ID: 1195790215

View in Genome Browser
Species Human (GRCh38)
Location X:108576326-108576348
Sequence TGTTTAAGAAGAGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195790215 Original CRISPR TGTTTAAGAAGAGCAAAAGC AGG Intronic
901124882 1:6922222-6922244 AGTTTCAGATGAGCAAAAGCAGG + Intronic
902279007 1:15360832-15360854 TGTGTAACAAGAACAAAAGGGGG - Intronic
903139362 1:21329830-21329852 AGTTTGTGAAGAGCAAAAGCAGG + Intronic
906185381 1:43858542-43858564 TGCTTGTGAAGAGCAAAAGCTGG + Intronic
906777658 1:48544178-48544200 TGTTTAAAAAGTTCACAAGCTGG + Intronic
907031537 1:51177088-51177110 TGTTTAAGAAACGTAACAGCCGG - Intergenic
907221753 1:52912074-52912096 TGTCTAACAACAGCAGAAGCAGG - Intronic
908675936 1:66604162-66604184 TGTTTAAGAAGAAAAAGTGCTGG + Intronic
910392697 1:86761235-86761257 TATTTAAGAAGAGAAAAGGGTGG + Intergenic
910792726 1:91067967-91067989 TGGGTAAGAAGAGCAAAACTCGG - Intergenic
910994322 1:93087861-93087883 TGTTTAACAAGTGAAAAATCTGG - Intronic
912197937 1:107422219-107422241 TGTATGAGAAGAGCAGATGCAGG + Intronic
912693282 1:111820794-111820816 TTTATAAGAAAAGAAAAAGCTGG + Intronic
912862643 1:113228010-113228032 TGTTAAAGAAGAGAGAAAGAAGG + Intergenic
914424995 1:147567526-147567548 TTTTTAAGTCGAGCAAAAGCAGG + Intronic
914897190 1:151687202-151687224 TGTTCAACAAGGGCAAAATCAGG - Intronic
915417644 1:155754399-155754421 AGCTGAAGAAGAGCAAAAGGCGG - Exonic
916367105 1:164042239-164042261 TGTTTAAGAAAATAAGAAGCAGG + Intergenic
916770266 1:167900843-167900865 TTTTTAACAACATCAAAAGCGGG + Intronic
916864511 1:168841510-168841532 AGTATAAGAAAAGAAAAAGCAGG - Intergenic
916928240 1:169546533-169546555 TGTTTGATGAGAACAAAAGCTGG - Exonic
917476057 1:175369995-175370017 GGTTTAAGAAGAGAAAAAAGAGG - Intronic
917590466 1:176470890-176470912 GGTTGAAAGAGAGCAAAAGCTGG + Intronic
919125837 1:193392392-193392414 TTTTTCAGAAGATCAAAATCTGG - Intergenic
919613067 1:199770755-199770777 TATTTGAGAAGAGCAAAAACAGG - Intergenic
920960801 1:210662515-210662537 GGTTAAAGAAGAGAAACAGCTGG + Intronic
921958062 1:221004410-221004432 TGTTAAAGAAGAGAAGAATCTGG - Intergenic
922538124 1:226398311-226398333 ATTTTAAAAAGAGCAAAACCAGG + Intronic
922641474 1:227236272-227236294 TTTTTAAAAACAGCAAAAGCTGG - Intronic
922943698 1:229492063-229492085 TGTTTTAGAAGAGCTAAAATAGG - Intronic
924761411 1:246990354-246990376 AGTATAAGAAGAGAAAAAGAAGG + Intronic
1063612310 10:7573076-7573098 TGTTTAAAAAGTGTAAAACCAGG - Intronic
1063652987 10:7958674-7958696 TGCTTCAGAAGAGCATGAGCAGG - Intronic
1066191928 10:33064004-33064026 TGCTTCAGAAAAGCAAAACCTGG - Intergenic
1066327670 10:34380926-34380948 CATTTAAGTAGAGCAAAAGGAGG + Intronic
1068132357 10:52910591-52910613 TTTTTAACCAGAGCAAAACCTGG + Intergenic
1068245829 10:54365906-54365928 TGTTTACGAAGAGCGTAAGAGGG + Intronic
1068622098 10:59197613-59197635 TGTTAAAGAAGAGTAAAAGCAGG - Intronic
1068911949 10:62387998-62388020 TGTTTAGGAAGAGCAAACCAGGG - Intronic
