ID: 1195789993

View in Genome Browser
Species Human (GRCh38)
Location X:108573643-108573665
Sequence TGGATACTTACTTGTATTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195789993 Original CRISPR TGGATACTTACTTGTATTCC AGG (reversed) Exonic
906168620 1:43706219-43706241 TGGATGCTTCCTTGTGTCCCTGG + Intronic
906253897 1:44332736-44332758 TGGCTCCTCACTAGTATTCCCGG - Intronic
908648467 1:66305715-66305737 TGGATAGTAATTTGTCTTCCTGG + Intronic
912677858 1:111702054-111702076 TGTACTCTTTCTTGTATTCCAGG - Intronic
917321391 1:173785669-173785691 TGCATACCTACCTTTATTCCTGG - Exonic
917393762 1:174568939-174568961 TGGGTATTTAATTGTATGCCAGG + Intronic
917478035 1:175385709-175385731 TGGATGCTTACATGTGTTCAAGG + Intronic
919040668 1:192383755-192383777 TTGAAACTTGCTTGCATTCCGGG - Intergenic
923649243 1:235857871-235857893 AGAATACTGACTTGTCTTCCTGG - Intronic
1064446996 10:15404083-15404105 TAGATACTTAATTGTATTGTGGG - Intergenic
1067297131 10:44981131-44981153 TGGAAACTTCTTTGTATCCCTGG - Intronic
1068295362 10:55064203-55064225 TAGATAATTACTTGTATGTCAGG - Intronic
1068845316 10:61665133-61665155 GGGATAATTACTTCTATTCTAGG - Intronic
1071912260 10:90249755-90249777 TGTATATTTCCTTTTATTCCTGG - Intergenic
1072936159 10:99715706-99715728 TGGATACTTTCAAATATTCCTGG - Intronic
1078228555 11:9416608-9416630 TTGATCCATTCTTGTATTCCTGG - Intronic
1082053049 11:47788641-47788663 TGGATACTTCTTTGTATTTTGGG - Intronic
1084633534 11:70373589-70373611 TGGTGACTTCCTTGCATTCCAGG - Intronic
1086641309 11:89160079-89160101 TGTATAGTTACTTGTTTTCTAGG + Intergenic
1092159447 12:6308090-6308112 TGGATACTTCTCTTTATTCCTGG - Intergenic
1101139903 12:101784443-101784465 TGGATACAAACTTCTCTTCCTGG - Intronic
1101364500 12:104059229-104059251 TGTATACCTACATGTATACCAGG - Intronic
1102219404 12:111184272-111184294 TGGATACTTAGGTTTTTTCCAGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104116457 12:125753868-125753890 TGGATATTTAAGTGTATTCCAGG + Intergenic
1106916145 13:34516387-34516409 TGAATATTTATTTATATTCCAGG + Intergenic
1107293650 13:38886960-38886982 TGGATATTGACGTTTATTCCTGG + Exonic
1110749451 13:79095732-79095754 TAGATAATTATTTGTATTGCAGG - Intergenic
1111001748 13:82193387-82193409 TGGCTACTTTTTTGTATTTCTGG + Intergenic
1112887776 13:104194730-104194752 TGGATACGTACCTCTATTTCAGG - Intergenic
1114781369 14:25541813-25541835 TGGATACTTCATTGGAGTCCTGG - Intergenic
1114783422 14:25566383-25566405 TTGAAACATACTTGCATTCCTGG + Intergenic
1115059303 14:29170533-29170555 TGGATACTCACTTCTATGCCAGG - Intergenic
1116427807 14:44811403-44811425 TGGAGACTTACTTGTCTCCAAGG - Intergenic
1117397853 14:55328665-55328687 TGTATACAAACTTGTAGTCCTGG + Intronic
