200-159225222 ATACAACTCAACAATAAAAAAGG + Intronic
964888558 3:161512728-161512750 ATACTATGCAGCCACAAAAAAGG - Intergenic
965021269 3:163235178-163235200 ATACTATGCAACCATAAAAAAGG + Intergenic
965103103 3:164328312-164328334 ATACTACGCAGCCATAAAAAAGG + Intergenic
965129013 3:164670518-164670540 ATACTATTCAGCCATAAAAAAGG + Intergenic
965161099 3:165134747-165134769 ATACTATGCAACCATAAAAAAGG - Intergenic
965270858 3:166615534-166615556 ATACTATGCAACCATAAAAAAGG - Intergenic
965416062 3:168394374-168394396 ATACTACTCAGCAATAAAAAAGG + Intergenic
965678005 3:171220049-171220071 ATGCTACACAGCCATAAGAAAGG + Intronic
965699813 3:171449086-171449108 ATGCTACACAGCCATAAAAAAGG - Intronic
965739495 3:171858957-171858979 ATACTACGCAGCCATAAAAAAGG + Exonic
965753538 3:172001834-172001856 ATACTACTCAGCCATAAAAAAGG + Intergenic
965893608 3:173545751-173545773 ATACTATGCAACCATAAAAAAGG + Intronic
965981813 3:174701778-174701800 ACACTACTCAACAATAAAAAAGG - Intronic
966164353 3:177000353-177000375 ATACTACTCAGCCATGAAAAAGG - Intergenic
966478084 3:180373172-180373194 ATACTACGCAGCCATAAAAAAGG + Intergenic
966532713 3:180998514-180998536 ATGCTATACAGCCATAAAAAAGG - Intergenic
966546301 3:181152882-181152904 ATGCTACTCAGCCAATAAAAAGG + Intergenic
966589711 3:181668644-181668666 ATACTACGCAGCCATAAAAAAGG + Intergenic
966605594 3:181818691-181818713 ATATTATTCAACCATAAAAAGGG - Intergenic
966623790 3:181994589-181994611 ATACTACACAGCCATAAAAAGGG - Intergenic
966837855 3:184062831-184062853 ATACTACACAGCCATAAAAAAGG - Intergenic
967093702 3:186158676-186158698 TTGCTACTTAACCTCAAAGATGG + Intronic
967329924 3:188280178-188280200 ATGCTAGACATCCACACAAAAGG - Intronic
968059348 3:195715311-195715333 ATACTATGCAACAACAAAAAAGG + Intergenic
969051232 4:4374574-4374596 ATATTACTCAGCCATAAAAAAGG - Intronic
969384568 4:6835802-6835824 ATACTACGCAGCCATAAAAAAGG - Intronic
969692776 4:8713638-8713660 ATACTATGCAGCCACAAAAAGGG + Intergenic
970496671 4:16633094-16633116 ATACTACGCAGCCATAAAAAAGG + Intronic
970750811 4:19358273-19358295 ATACTACTCAGCAACAAAAGAGG + Intergenic
970983513 4:22128952-22128974 ATACTATGCAGCCACAAAAAAGG + Intergenic
971106472 4:23530189-23530211 ATACTATGCAACCATAAAAAAGG + Intergenic
971141453 4:23929416-23929438 GTGCTGTTCAACCACATAAAAGG - Intergenic
971163867 4:24162020-24162042 ATACTATTCAGCCATAAAAAAGG + Intergenic
971170491 4:24228299-24228321 ATACTACACAGCCATAAAAAAGG + Intergenic
971337971 4:25741577-25741599 ATGTTAATCAACCACAACAAGGG - Intergenic
971480172 4:27107889-27107911 ATACTACACAGCCATAAAAATGG + Intergenic
971693766 4:29871698-29871720 ATACTACTCAGCCATAAAAATGG - Intergenic
971703994 4:30015305-30015327 ATACTATGCAGCCACAAAAAAGG - Intergenic
971809068 4:31399820-31399842 ATGCTATGCAGCCATAAAAAAGG - Intergenic
971895264 4:32584918-32584940 ATACTATGCAGCCACAAAAAAGG - Intergenic
971965675 4:33552293-33552315 ATACTACGCAGCCATAAAAAAGG - Intergenic
972212931 4:36860369-36860391 ATACTACGCAGCCATAAAAAAGG + Intergenic
972255349 4:37349016-37349038 ATACTATTCAGCCATAAAAAAGG - Intronic
972318153 4:37946999-37947021 ATGCGACTCAACAATAAAAAGGG + Intronic
972500179 4:39670499-39670521 ATACTATGCAGCCACAAAAAAGG - Intergenic
972785748 4:42325427-42325449 ATACTATGCAACCATAAAAAAGG + Intergenic
972807327 4:42542770-42542792 ATACTATGCAACCATAAAAAAGG - Intronic
973602511 4:52556040-52556062 ATGCTATGCAGCCATAAAAAAGG - Intergenic
973627163 4:52784351-52784373 ATGCTATGCAGCCATAAAAAAGG + Intergenic
973672098 4:53230429-53230451 ATACTATGCAGCCACAAAAAAGG + Intronic
974081939 4:57222944-57222966 ATACTACTCAATCGCCAAAAAGG - Intergenic
974084788 4:57248250-57248272 ATACTACTCAGCCATAAAGAGGG + Intergenic
974292813 4:59955628-59955650 ATGCTATTCAGCCATAAAAAGGG + Intergenic
974503703 4:62739187-62739209 ATGCTATGCAGCCATAAAAAAGG + Intergenic
974567413 4:63595402-63595424 ATACTATGCAGCCACAAAAAAGG + Intergenic
974584623 4:63856084-63856106 ATGCTATGCAGCCATAAAAATGG + Intergenic
974794079 4:66726256-66726278 ATGCTATGCAGCCATAAAAAAGG - Intergenic
974851087 4:67405631-67405653 ATACTATTCAGCCATAAAAAAGG - Intergenic
974854814 4:67448086-67448108 ATACTACACAGCCATAAAAAAGG + Intergenic
974879823 4:67741384-67741406 ATACTGCTCAGCCATAAAAAAGG - Intronic
974955741 4:68639379-68639401 ATACTACACAGCCATAAAAAAGG + Intronic
975051285 4:69867783-69867805 GTGGTACTCAACCACCAAAGGGG + Intergenic
975065147 4:70052599-70052621 ATGCTAATGAAACACACAAATGG - Intronic
975103136 4:70537041-70537063 ATACTACGCAGCCATAAAAAAGG + Intergenic
975277115 4:72515169-72515191 ATGCTATGCAGCCATAAAAAAGG - Intronic
975354552 4:73385986-73386008 ATACTACACAGCCATAAAAAAGG - Intergenic
975743764 4:77455860-77455882 ATACTATTCAGCCATAAAAAAGG - Intergenic
976016170 4:80557769-80557791 ATACTATACAACAACAAAAAAGG + Intronic
976458831 4:85283849-85283871 ATACTACACAGCCATAAAAAAGG + Intergenic
976460700 4:85308674-85308696 ATACTACTCAGCCATGAAAAAGG - Intergenic
976470597 4:85424363-85424385 ATACTACACAGCCATAAAAAAGG - Intergenic
976790771 4:88875948-88875970 ATACTATGCAGCCACAAAAAAGG + Intronic
976820337 4:89199127-89199149 ATACTATGCAGCCACAAAAAAGG - Intergenic
976830592 4:89309341-89309363 ATACTATGCAGCCACAAAAAAGG + Intergenic
976871389 4:89797683-89797705 ATACTACTTAGCAACAAAAATGG - Intronic
977187470 4:93957935-93957957 ATACTATGCAACCATAAAAAAGG + Intergenic
977507329 4:97918621-97918643 ATACTACTAAGCCATAAAAAAGG + Intronic
977560787 4:98531403-98531425 ATGCTATGCAGCCATAAAAAAGG - Intronic
977578350 4:98698515-98698537 ATACTACGCAGCCATAAAAAGGG - Intergenic
977632190 4:99255351-99255373 ATACTATGCAGCCACAAAAAAGG - Intergenic
977957567 4:103047728-103047750 ATACTACGCAGCCATAAAAAAGG - Intronic
977967489 4:103169940-103169962 ATACTACGCAGCCATAAAAAAGG + Intronic
978063014 4:104361631-104361653 ATTCTTGTCAACTACAAAAAAGG - Intergenic