1118170877 14:63387311-63387333 TGGATACATACTTTTATTAGTGG - Intronic
1119070780 14:71581492-71581514 TGGATACTTACTGGTTGTCCCGG + Intronic
1127143287 15:55998687-55998709 TTGATAACTACTTATATTCCTGG - Intergenic
1127231852 15:57005134-57005156 TTGATACTTCCTAGTATTTCTGG + Intronic
1129099949 15:73252180-73252202 TGGGCACTTAGTTGTATACCTGG + Intronic
1131744507 15:95432073-95432095 TGAATACTAACTGGTATTCTGGG + Intergenic
1146678410 17:34789822-34789844 TGGATCCTGACTTTTTTTCCTGG + Intergenic
1146820336 17:35979572-35979594 ATGATACTTACTTGTATCCTAGG + Intronic
1153014890 18:574625-574647 TGGACACTTAAATGTGTTCCTGG + Intergenic
1155250706 18:23950837-23950859 TGGATAGTTACTTGCTTTTCTGG - Intronic
1156145246 18:34167385-34167407 TCGATACTTGCTTGTATCTCTGG + Intronic
1157035788 18:43971565-43971587 TGGAAACATCCTTGCATTCCTGG + Intergenic
926582319 2:14644202-14644224 TGGGTAATTACCTATATTCCAGG - Intronic
929713875 2:44291747-44291769 TGCATACCAACTTGTACTCCTGG + Intronic
930223651 2:48770171-48770193 TGGATACCAACTGGTATTCTTGG + Intronic
930569616 2:53068775-53068797 TGGATACATATTTGTATGCAAGG + Intergenic
932974600 2:76583680-76583702 TTGACACATCCTTGTATTCCAGG + Intergenic
933062194 2:77752202-77752224 TTGATAAATACTTGTATTCCTGG + Intergenic
933198458 2:79420184-79420206 TTTATACTTCCTTGTATTCTAGG - Intronic
934502832 2:94872966-94872988 TGGGTACTTCCTTGTGTGCCAGG - Intronic
935272448 2:101446728-101446750 TGCCTAGTTACTTGTTTTCCTGG + Intronic
937730017 2:125218429-125218451 TTGAGACTTCCTTGCATTCCTGG + Intergenic
937972843 2:127564074-127564096 TGGATACTTACTTCTCTTCGGGG - Intronic
939478250 2:142714379-142714401 TGGACAATTAGTTGTAGTCCAGG + Intergenic
940808571 2:158216840-158216862 TGAATACTTAACTGTGTTCCAGG + Intronic
942157549 2:173147009-173147031 TGGATACTTATTTGAATTCTTGG + Intronic
942798842 2:179852747-179852769 GGGATACTTACTTAGATTACTGG + Intronic
943272259 2:185821599-185821621 TTGAAACTTGCTTGCATTCCCGG - Intronic
943497691 2:188644058-188644080 TTGAAACTTACTTGGATCCCTGG - Intergenic
943873213 2:193028370-193028392 TTGAACCTTTCTTGTATTCCTGG - Intergenic
945655575 2:212618977-212618999 TGGATGCTTACTGCTATTTCAGG - Intergenic
946954527 2:224914467-224914489 TGGATCCCTACTTGTATTTCTGG - Intronic
948330922 2:237164309-237164331 AGGAAATTTTCTTGTATTCCTGG + Intergenic
1168926080 20:1580280-1580302 TTGAAACATCCTTGTATTCCAGG - Intronic
1170867171 20:20168588-20168610 TGGATACTTAATTCCATTACTGG - Intronic
1173869415 20:46332239-46332261 TCCATCCTTGCTTGTATTCCTGG - Intergenic
949418604 3:3840294-3840316 TGGAACCTTCCTTGCATTCCTGG + Intronic
951469698 3:23043022-23043044 CGGTTTATTACTTGTATTCCTGG + Intergenic
953626399 3:44575545-44575567 TTGAAATTTTCTTGTATTCCTGG + Intronic
956284168 3:67591027-67591049 TGAATACTGACATGTTTTCCAGG + Intronic
958504493 3:94956994-94957016 TTGAAACTTAATTGTTTTCCAGG - Intergenic
961193267 3:124980362-124980384 TGGATGCTTACTTGTTTTGTTGG - Intronic
962222664 3:133576774-133576796 CTGATACTTACTTATATCCCTGG - Intronic
963822573 3:149914537-149914559 AGGTTATTTACTTGTACTCCTGG - Intronic
963822757 3:149916723-149916745 AGGTTATTTACTTGTACTCCTGG - Intronic
964166453 3:153712413-153712435 TTGAAACATACTTGCATTCCTGG + Intergenic
967370424 3:188738701-188738723 TGAATACTTAATTGGATCCCTGG + Intronic
971144955 4:23966536-23966558 TGGATACTTAATGTGATTCCTGG - Intergenic
971297061 4:25404699-25404721 TGGAGATCTACTTGTAATCCTGG + Intronic
971638877 4:29102503-29102525 TTGAAACTTTCTCGTATTCCTGG - Intergenic
974522347 4:62998936-62998958 TGGAAGCTTTCTTGCATTCCAGG - Intergenic
976073280 4:81267105-81267127 TGGAAACATCCTTGCATTCCTGG + Intergenic
977958520 4:103057982-103058004 TTGATAGTAACTAGTATTCCTGG - Intronic
978219265 4:106250762-106250784 TGGATATCTAGATGTATTCCAGG + Intronic
980732312 4:136838710-136838732 TTGACACTCACTTTTATTCCTGG - Intergenic
980979545 4:139642482-139642504 TGGATACTCATTTGCCTTCCAGG + Intergenic
982006900 4:151072235-151072257 TAAATACTTACTTGTACTCAAGG + Intergenic
982889917 4:160834181-160834203 TGTATCTTTACTTATATTCCAGG + Intergenic
983329378 4:166304854-166304876 TGGATAATCTTTTGTATTCCTGG - Intergenic
984205825 4:176786819-176786841 TGGCTTCTTTCTTGAATTCCTGG + Intronic
985847510 5:2362377-2362399 TTGAAACTTCCTTGTATCCCAGG + Intergenic
987477842 5:18414357-18414379 TTGATACTTAATTATATTTCTGG + Intergenic
990169315 5:53030191-53030213 TGGATACTTAGAGGTAATCCTGG - Intronic
991904173 5:71491878-71491900 TGGATAATTTCTTGTATTTTTGG + Intronic
992997862 5:82350022-82350044 TGGATTCTTCCTTGACTTCCTGG + Intronic
993177617 5:84508465-84508487 TGGATACTTTTTAGTATTGCAGG + Intergenic
994287244 5:97984001-97984023 TGAATACTTACTTGAATTACTGG + Intergenic
998620452 5:143788864-143788886 TGAATACTTACCTCTATCCCAGG + Intergenic
1000763495 5:165255848-165255870 TTGATATTTTCTTGAATTCCAGG - Intergenic
1003083668 6:3043501-3043523 TTGAACCTTACTTGCATTCCCGG - Intergenic
1005094587 6:22100543-22100565 TGAATATTTTCTTGTATTCTGGG + Intergenic
1005953117 6:30645963-30645985 TGAATACTTACCTGTATTGGGGG - Exonic
1007698985 6:43754600-43754622 TTGATACTTCCTTATATACCAGG - Intergenic
1008007176 6:46423131-46423153 TGGATTCCTAATTTTATTCCAGG + Intronic
1008308495 6:49935234-49935256 TGCATTCTTATTAGTATTCCAGG - Intergenic
1009321794 6:62300131-62300153 TGGATAACTACTTGTCTTTCAGG - Intergenic
1010258450 6:73787850-73787872 TGGATAAACACTTGTATTCTGGG + Intronic