978270607 4:106885167-106885189 ATACTATGCAGCCACAAAAAAGG + Intergenic
978277795 4:106973073-106973095 ATACTACGCAGCCATAAAAAAGG - Intronic
978666758 4:111193623-111193645 ATACTATGCAGCCACAAAAAAGG + Intergenic
978938161 4:114403986-114404008 ATACTACGCAGCCATAAAAAAGG + Intergenic
978944380 4:114477601-114477623 ATTCTAATTAAACACAAAAATGG - Intergenic
978978641 4:114913986-114914008 GTACTATTCAACCATAAAAATGG + Intronic
979314952 4:119251238-119251260 ATACTATGCAGCCACAAAAAAGG - Intronic
979363369 4:119791190-119791212 ATGCTACTCAGCAAAAAAAAGGG - Intergenic
979605494 4:122634194-122634216 ATACTACGCAGCCATAAAAAAGG - Intergenic
980137591 4:128873850-128873872 ATGATTGTCAACAACAAAAAAGG + Exonic
980205584 4:129715825-129715847 ATGCTATGCAGCCATAAAAAAGG - Intergenic
980540512 4:134187350-134187372 ATACTATTCAGCCATAAAAAAGG + Intergenic
980597465 4:134972815-134972837 ATACTATGCAACCATAAAAAAGG + Intergenic
981297202 4:143146154-143146176 ATACTATGCAGCCACAAAAAAGG + Intergenic
981612232 4:146606727-146606749 ATACTATGCAGCCACAAAAAAGG + Intergenic
982400130 4:154957341-154957363 ATACTACTCAGCAACAAAAAGGG - Intergenic
982477702 4:155873281-155873303 TGGCTACTCATCTACAAAAAGGG + Intronic
982601670 4:157459196-157459218 ATACTACGCAGCCATAAAAAAGG + Intergenic
982612599 4:157595710-157595732 ATACTATGCAGCCACAAAAAAGG + Intergenic
982875276 4:160640440-160640462 ATGCTATGCAGCCATAAAAAAGG + Intergenic
983457398 4:167982357-167982379 ATACTATGCAGCCACAAAAAAGG - Intergenic
983655885 4:170084039-170084061 ATATTATTCAACCATAAAAAAGG + Intronic
983746640 4:171208676-171208698 ATACTACACAGCCATAAAAAGGG - Intergenic
983753927 4:171310321-171310343 ATGCTATGCAGCCATAAAAAAGG - Intergenic
984142203 4:176017611-176017633 ATACTATGCAACCATAAAAAAGG - Intergenic
984326610 4:178262376-178262398 ATACTACACAGCCATAAAAAAGG + Intergenic
984423055 4:179549750-179549772 ATACTACGCAGCCACAAAAGAGG + Intergenic
984485142 4:180358700-180358722 ATACTACGCAGCCATAAAAAAGG - Intergenic
984593474 4:181641517-181641539 ATACTATGCAGCCACAAAAAAGG - Intergenic
984681080 4:182609553-182609575 ATGCTACGAAAGCACAAAGAAGG - Intronic
984903645 4:184607611-184607633 ATACTACGCAGCCATAAAAAAGG + Intergenic
985185703 4:187313138-187313160 AAGCAACTAAACCACAAAATTGG + Intergenic
986520863 5:8616715-8616737 ATACTACGCAGCCATAAAAAAGG + Intergenic
986651932 5:9972533-9972555 ATACTACTCAGTCATAAAAAGGG + Intergenic
986655623 5:10008488-10008510 ATGCTACGCAGCCATAAAAAAGG + Intergenic
986666157 5:10106439-10106461 ATACTATTCAGCCATAAAAAAGG + Intergenic
986771079 5:10974270-10974292 ATATTATTCAGCCACAAAAACGG - Intronic
986917498 5:12640110-12640132 TAGCTACGCAGCCACAAAAAAGG + Intergenic
987019790 5:13858225-13858247 ATACTATGCAGCCACAAAAAAGG + Intronic
987102350 5:14603161-14603183 ATACCACTCAACAATAAAAAAGG - Intronic
987305431 5:16632983-16633005 ATGCTATACAGCCATAAAAAAGG - Intergenic
987426977 5:17784817-17784839 ATACTATGCAGCCACAAAAAAGG + Intergenic
987527838 5:19076765-19076787 ATACCACTCAGCCACAAAAAAGG + Intergenic
987578886 5:19762905-19762927 ATACTATGCAACCATAAAAAAGG + Intronic
987736439 5:21849959-21849981 ATACTATTCAACCTTAAAAAAGG + Intronic
987846224 5:23290605-23290627 ATACTACTCATCCATAAAAAAGG - Intergenic
987949301 5:24655061-24655083 ATGCTATGCAGCCATAAAAAAGG - Intergenic
988015087 5:25545973-25545995 ATACTACACATCCATAAAAAAGG - Intergenic
988187332 5:27884227-27884249 ATACTATGCAACCATAAAAAAGG - Intergenic
988293028 5:29315581-29315603 ATACTATGCAGCCACAAAAAAGG - Intergenic
988332183 5:29856268-29856290 ATACTATGCAGCCACAAAAAAGG - Intergenic
988443449 5:31258294-31258316 ATGCTATGCAGCCATAAAAAAGG + Intronic
988639831 5:33029534-33029556 ATACTACTAAGCCATAAAAAAGG + Intergenic
989211873 5:38864715-38864737 AAGATATTCAACCCCAAAAAAGG - Intronic
989546920 5:42685277-42685299 ATACTACTCAGCCATAAAAAAGG - Intronic
989721190 5:44530601-44530623 ATACTACTCAGTCATAAAAAAGG - Intergenic
989804576 5:45587356-45587378 ATACTATGCAGCCACAAAAAAGG + Intronic
989840004 5:46052573-46052595 ATAATACTCAATCAAAAAAAAGG - Intergenic
989954975 5:50347845-50347867 ATACTATTCAGCCATAAAAAAGG - Intergenic
989987977 5:50725036-50725058 ATACTACTCAGCCACTAAAAAGG - Intronic
990091706 5:52059296-52059318 ATACTACGCAGCCATAAAAAAGG - Intronic
990164460 5:52978668-52978690 ATACTACTCACCAATAAAAAAGG + Intergenic
990235541 5:53763549-53763571 ACACTACGCAGCCACAAAAAAGG + Intergenic
990489739 5:56293055-56293077 ATACTATGCAGCCACAAAAAAGG - Intergenic
990611239 5:57458992-57459014 ATGCTACTCCCCCAGAAAAGAGG + Intergenic
990858543 5:60299735-60299757 ATGCTATGCAGCCATAAAAAAGG - Intronic
991430776 5:66542576-66542598 ATACTACTCAATAACAAAAAAGG - Intergenic
991572068 5:68065496-68065518 ATACTATGCAGCCACAAAAAAGG + Intergenic
991647145 5:68811820-68811842 AAACAACTCAACCAAAAAAATGG - Intergenic
992598246 5:78367982-78368004 ATGCTACTCAGCTGCCAAAAGGG - Intronic
992936686 5:81714241-81714263 ATACTATACAACCATAAAAAAGG - Intronic
992948859 5:81837286-81837308 ATGCTATTTTTCCACAAAAATGG + Intergenic
993150907 5:84161176-84161198 ATACTACTCAGACATAAAAAAGG - Intronic
993217208 5:85041358-85041380 ATGCTACTCAGCCATATAAAAGG - Intergenic
993270602 5:85791241-85791263 ATACTACGCAGCCATAAAAAAGG - Intergenic
993290514 5:86062385-86062407 ATGCTATGCAGCCATAAAAAAGG + Intergenic
993291492 5:86077856-86077878 ATGCTATGCAGCCATAAAAAAGG - Intergenic
993372122 5:87105787-87105809 ATACTACGCAGCCATAAAAAAGG + Intergenic
993483894 5:88458311-88458333 ATGCTATGCAGCCATAAAAAAGG + Intergenic
993674486 5:90800729-90800751 ATGCTATACAGCCATAAAAATGG + Intronic
993787840 5:92165812-92165834 ATGCTATGCAGCCATAAAAAAGG - Intergenic
993804573 5:92388518-92388540 ATGCTATGCAGCCATAAAAAAGG + Intergenic
993818616 5:92584953-92584975 ATGCTATGCAGCCATAAAAAAGG + Intergenic
994237638 5:97382891-97382913 ATACTATGCAGCCACAAAAAAGG - Intergenic
994452429 5:99959247-99959269 ATACTATGCGACCACAAAAAAGG - Intergenic
994480404 5:100327277-100327299 ATACTACTCAGCCATTAAAAGGG - Intergenic
994483772 5:100369211-100369233 ATACTATACAACCATAAAAAAGG - Intergenic
994495542 5:100507696-100507718 ATACTATGCAGCCACAAAAAAGG + Intergenic
994526837 5:100916335-100916357 ATACTATGCAACCATAAAAAAGG - Intergenic
994528006 5:100930422-100930444 ATACTATGCAACCATAAAAAAGG - Intergenic
994606641 5:101975636-101975658 ATACTACCCAACCATAAAAAAGG - Intergenic
994707017 5:103219291-103219313 ATACTACGCAGCCATAAAAAAGG - Intergenic
994871523 5:105356093-105356115 AAGCTACTCAGACAAAAAAATGG - Intergenic
994964615 5:106653081-106653103 ATACTACACAGCCATAAAAAAGG + Intergenic
994976298 5:106811423-106811445 ATGCTATGCAGCCATAAAAAAGG - Intergenic
995005980 5:107195736-107195758 ATGCCTCTCAAACACAACAAAGG + Intergenic
995150852 5:108843249-108843271 ATACTACTCAGCCATAAAAAAGG - Intronic
995529696 5:113080460-113080482 ATACTACTCAGCCATAAAAAAGG + Intronic
995806280 5:116055981-116056003 ATACTATGCAACCATAAAAAAGG - Intronic
995816245 5:116171635-116171657 ATACTATTCAGCCATAAAAAAGG + Intronic
995855706 5:116590020-116590042 ATACTATGCAACCATAAAAAAGG + Intergenic
995940879 5:117582433-117582455 ATGCTATTCAGCCACAAAAAGGG - Intergenic
995944433 5:117626152-117626174 ATACTACACAGCCATAAAAAAGG - Intergenic
996294441 5:121895046-121895068 ATACTATGCAACCATAAAAAAGG + Intergenic
996678813 5:126207844-126207866 ATACTACTCAGCCATAAAAAAGG + Intergenic
996777291 5:127146462-127146484 ATACTATGCAACCATAAAAAAGG + Intergenic
996882929 5:128321626-128321648 ATACTATGCAACCATAAAAAAGG - Intronic
997066634 5:130567672-130567694 ATACTATGCAACCATAAAAAAGG + Intergenic
997601791 5:135143893-135143915 ATACTACGCAGCCATAAAAAAGG - Intronic
997797319 5:136823353-136823375 ATACTATGCAGCCACAAAAAAGG - Intergenic
998178431 5:139916732-139916754 ATACTATTCGGCCACAAAAAAGG - Intronic
998694512 5:144624146-144624168 ATGCTATGCAGCCATAAAAAAGG - Intergenic
998815530 5:146010212-146010234 ATACTACGCAGCCATAAAAAAGG - Intronic
998912728 5:146977709-146977731 ATACTACACAGCCATAAAAAAGG - Intronic
999313249 5:150566979-150567001 ATATTATTCCACCACAAAAAAGG + Intergenic
999359363 5:150969921-150969943 ATACTATGCAGCCACAAAAAGGG + Intergenic
999518094 5:152321157-152321179 ATACTATTCAGCCATAAAAAAGG + Intergenic
999665676 5:153910561-153910583 ATACTATGCAACCATAAAAAAGG + Intergenic
1000049459 5:157549242-157549264 ATGCAACTCAAAGTCAAAAATGG + Intronic
1000492945 5:161937949-161937971 ATGCTACACCACCCTAAAAAAGG - Intergenic
1000666036 5:163997559-163997581 ATACTACGCAGCCATAAAAAAGG - Intergenic
1000723122 5:164733400-164733422 ATACTACTCAGCCATAAAAAAGG + Intergenic
1000773200 5:165383371-165383393 ATACTATGCAGCCACAAAAAAGG - Intergenic
1000854435 5:166380698-166380720 ATACTACGCAGCCATAAAAAAGG - Intergenic
1000859888 5:166444869-166444891 ATACTACGCAGCCATAAAAAAGG - Intergenic
1001310401 5:170606082-170606104 ATGTTACTCAGCCATAAAAAGGG - Intronic
1001362152 5:171097970-171097992 ATACTATTCAGCCATAAAAAAGG - Intronic
1001369532 5:171184288-171184310 ATACTATTCAGCCATAAAAAAGG + Intronic
1001630539 5:173171768-173171790 ATACTATTCAGCCATAAAAAAGG - Intergenic
1001773563 5:174312637-174312659 ATTCTACTCAATCTCACAAAAGG - Intergenic
1003634222 6:7817382-7817404 ATACTATGCAACCATAAAAAAGG + Intronic
1003808036 6:9748633-9748655 ATACTACGCATCCATAAAAAAGG + Intronic
1004182015 6:13389420-13389442 ATGCTATGCAGCCATAAAAAAGG + Intronic
1004379909 6:15123738-15123760 ATACTGCTCCACCACAAGAATGG - Intergenic
1004592648 6:17068770-17068792 ATACTACTCTGCCATAAAAAGGG - Intergenic
1005222039 6:23598041-23598063 ATACTACGCAGCCATAAAAAAGG + Intergenic
1005691071 6:28306143-28306165 ATACTACTCAGCCATTAAAAAGG - Intergenic
1005777768 6:29155362-29155384 ATACTATGCAGCCACAAAAAAGG - Intergenic
1005904815 6:30253023-30253045 ATACTACGCAGCCATAAAAAAGG + Intergenic
1006063942 6:31447583-31447605 ATACTATGCAACCATAAAAAAGG - Intergenic
1006310189 6:33251923-33251945 ATGCCACTAAACCCCCAAAAGGG + Exonic
1006664330 6:35679578-35679600 ATACTACTCAGCCATAAAAAAGG + Intronic
1006740909 6:36308069-36308091 ATGCTACTTAAATACAAAACTGG + Intronic
1006820628 6:36891327-36891349 ATACTATGCAGCCACAAAAAAGG - Intronic
1007283855 6:40733239-40733261 ATGCTATTCTACAACAAAAAGGG + Intergenic
1007296284 6:40824070-40824092 ATACTATGCAGCCACAAAAAAGG + Intergenic
1007338503 6:41172676-41172698 ATACTATGCAACCATAAAAAAGG - Intergenic
1007645409 6:43376561-43376583 ATGCTAGTCAGCCACCAAAATGG + Intergenic
1007837667 6:44686699-44686721 ATACTACTCAGCCATAAAAAAGG - Intergenic
1007846601 6:44763126-44763148 ATACTAGGCAACCATAAAAAAGG - Intergenic
1008060624 6:46993031-46993053 ATACTATGCAGCCACAAAAAAGG + Intergenic
1008069974 6:47089653-47089675 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1008220601 6:48850008-48850030 ATACTACACAGCCATAAAAAAGG + Intergenic
1008408299 6:51143782-51143804 ATACTATGCAGCCACAAAAAAGG + Intergenic
1008436337 6:51480698-51480720 ATACTACGCAGCCATAAAAAAGG - Intergenic
1008633748 6:53388838-53388860 ATACTATGCAACCATAAAAAAGG + Intergenic
1008713702 6:54262255-54262277 ATGTTATTCAATAACAAAAAGGG - Intronic
1008757277 6:54811060-54811082 ATGTTACTCAGCCTTAAAAAAGG - Intergenic
1008795450 6:55297434-55297456 ATACTACGCAGCCATAAAAAAGG - Intergenic
1009054087 6:58314903-58314925 ATACTATGCAGCCACAAAAAAGG + Intergenic
1009058221 6:58364979-58365001 ATACTATGCAGCCACAAAAAAGG + Intergenic
1009253830 6:61349489-61349511 AAGCTTCTCAATCACAAGAATGG - Intergenic
1009258516 6:61451310-61451332 AAGCTTCTCAATCACAAGAATGG - Intergenic
1009468686 6:64004798-64004820 ATACTACACAACCATAAAAAAGG - Intronic