1016249660 6:142025689-142025711 TGCCTAGTTACCTGTATTCCTGG - Intergenic
1019006442 6:168801018-168801040 TGGACACTTAGGTGGATTCCAGG + Intergenic
1022176449 7:27875844-27875866 AGGATAATTACTAGTTTTCCAGG - Intronic
1026080877 7:67219210-67219232 TGGATCCATCCTTGCATTCCAGG + Intronic
1026531162 7:71198540-71198562 TGGCCACTTACTGGTAGTCCAGG - Intronic
1026585912 7:71656101-71656123 TGGGTACTTACTTATGTTCCAGG + Intronic
1026696205 7:72594822-72594844 TGGATCCATCCTTGCATTCCAGG - Intronic
1030831625 7:114230543-114230565 TTAAACCTTACTTGTATTCCAGG - Intronic
1031327741 7:120422823-120422845 TGGAAACTTTCTTCTACTCCGGG + Intronic
1033931956 7:146534247-146534269 TGGATACTTTCTCGTATTCTGGG + Intronic
1033977556 7:147120830-147120852 TCGTTACTTACTGGTATCCCAGG + Intronic
1036287936 8:7461063-7461085 TGAATACCTACTTCTATTCTAGG - Intronic
1036333540 8:7850465-7850487 TGAATACCTACTTCTATTCTAGG + Intronic
1038874713 8:31535538-31535560 TGGATATTTACTTGATTACCAGG + Intergenic
1039084975 8:33770968-33770990 TGGATACTCATTTGTATTGGTGG - Intergenic
1039628574 8:39082278-39082300 TTGAAACTTTCTTGTAGTCCTGG + Intronic
1040968197 8:53105415-53105437 TGCAGACTTACAGGTATTCCTGG - Intergenic
1041366932 8:57116348-57116370 CAGATACTCCCTTGTATTCCAGG - Intergenic
1042149801 8:65769500-65769522 TTGAAACTAACTTGTATTCGTGG - Intronic
1042684317 8:71421187-71421209 TGGATCATTACTTCAATTCCAGG + Intronic
1043280222 8:78455063-78455085 TGGATACTTACTTTTACTTATGG - Intergenic
1043452249 8:80379837-80379859 TTAATAATTAATTGTATTCCTGG - Intergenic
1044006959 8:86949480-86949502 TGGGTATTTAATTGTATTCGTGG + Intronic
1045296072 8:100872581-100872603 TGGGCACTTACTTGAGTTCCTGG + Intergenic
1050506123 9:6351228-6351250 TGGACACCTTCTTTTATTCCTGG + Intergenic
1050966828 9:11815065-11815087 TTGAGCCATACTTGTATTCCTGG + Intergenic
1051307672 9:15731808-15731830 TGGAAACTTACATGTGTTGCTGG - Intronic
1057821826 9:98337663-98337685 TGGATGTGTACTTGTATTTCTGG - Intronic
1058152788 9:101480584-101480606 TGGAGAAATATTTGTATTCCAGG + Intronic
1059354677 9:113689272-113689294 CCGAAACTTGCTTGTATTCCAGG + Intergenic
1191901255 X:66042773-66042795 TGGATAGTTACTTTAATTCAAGG + Intergenic
1194249544 X:91557860-91557882 TAGGTATTTACTTGTATTCATGG - Intergenic
1195040631 X:101010736-101010758 TGGGTTCTTCCTTTTATTCCTGG - Intronic
1195064821 X:101231482-101231504 TGAATACTTATTTGTATATCTGG + Intronic
1195202779 X:102565843-102565865 TGGATACAAACATGTAATCCAGG - Intergenic
1195789993 X:108573643-108573665 TGGATACTTACTTGTATTCCAGG - Exonic
1196255947 X:113519020-113519042 CTTATACTTACTTGTATTCTTGG + Intergenic
1200568500 Y:4799110-4799132 TAGGTATTTACTTGTATTCATGG - Intergenic