1009483740 6:64193834-64193856 ATACTACGCAGCCATAAAAAAGG - Intronic
1009507156 6:64498800-64498822 ATACTATGCAACCATAAAAAAGG - Intronic
1009510894 6:64548485-64548507 ATGCTATTCAGTCATAAAAAAGG + Intronic
1009629204 6:66172596-66172618 ACACTATGCAACCACAAAAAAGG + Intergenic
1009675445 6:66813818-66813840 ATACTATGCAGCCACAAAAAAGG + Intergenic
1009795514 6:68461884-68461906 ATACTATGCAACCATAAAAAAGG - Intergenic
1009805318 6:68594969-68594991 ATACTATGCATCCACAAAAAAGG - Intergenic
1009945622 6:70338957-70338979 ATACTACACAGCCATAAAAAAGG - Intergenic
1010154181 6:72773288-72773310 ATACTACGCAGCCATAAAAAAGG + Intronic
1010312765 6:74406948-74406970 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1010501774 6:76609923-76609945 ATACTATGCAACCATAAAAAAGG + Intergenic
1011031068 6:82923366-82923388 ATACTACGCAGCCATAAAAAAGG + Intronic
1011291622 6:85782638-85782660 ATACTATTCAGCCATAAAAAAGG - Intergenic
1011316307 6:86035572-86035594 ATACTATGCAACCATAAAAAAGG + Intergenic
1011361347 6:86528141-86528163 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1011700779 6:89952290-89952312 TTTCTTGTCAACCACAAAAATGG + Intronic
1011725748 6:90208860-90208882 ATGCTATGCAGCCATAAAAAAGG + Intronic
1011899026 6:92269086-92269108 AAACTACTCAACCGCAAACATGG - Intergenic
1012047918 6:94302100-94302122 ATACTATGCAGCCACAAAAAAGG + Intergenic
1012156360 6:95824643-95824665 ATACTACTCAGCCATAAAAAAGG + Intergenic
1012236088 6:96817646-96817668 ATACTACACAGCCACGAAAATGG + Intronic
1012251776 6:96988761-96988783 ATACTATGCAACCATAAAAAAGG + Intronic
1012483359 6:99692315-99692337 ATACTACGCAACCATAAAAAAGG + Intergenic
1012489427 6:99764380-99764402 ATACTATGCAACCATAAAAAAGG - Intergenic
1012527444 6:100195423-100195445 ATACTATGCAACCATAAAAAAGG + Intergenic
1013878951 6:114870100-114870122 ATACTACTCAGCAATAAAAAAGG - Intergenic
1014081979 6:117298022-117298044 ATACTATTCAGCCACTAAAAAGG + Intronic
1014088008 6:117370817-117370839 ATTTTATTCACCCACAAAAATGG + Intronic
1014418344 6:121211650-121211672 ATACTACTCAGCCATAATAAAGG - Intronic
1014423469 6:121272916-121272938 ATACTACGCAGCCATAAAAACGG + Intronic
1014425585 6:121301344-121301366 ATACTACACAGCCATAAAAAAGG + Intronic
1014426382 6:121312011-121312033 ATACTACGCAGCCATAAAAAAGG + Intronic
1014480883 6:121935227-121935249 ATACTATGCAGCCACAAAAAAGG - Intergenic
1014481363 6:121941603-121941625 ATACTACACAGCCATAAAAAAGG - Intergenic
1014532472 6:122575573-122575595 ATACTACTCAGCCATAAAAAAGG + Intronic
1014881748 6:126732049-126732071 ATACTACGCAGCCATAAAAAAGG + Intergenic
1015140513 6:129925931-129925953 ATGCTACTAAAGGACAAAAAAGG - Intergenic
1015367099 6:132408365-132408387 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1015501301 6:133936512-133936534 ATACTATGCAGCCACAAAAAAGG + Intergenic
1015598514 6:134889687-134889709 ATGCTACTCAACCATTAAAGTGG - Intergenic
1015636248 6:135277624-135277646 ATACTACTCAGTCATAAAAAGGG + Intergenic
1015691438 6:135928611-135928633 ATACTACTTAGCCATAAAAAGGG + Intronic
1015802608 6:137075956-137075978 ATACTACGCAGCCATAAAAAAGG + Intergenic
1016617016 6:146062150-146062172 ATACTATGCAGCCACAAAAAGGG + Intronic
1016736178 6:147482658-147482680 ATACTACGCAGCCATAAAAAAGG - Intergenic
1016781625 6:147965594-147965616 ATACTACGCAGCCATAAAAAAGG + Intergenic
1017011752 6:150068210-150068232 ATGCTACTCAGCAACAAAGGAGG + Intronic
1017033331 6:150243822-150243844 ATGCTACTCAGCAACAGAAAAGG + Intronic
1017365446 6:153631460-153631482 ATGCTATGCAACCATAAAAAAGG - Intergenic
1017412027 6:154177946-154177968 ATACTACGCAGCCATAAAAAAGG + Intronic
1017459924 6:154639370-154639392 ATACTACGCAGCCATAAAAAAGG - Intergenic
1017479155 6:154832557-154832579 ATGTTACTAACCCAGAAAAAAGG + Exonic
1017574705 6:155789467-155789489 ATACTACACAGCCATAAAAAAGG - Intergenic
1018263644 6:161996204-161996226 GTACTAATCAGCCACAAAAAGGG + Intronic
1018349168 6:162938234-162938256 ATACTATTCATCCATAAAAAAGG - Intronic
1018531944 6:164774770-164774792 ATGCTATGCAACCATAAAAAAGG - Intergenic
1018552728 6:165016769-165016791 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1018676364 6:166225834-166225856 ATACTATGCAGCCACAAAAAAGG + Intergenic
1018800867 6:167221508-167221530 AAGCAGCTCAACCACAAGAATGG - Intergenic
1019454701 7:1120785-1120807 ATTTTACTCAGCCCCAAAAATGG + Intronic
1019454748 7:1121025-1121047 ATTTTACTCAGCCACAAAAACGG + Intronic
1019785250 7:2972765-2972787 GTGCTACTCAGCCAATAAAAGGG - Intronic
1020229962 7:6310780-6310802 ATATTACTCAGCCATAAAAAGGG + Intergenic
1020411004 7:7891448-7891470 ATATTATTCAGCCACAAAAAAGG + Intronic
1020455410 7:8368126-8368148 ATACTATTCAGCCATAAAAAAGG - Intergenic
1020573911 7:9901465-9901487 ATACTATGCAACCATAAAAACGG - Intergenic
1020821575 7:12974614-12974636 ATACTACTCAGCCATAAAAAAGG - Intergenic
1020844653 7:13267693-13267715 ATTCTGGCCAACCACAAAAATGG - Intergenic
1020943668 7:14572715-14572737 ATCCTATTCAACAGCAAAAAGGG + Intronic
1020995899 7:15263719-15263741 ACACTACTCAGCCACGAAAAAGG + Intronic
1021503384 7:21354365-21354387 TTGTTACTCAACAACAGAAAAGG - Intergenic
1021542684 7:21777265-21777287 ATACTGCTCAACAATAAAAAAGG - Intronic
1021752796 7:23820855-23820877 ATACTGTTCAACCATAAAAAAGG - Intronic
1022047428 7:26633173-26633195 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1022081380 7:27025231-27025253 TTGCTACAAAACAACAAAAAAGG - Intergenic
1022157417 7:27674303-27674325 ATACTACTCAGCCATAAAAAAGG + Intergenic
1022793807 7:33715660-33715682 ATACTACCCAGCAACAAAAAAGG - Intergenic
1022900417 7:34803374-34803396 ATACTATGCAACCATAAAAAAGG + Intronic
1022996934 7:35766242-35766264 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1023363341 7:39438280-39438302 ATACTATGCAGCCACAAAAAAGG - Intronic
1023650702 7:42365776-42365798 ATACTACGTAGCCACAAAAAAGG - Intergenic
1024016521 7:45321072-45321094 ATACTACGCAGCCATAAAAAAGG + Intergenic
1024379310 7:48676450-48676472 ATACTACGCAGCCATAAAAAAGG + Intergenic
1024566205 7:50683130-50683152 ATATTATTCAGCCACAAAAAAGG + Intronic
1024576096 7:50765469-50765491 GTGCTATTCAACCATAAAAAAGG + Intronic
1024595618 7:50933301-50933323 ATACTACTCAGCCATAAAATGGG - Intergenic
1024686315 7:51749738-51749760 ATACTATTCAGCCATAAAAAAGG - Intergenic
1024956322 7:54925291-54925313 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1025091857 7:56070806-56070828 ATACTACTCATCGATAAAAAGGG + Intronic
1025253415 7:57367096-57367118 ACACTACTCAGCCATAAAAAAGG - Intergenic
1025313710 7:57988644-57988666 ATACTACTCAATCAAAAGAAAGG + Intergenic
1025314168 7:57997150-57997172 AAGCTGCTCAACCAAAAGAAAGG - Intergenic
1025576441 7:62648706-62648728 ATACTACTCAAACAAAAGAAAGG + Intergenic
1026287828 7:68978899-68978921 ATACTACACAGCCATAAAAAAGG - Intergenic
1026394073 7:69933810-69933832 ATACTAGTCAAGCACAAAAATGG - Intronic
1026501912 7:70950055-70950077 ATACTACTCAGCCATGAAAAAGG - Intergenic
1026709095 7:72721082-72721104 ATACTATGCAGCCACAAAAAAGG - Intronic
1026795046 7:73360813-73360835 ATACTATGCAACCATAAAAAAGG + Intergenic
1027400519 7:77801118-77801140 ATGCTCCTCAAACACAGAGAAGG - Intronic
1027512472 7:79099810-79099832 ATGCTATGCAGCCAAAAAAAAGG - Intronic
1027539149 7:79445973-79445995 ATACTATGCAGCCACAAAAAAGG + Intronic
1027657735 7:80952145-80952167 ATACTATGCATCCACAAAAAAGG - Intergenic
1027871311 7:83711754-83711776 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1028050844 7:86184011-86184033 ATGTTAATAAACCACAATAATGG + Intergenic
1028161161 7:87485967-87485989 ATACTATGCAACCATAAAAAGGG + Intergenic
1028178032 7:87680210-87680232 ATACTACGCAGCCACAAAAAGGG - Intronic
1028181051 7:87725424-87725446 ATACTATGCAGCCACAAAAAAGG - Intronic
1028288472 7:89034584-89034606 ATACTATGCAACCATAAAAAAGG - Intronic
1028685248 7:93584392-93584414 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1028703318 7:93809056-93809078 ATACTACTCAGCCATAGAAAGGG + Intronic
1028782383 7:94751946-94751968 ATACTATGCAGCCACAAAAAAGG - Intergenic
1028786480 7:94800172-94800194 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1029018126 7:97335856-97335878 ATACTACGCAGCCATAAAAAAGG + Intergenic
1029743060 7:102502093-102502115 ATACTACTCAGCCATAAAAAAGG + Intronic
1029761050 7:102601254-102601276 ATACTACTCAGCCATAAAAAAGG + Intronic
1029849691 7:103448697-103448719 ATACTATGCAACCATAAAAAAGG - Intergenic
1030178346 7:106678246-106678268 ATACTATGCAACCATAAAAACGG + Intergenic
1030181592 7:106715221-106715243 ATACTATGCAACCATAAAAAAGG + Intergenic
1030287547 7:107841972-107841994 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1030331228 7:108273081-108273103 ATGCTATGCAGCCATAAAAAAGG - Intronic
1030346338 7:108437072-108437094 GTACTATTCAACCATAAAAAAGG + Intronic
1030389986 7:108915687-108915709 ATACTATTCAGCCATAAAAAAGG - Intergenic
1030395232 7:108978089-108978111 ATACTACGCAGCCATAAAAAAGG - Intergenic
1030450579 7:109705120-109705142 ATACTACTCAGCTATAAAAAAGG - Intergenic
1030462535 7:109858477-109858499 ATACTATGCAACCATAAAAAAGG + Intergenic
1030550546 7:110953502-110953524 ATGCTATGCAGCCATAAAAAAGG - Intronic
1030600525 7:111586970-111586992 ATGCTTCCCAACCACATAATGGG + Intergenic
1030691712 7:112541994-112542016 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1030736003 7:113049399-113049421 ATACTACACAGCCATAAAAAAGG - Intergenic
1031172884 7:118313630-118313652 ATACTATGCAACCATAAAAAAGG - Intergenic
1031326834 7:120410880-120410902 ATGCTATGCAGCCATAAAAAAGG - Intronic
1031734025 7:125333844-125333866 ACACTACGCAACCATAAAAAAGG + Intergenic
1032290509 7:130586123-130586145 ATACTACTCAGCCATAAAAAAGG + Intronic
1032966990 7:137109075-137109097 ATACTACTCAGCCACAAAAAAGG - Intergenic
1033196812 7:139334609-139334631 ATACTACTCAGCAATAAAAAGGG - Intergenic
1033441470 7:141383552-141383574 ATACTATGCAGCCACAAAAAAGG - Intronic
1033498836 7:141927048-141927070 ATACTATGCAGCCACAAAAAAGG - Intronic
1033787913 7:144756336-144756358 ATACTATGCAACCATAAAAAAGG - Intronic
1033973927 7:147075965-147075987 ATACTACGCAGCCATAAAAAAGG - Intronic
1034576079 7:151999206-151999228 ATATTATTCAACCATAAAAAAGG - Intronic
1034602384 7:152272758-152272780 ATGGTACTCAACAAAGAAAAGGG + Intronic
1034825734 7:154260636-154260658 ATACTACTCAGCCATAAAAAAGG - Intronic
1034953175 7:155315099-155315121 ATACTATACAACCATAAAAAAGG + Intergenic
1035315602 7:157995983-157996005 ATACTATTCAGCCATAAAAAAGG + Intronic
1035315606 7:157996035-157996057 ATACTATTCAGCCATAAAAAAGG + Intronic
1035315610 7:157996087-157996109 ATACTATTCAGCCATAAAAAAGG + Intronic
1035539725 8:423627-423649 ATACTACACAGCCATAAAAAAGG - Intronic
1035857828 8:2995701-2995723 ATGCTACTCCACAGGAAAAAGGG + Intronic
1035894334 8:3380546-3380568 ATACTACGCAGCCATAAAAAAGG + Intronic
1035942889 8:3923607-3923629 AAATTACTGAACCACAAAAATGG - Intronic
1036146012 8:6255567-6255589 ATACTATGCAACCATAAAAAAGG + Intergenic
1036783230 8:11664962-11664984 ATACTACTCACCCATAAAAAAGG - Intergenic
1036955296 8:13181670-13181692 ATACTACGCAGCCATAAAAAAGG - Intronic
1037160841 8:15770218-15770240 ATGCTATCCAGCCATAAAAAAGG + Intergenic
1038935905 8:32251391-32251413 ATACTACGCAACCATAAAAAAGG - Intronic
1039048899 8:33475042-33475064 ATACTACACATCCACTAAAATGG + Intronic
1039201680 8:35101521-35101543 ATACTACTCAGCCATTAAAAGGG - Intergenic
1039212059 8:35228463-35228485 ATACTATGCAACCATAAAAAAGG - Intergenic
1039452531 8:37687131-37687153 ATACTACTCAGCCATAAAAAAGG + Intergenic
1039743266 8:40401328-40401350 ATACTATTCAGCCATAAAAAAGG - Intergenic
1040942513 8:52847047-52847069 ATACTATGCAACCATAAAAAAGG - Intergenic
1040947638 8:52900830-52900852 ATACTACACAGCCATAAAAAAGG - Intergenic
1040984519 8:53279400-53279422 ATACTATTCAGCCATAAAAAAGG + Intergenic
1041020879 8:53637007-53637029 ATACTATGCAGCCACAAAAAAGG - Intergenic
1041119547 8:54572084-54572106 ATCCTACTCACCCATAATAAAGG + Intergenic
1041438641 8:57869531-57869553 ATACTACGCAGCCATAAAAAAGG - Intergenic
1041678026 8:60556014-60556036 ATACTATTCAGCCATAAAAAAGG + Intronic
1041681760 8:60600721-60600743 ATACTACTCAACAATAAGAAGGG + Intronic
1041788551 8:61664306-61664328 ATGCCATTCAACCAAAATAATGG + Intronic
1041841622 8:62278712-62278734 ATACTACGCACCCATAAAAAAGG - Intronic
1042061959 8:64828341-64828363 ATGCAACTCTACACCAAAAATGG - Intergenic
1042084554 8:65093362-65093384 ATACTACTCAGCCATAAAAATGG + Intergenic
1042153012 8:65810154-65810176 ATACTATGCAGCCACAAAAAAGG + Intronic
1042447419 8:68902558-68902580 ATACTATTCAACCATAAAAAAGG + Intergenic
1042479346 8:69286014-69286036 ATACTATGCAGCCACAAAAAAGG + Intergenic
1042627724 8:70777290-70777312 ATACTACGCAGCCATAAAAAAGG - Intronic
1042812366 8:72840244-72840266 ATACTATGCAACCACAAAAAAGG - Intronic
1042968791 8:74385512-74385534 ATACTATGTAACCACAAAAAAGG - Intronic
1043128923 8:76436758-76436780 ATACTATGCAACCATAAAAAAGG - Intergenic
1043224915 8:77713991-77714013 ATACTACTCAGTCATAAAAAAGG - Intergenic
1043365800 8:79531853-79531875 ATGCTATGCAACCATTAAAAAGG - Intergenic
1043449548 8:80352684-80352706 ATACTACACAGCCATAAAAAAGG - Intergenic
1043560292 8:81485329-81485351 ATACCACTCAGCCATAAAAAGGG - Intergenic
1044134662 8:88571517-88571539 ATACTATGCAGCCACAAAAAAGG + Intergenic
1044194231 8:89354968-89354990 ATACTGCTCAACCATAAAAGGGG + Intergenic
1044560895 8:93611177-93611199 ATACTATGCAACCACGAAAAAGG + Intergenic
1044754749 8:95449436-95449458 ATACTACACAGCCATAAAAAAGG - Intergenic
1044928475 8:97229664-97229686 ATACTATGCAGCCACAAAAAAGG + Intergenic
1045521741 8:102908970-102908992 ATGTTATTCAGCCTCAAAAAAGG + Intronic
1045651018 8:104341737-104341759 CTTCCACTCAGCCACAAAAAGGG + Intronic
1045897025 8:107231640-107231662 ATACTACTCAGCAACAAAAAAGG - Intergenic
1045959403 8:107949340-107949362 ATACCACTCCGCCACAAAAAAGG - Intronic
1045974009 8:108110901-108110923 ATACTATGCAACCATAAAAAAGG + Intergenic
1046242289 8:111512031-111512053 ATACTACTCACCAATAAAAAGGG + Intergenic
1046308880 8:112407371-112407393 ATTTTACTAAACCAAAAAAAAGG - Intronic
1046335927 8:112787067-112787089 ATACTATGCAGCCACAAAAAAGG - Intronic
1046602440 8:116332309-116332331 ATACTACGCAGCCATAAAAAAGG + Intergenic
1047146265 8:122202860-122202882 ATACTACACAGCCATAAAAAAGG + Intergenic
1047237460 8:123054653-123054675 ATACGACTCAGCCATAAAAAAGG + Intronic
1047368029 8:124230233-124230255 ATACTACTTAGCCATAAAAAAGG - Intergenic
1047516583 8:125560128-125560150 ATACTACACAACCACTATAAAGG - Intergenic
1047649221 8:126901541-126901563 ATACTACGCAGCCATAAAAAAGG + Intergenic
1047707717 8:127517426-127517448 ATGGTACTGAACAACAAAATAGG + Intergenic
1047889167 8:129288277-129288299 ATACTACTCAGCCATAAAAAAGG + Intergenic
1048071156 8:131022456-131022478 ATACTATACAACCATAAAAAAGG - Intronic
1048088271 8:131208586-131208608 ATACTATTCAGCCATAAAAAAGG - Intergenic
1048562476 8:135556069-135556091 ATGCTATGCAGCCATAAAAAAGG - Intronic
1048843266 8:138583282-138583304 ATACTACACAGCCATAAAAAAGG + Intergenic
1048868435 8:138777702-138777724 ATACTACGCAGCCATAAAAATGG - Intronic
1048913531 8:139159819-139159841 ATACTACGCAGCCATAAAAAAGG - Intergenic
1049051693 8:140202322-140202344 ATGATACTCAAAAACAGAAAAGG + Intronic
1049177067 8:141200439-141200461 ATACTACTCAGCCATAAAAAAGG + Intergenic
1049234338 8:141504656-141504678 ATGCTACTCAGCAACAAAAGAGG + Intergenic
1049590749 8:143460697-143460719 ATGTTACTCTACCATAAGAAAGG + Intronic
1050053599 9:1628919-1628941 ATACTACGCAGCCATAAAAAAGG + Intergenic
1050076000 9:1864772-1864794 ATACTACGCAGCCATAAAAAAGG + Intergenic
1050129633 9:2398059-2398081 ATACTATGCAACCATAAAAAAGG - Intergenic
1050215489 9:3318179-3318201 ATACTATGCAACCATAAAAAAGG + Intronic
1050467595 9:5946158-5946180 ATGCTTTTTATCCACAAAAATGG + Intronic
1050852582 9:10306079-10306101 ATCCTATGCATCCACAAAAAAGG + Intronic
1051059139 9:13026171-13026193 ATACTACACAGCCATAAAAAAGG + Intergenic
1051489136 9:17641774-17641796 ATACTATGCAGCCACAAAAAAGG - Intronic
1051878873 9:21819474-21819496 ATACTACGCAGCCATAAAAAGGG - Intronic
1052103466 9:24480518-24480540 ATGCTATTCAGCCACAAAAAAGG - Intergenic
1052241901 9:26283212-26283234 ATACTACGCAGCCATAAAAAAGG + Intergenic
1052261566 9:26522387-26522409 ATACTACGCAGCCATAAAAAAGG - Intergenic
1052335731 9:27318022-27318044 ATACTATGCAGCCACAAAAAAGG - Intergenic
1052570747 9:30218942-30218964 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1052649771 9:31287447-31287469 ATACTATGCAACCATAAAAAAGG + Intergenic
1053486751 9:38463091-38463113 ATACTACTCAGCAAGAAAAAAGG - Intergenic
1053686539 9:40532615-40532637 AAGCTACTCAATCAAAAGAAAGG - Intergenic
1053711778 9:40819386-40819408 AAACTACTCAACCAAAAGAAAGG - Intergenic
1053938708 9:43202294-43202316 AAACTACTCAACCAAAAGAAAGG - Intergenic
1054094882 9:60890914-60890936 ATGCATCTCTATCACAAAAATGG - Intergenic
1054277246 9:63093243-63093265 AAGCTACTCAATCAAAAGAAAGG + Intergenic
1054277257 9:63093414-63093436 AAACTACTCAACCAAAAGAAAGG + Intergenic
1054397579 9:64671515-64671537 AAACTACTCAACCAAAAGAAAGG - Intergenic
1054397590 9:64671686-64671708 AAGCTACTCAATCAAAAGAAAGG - Intergenic
1054422317 9:64952632-64952654 AAACTACTCAACCAAAAGAAAGG - Intergenic
1054432219 9:65176709-65176731 AAACTACTCAACCAAAAGAAAGG - Intergenic
1054432230 9:65176880-65176902 AAGCTACTCAATCAAAAGAAAGG - Intergenic
1054498155 9:65844796-65844818 AAGCTACTCAATCAAAAGAAAGG + Intergenic
1054498166 9:65844967-65844989 AAACTACTCAACCAAAAGAAAGG + Intergenic
1054831639 9:69631713-69631735 ATACTATGCAGCCACAAAAAAGG + Intronic
1054938488 9:70714445-70714467 ATACTATGCAACCATAAAAAAGG + Intronic
1054940179 9:70732438-70732460 ATACTATGCAACCATAAAAAAGG + Intronic
1055699869 9:78932186-78932208 ATACTATTCAGCCATAAAAAAGG + Intergenic
1055743939 9:79422113-79422135 ATACTATGCAACCATAAAAAAGG - Intergenic
1055860041 9:80738568-80738590 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1056116177 9:83443474-83443496 ATGCTATGCAGCCATAAAAAAGG - Intronic
1056190347 9:84178476-84178498 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1056456899 9:86768922-86768944 ATACTACTCAGCCATAAAAAAGG - Intergenic
1056565451 9:87768756-87768778 ATGCTATACAGCCATAAAAAAGG - Intergenic
1056811376 9:89766961-89766983 ATGCTATTCAGTCATAAAAAGGG - Intergenic
1056910877 9:90699271-90699293 ATGCTTTTCAACCTTAAAAAGGG - Intergenic
1057220622 9:93256041-93256063 ACATTACACAACCACAAAAAAGG - Intronic
1057393483 9:94658717-94658739 ATGCTACTTAGCAATAAAAAGGG - Intergenic
1057450945 9:95159366-95159388 ATGCTATGCAGCCATAAAAAAGG - Intronic
1057460840 9:95260347-95260369 ATGCTATGCAGCCATAAAAAAGG + Intronic
1058081439 9:100704813-100704835 ATACTATGCAACCATAAAAAAGG - Intergenic
1058270848 9:102969376-102969398 ATACTATGCAACCATAAAAAAGG - Intergenic
1058488585 9:105469102-105469124 ATATTATTCAACCACAAAAAAGG - Intronic
1058493574 9:105529430-105529452 ATACTACACAGCCATAAAAAAGG + Intronic
1058514103 9:105751958-105751980 AGTCTACCAAACCACAAAAATGG - Intronic
1058586285 9:106509694-106509716 ATACTATGCAACCACAGAAAAGG - Intergenic
1059582731 9:115568791-115568813 ATTTTACTCAGCCATAAAAAGGG - Intergenic
1059754743 9:117281961-117281983 ATGGAACTCAACCTCAAGAAAGG - Intronic
1059951604 9:119469153-119469175 ATACTATTCAGCCAGAAAAAAGG - Intergenic
1060026047 9:120172433-120172455 ATACTACTCAGCCATAAAAAGGG + Intergenic
1060168124 9:121437204-121437226 ATACTATGCAGCCACAAAAAAGG + Intergenic
1061572570 9:131486928-131486950 ATTCTACACAGCAACAAAAATGG - Intronic
1203384353 Un_KI270438v1:8309-8331 ATACTGCTCAATCAAAAAAAAGG - Intergenic
1203384417 Un_KI270438v1:9666-9688 ATACTGCTCAATCAAAAAAAAGG - Intergenic
1185659335 X:1714431-1714453 CTGTTTCTCAACCACCAAAAAGG + Intergenic
1185674783 X:1840389-1840411 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1185937474 X:4275140-4275162 ATACTACTCAGCCATAAAAAGGG - Intergenic
1186330287 X:8525212-8525234 ATACTATACAGCCACAAAAAAGG - Intergenic
1186379580 X:9043785-9043807 ATGCTATGCAGCCATAAAAAAGG - Intronic
1186548723 X:10479677-10479699 GTACTAGTCAACCATAAAAAAGG - Intronic
1186609258 X:11123291-11123313 ATACTATGCAGCCACAAAAAAGG + Intergenic
1186627526 X:11310493-11310515 ATATTATTCAGCCACAAAAAGGG + Intronic
1186877032 X:13827091-13827113 CTGCAACTCAACCACAAAGCTGG + Intronic
1187071868 X:15896571-15896593 ATACTACGCAGCCATAAAAAAGG - Intergenic
1187207224 X:17194382-17194404 AAACTACTCAACAATAAAAAAGG + Intergenic
1187307733 X:18111882-18111904 ATACTACTCAGCGATAAAAAGGG + Intergenic
1187661405 X:21550724-21550746 ATACTATGCAACCATAAAAAAGG + Intronic
1187758843 X:22557607-22557629 ATACTATTCAGCCATAAAAAAGG + Intergenic
1187760750 X:22581360-22581382 ATACTATGCAGCCACAAAAAAGG + Intergenic
1187778912 X:22795206-22795228 ATACTACGCAGCCACAAAAAAGG + Intergenic
1188026536 X:25216106-25216128 AAGCTATATAACCACAAAAAAGG - Intergenic
1188579349 X:31690775-31690797 ATACTATGCAACCATAAAAAAGG + Intronic
1188596558 X:31908372-31908394 ATACTACGCAACCATAAAAAAGG + Intronic
1188845631 X:35068476-35068498 ATACTATGCAACCATAAAAACGG - Intergenic
1188955339 X:36428732-36428754 AAACTACTCAACAATAAAAAAGG - Intergenic
1189569781 X:42284136-42284158 AGACTCCTGAACCACAAAAATGG - Intergenic
1189627109 X:42910425-42910447 ATACTATGCAACCATAAAAAAGG + Intergenic
1189875329 X:45430595-45430617 ATACTATGCAACCATAAAAAAGG - Intergenic
1189945545 X:46173879-46173901 ATACTACTCAGCCATAAAAAGGG - Intergenic
1190445375 X:50518797-50518819 ATACTATTCAGACACAAAAAAGG - Intergenic
1190624397 X:52322720-52322742 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1190954134 X:55174842-55174864 ATACTACGCAGCCATAAAAAGGG - Intronic
1191047549 X:56155262-56155284 ATACTATTCAGCCATAAAAAAGG + Intergenic
1191066101 X:56349295-56349317 ATACTATGCAGCCACAAAAAAGG - Intergenic
1191198399 X:57749911-57749933 ATACTACACAGCCATAAAAAAGG + Intergenic
1191582632 X:62781582-62781604 ATACTACGCAGCCATAAAAAAGG - Intergenic
1191595360 X:62937563-62937585 ATACTACCCAGCCATAAAAAAGG - Intergenic
1191653172 X:63564110-63564132 ATACTATGCAACCATAAAAAAGG - Intergenic
1191673196 X:63768315-63768337 ATACTACTCAGCCATAAAAAGGG - Intronic
1191753482 X:64568774-64568796 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1191821760 X:65317714-65317736 ATACTACTCAACTATAAAAAAGG - Intergenic
1191828375 X:65390063-65390085 ATGCTATGCAGCCATAAAAAAGG + Intronic
1191831776 X:65422867-65422889 ATACTATGCAGCCACAAAAAAGG - Intronic
1191878972 X:65825454-65825476 ATACTATGCAACCATAAAAAAGG + Intergenic
1191936275 X:66430325-66430347 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1191981708 X:66932851-66932873 ATACTATGCAACCATAAAAAAGG - Intergenic
1192062431 X:67842022-67842044 GTACTATTCAGCCACAAAAAAGG + Intergenic
1192086670 X:68105464-68105486 ATACTACGCAGCCATAAAAAAGG + Intronic
1192414309 X:70964557-70964579 ATACTACACAGCCATAAAAAAGG + Intergenic
1192457807 X:71292091-71292113 ATGAAACAGAACCACAAAAATGG + Intronic
1192733279 X:73822678-73822700 ATGCAACAAAAACACAAAAATGG - Intergenic
1192865638 X:75129253-75129275 ATACTATGCAGCCACAAAAAAGG + Intronic
1192877421 X:75246438-75246460 ATACTATGCAGCCACAAAAAAGG - Intergenic
1192929799 X:75793781-75793803 ATACTATTCAGCCATAAAAAAGG - Intergenic
1192977085 X:76298184-76298206 ATACTATTCAGCCATAAAAAAGG - Intergenic
1193011677 X:76682663-76682685 ATGCTATGCAGCCATAAAAAAGG + Intergenic
1193019422 X:76775119-76775141 ATACTATGCAACCATAAAAAAGG - Intergenic
1193075696 X:77353319-77353341 ATACTATGCAGCCACAAAAAAGG + Intergenic
1193201550 X:78697495-78697517 ATACTATGCAACCATAAAAAAGG + Intergenic
1193296730 X:79842320-79842342 ATACTACGCAGCCATAAAAAAGG + Intergenic
1193305661 X:79948598-79948620 ATACTACTCAGCCATAAAAAAGG + Intergenic
1193327453 X:80196267-80196289 ATGCTATGCAGCCATAAAAATGG + Intergenic
1193327803 X:80202095-80202117 ATACTACACAACCACAAAAATGG - Intergenic
1193591018 X:83389070-83389092 ATACTACTCAGCCATAAATATGG + Intergenic
1193924978 X:87473746-87473768 ATACTATTCAACCTCACAAAAGG - Intergenic
1194085277 X:89519056-89519078 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1194094506 X:89620710-89620732 ATACTATGCAGCCACAAAAAAGG + Intergenic
1194095843 X:89637471-89637493 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1194099114 X:89679971-89679993 ATACTATGCAGCCACAAAAAAGG + Intergenic
1194175252 X:90638526-90638548 ATACTATGCAGCCACAAAAAAGG + Intergenic
1194261697 X:91703405-91703427 ATGCTATGCAGCCATAAAAACGG + Intergenic
1194280192 X:91942024-91942046 ATGCTACTAAACCAGGAAATAGG + Intronic
1194393950 X:93356545-93356567 ATACTACTCAGCCATAAAAAAGG - Intergenic
1194516355 X:94859901-94859923 ATACTACTCAGCCATAAAAAGGG + Intergenic
1194606163 X:95981097-95981119 ATACTACTCAGCCATGAAAATGG - Intergenic
1194656813 X:96583219-96583241 ATACTACTCAGCCGCACAAAGGG - Intergenic
1194832446 X:98640812-98640834 ATACTATGCAGCCACAAAAAAGG + Intergenic
1195020297 X:100820096-100820118 GTACTCCTCAACCACAATAAAGG - Intergenic
1195162753 X:102186520-102186542 ATACTACGCAGCCATAAAAAAGG - Intergenic
1195177538 X:102325592-102325614 ATATTATTCATCCACAAAAAAGG + Intronic
1195181326 X:102361501-102361523 ATATTATTCATCCACAAAAAAGG - Intronic
1195396572 X:104417038-104417060 ATACTACGCAGCCATAAAAAAGG + Intergenic
1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG + Intronic
1195818509 X:108916029-108916051 GTACTACTCAGCCATAAAAAAGG + Intergenic
1195822876 X:108966121-108966143 ATGCTAGTTATCCACAAAGAAGG - Intergenic
1195873488 X:109513130-109513152 ATACTATTCAGCCATAAAAAGGG + Intergenic
1195970452 X:110467443-110467465 ATACTATGCAACCACAAAAAAGG - Intergenic
1196010572 X:110883166-110883188 ATACTACACAGCCATAAAAATGG - Intergenic
1196296865 X:114007860-114007882 ATACTACTGAACAATAAAAAGGG + Intergenic
1196307548 X:114122167-114122189 ATGCTATGCAACCATAAAAAAGG - Intergenic
1196605483 X:117653128-117653150 ATCCTACTCAGCCACAAAAATGG + Intergenic
1196618915 X:117799426-117799448 ATACTATTCAGCCATAAAAAAGG + Intergenic
1197065717 X:122231619-122231641 ATACTACACAGCCATAAAAAGGG - Intergenic
1197105600 X:122710717-122710739 ACACTACTCAGCCATAAAAAAGG + Intergenic
1197120547 X:122885938-122885960 GTACTACTCAGCCATAAAAAGGG + Intergenic
1197172788 X:123453198-123453220 ATACTACGCAGCCATAAAAAAGG + Intronic
1197185680 X:123584539-123584561 ATGTTATTCAGCCACAATAAAGG + Intergenic
1197197971 X:123722374-123722396 ATACTATGCAACCATAAAAAAGG + Intronic
1197198021 X:123722828-123722850 AAGCAACTCAATAACAAAAAAGG + Intronic
1197269707 X:124412318-124412340 ATGCTTCTCAAGGACAAGAATGG - Intronic
1197350345 X:125374393-125374415 ATACTATACAACCATAAAAAAGG - Intergenic
1197493068 X:127142681-127142703 ATACTATGCAACCATAAAAAAGG + Intergenic
1197576328 X:128216752-128216774 ATACTATGCAACCATAAAAAAGG + Intergenic
1197931104 X:131697192-131697214 ATACTATGCAGCCACAAAAAAGG - Intergenic
1198259328 X:134951836-134951858 ATACTATGCAACCATAAAAAAGG + Intergenic
1198477316 X:137008261-137008283 ATACTATGCAACCATAAAAAAGG + Intergenic
1198556389 X:137798096-137798118 ATACTATACAACCATAAAAAAGG + Intergenic
1198661736 X:138976352-138976374 ATACTACTCAGCCATAAAAAAGG + Intronic
1198689531 X:139265322-139265344 ATACTATTCAGCCATAAAAAAGG + Intergenic
1198760193 X:140024377-140024399 ATGCTACGCAGCCATAAAAACGG - Intergenic
1198854621 X:141003027-141003049 ATGATATTCCACCAGAAAAAGGG - Intronic
1198877397 X:141242120-141242142 ATGATATTCCACCAGAAAAAGGG + Intronic
1198908080 X:141584341-141584363 ATGATATTCCACCAGAAAAAGGG + Intronic
1198908711 X:141590083-141590105 ATGATATTCCACCAGAAAAAGGG - Intronic
1198918359 X:141698068-141698090 ATGATATTCCACCAGAAAAAGGG + Intronic
1199011527 X:142764170-142764192 ATACTACGCAGCCATAAAAATGG - Intergenic
1199215375 X:145255269-145255291 ATGATATTCCACCAGAAAAAGGG - Intronic
1199407568 X:147480357-147480379 ATACTACACAGCCAAAAAAAAGG - Intergenic
1199417693 X:147604947-147604969 ATACTACTTAGCCATAAAAAAGG + Intergenic
1199425946 X:147701250-147701272 ATACTACACAGCCATAAAAAGGG + Intergenic
1199699972 X:150367893-150367915 ATACTACGCAGCCATAAAAAAGG - Intronic
1199796731 X:151205640-151205662 ATACTATGCAACCATAAAAAAGG + Intergenic
1199811392 X:151353246-151353268 ATGCAACTCAATATCAAAAAGGG - Intergenic
1200437922 Y:3174938-3174960 ATGCTATGCAGCCATAAAAAAGG - Intergenic
1200447141 Y:3276889-3276911 ATACTACGCAGCCATAAAAAAGG + Intergenic
1200597670 Y:5165519-5165541 ATGCTACTAAACCAGGAAATAGG + Intronic
1200733543 Y:6769318-6769340 ATACTATGCAACCATAAAAAAGG - Intergenic
1200819635 Y:7569308-7569330 ATACTATGCAGCCACAAAAAAGG + Intergenic
1201145225 Y:11060979-11061001 ATACTACTCAGCCATAAAAAAGG + Intergenic
1201313935 Y:12624352-12624374 ATACTATGCAACCAAAAAAAGGG - Intergenic
1201405628 Y:13646794-13646816 ATACTATGCAGCCACAAAAAAGG - Intergenic
1201578751 Y:15489062-15489084 ATACTACACAGCCATAAAAAAGG - Intergenic
1201619690 Y:15942469-15942491 ATACTACACAGCCATAAAAAAGG - Intergenic
1201708346 Y:16961624-16961646 ATACTATGCAGCCACAAAAAGGG + Intergenic
1202056747 Y:20842418-20842440 ATACTATTCAGCCATAAAAAAGG - Intergenic
1202332901 Y:23773336-23773358 ATACTATTCAGCCATAAAAAAGG - Intergenic
1202537868 Y:25896727-25896749 ATACTATTCAGCCATAAAAAAGG + Intergenic