1068987094 10:63117509-63117531 TGTTAAAGAAGAACTAGAGCAGG - Intergenic
1069530624 10:69216547-69216569 AGTTTAAGAAAAGCCAAAGTAGG + Intergenic
1069658643 10:70108863-70108885 TGTTTAACGAGAGCAAGAGCTGG - Intronic
1069688227 10:70333040-70333062 TGGGTAAGAAGAGCAGAGGCAGG + Intronic
1071998109 10:91166393-91166415 TATTTAGGAAGTGAAAAAGCAGG + Intronic
1073446538 10:103584339-103584361 TGTTTAAGCAGAGGAATAGGTGG - Intronic
1073467448 10:103702499-103702521 TGTTTAAAAAGAGCAGAAGCAGG + Intronic
1073556120 10:104453451-104453473 TGATTAAGAAAAACAAAAGAAGG - Intronic
1074419202 10:113294198-113294220 TGTTTATGAAGAGTAAATGAAGG + Intergenic
1074730936 10:116374648-116374670 TATTTAAAAAGTCCAAAAGCAGG + Intronic
1074743446 10:116507357-116507379 TTTTTAAGAAGAGAAAAATATGG + Intergenic
1075107620 10:119552150-119552172 TATTTACAAAGAGCAAAAACAGG + Intergenic
1077970270 11:7181900-7181922 TGGTTGAGTAGAGCACAAGCAGG + Intergenic
1078201987 11:9191538-9191560 TGTTTAAGAAACCCAAAAGTTGG - Intronic
1080314344 11:30932919-30932941 TGTGAAAGAAGAGTAAATGCAGG + Intronic
1080373873 11:31684923-31684945 TGTTTAGTAAGATCAAAATCAGG - Intronic
1080911690 11:36606612-36606634 AGTTTAAGAAGTGGAAAAGAAGG + Intronic
1081094309 11:38913729-38913751 TGTATAATAAGAGAAAATGCTGG + Intergenic
1082773961 11:57231501-57231523 TGTTTCAGAAGAGGGAGAGCAGG + Intergenic
1083457558 11:62789160-62789182 AGATCCAGAAGAGCAAAAGCAGG - Exonic
1084269868 11:68023030-68023052 TGTGTAAGAAGGACAAAGGCAGG - Intronic
1084703597 11:70803112-70803134 TGTTTGGGCAGAGGAAAAGCAGG + Intronic
1086329315 11:85737903-85737925 TGATTGAGAAGGGCAAAAGAGGG + Intronic
1086997836 11:93378940-93378962 ACTTAAAGAAGAGAAAAAGCAGG - Intronic
1087366444 11:97225805-97225827 TGTTAGAAAAGAGCAAAAGAGGG + Intergenic
1088837363 11:113589189-113589211 TGTATAAGAAGGTAAAAAGCAGG + Intergenic
1089535697 11:119159760-119159782 TTAATAAGAAGAGCACAAGCTGG + Intronic
1090266263 11:125354964-125354986 TGTTTAGAAAGTGCAAAAGCGGG + Intronic
1090310169 11:125729536-125729558 TCTTACAGAAGAGCAAAAGCTGG - Intergenic
1090644852 11:128759004-128759026 TGTTTGAGAAGGGAGAAAGCTGG - Intronic
1093103071 12:15051303-15051325 TGTTTAAGAAGACAAAAATATGG + Intergenic
1094551430 12:31455410-31455432 TGCTTAAGAAGGGCCCAAGCTGG + Intronic
1095473890 12:42565725-42565747 GGTTTAAAAAGAGAAAAAGAAGG - Intronic
1095726511 12:45459437-45459459 TGTTTAAGATAAGAAAAAGGTGG - Intergenic
1097885887 12:64728751-64728773 TCTTAAAGGAGAGCAAAAGAGGG + Intronic
1098000531 12:65937404-65937426 AGTTGAAGAAGAGCAGAACCTGG - Intronic
1098626256 12:72673618-72673640 TGCCTATGAAGCGCAAAAGCTGG + Intergenic
1098916217 12:76259352-76259374 GGATTAAGAAGAGCAAAAGAGGG - Intergenic
1099588589 12:84555152-84555174 ACTTTAAGAAGAGCAAAAGGAGG - Intergenic
1100091924 12:90983515-90983537 AGTATAAGAAAAGCAGAAGCTGG - Intronic
1100267201 12:92989070-92989092 TGATTAAAAATAGCAAAAGTAGG - Intergenic
1100395033 12:94178453-94178475 TGTTTAAAAAAAACAAAAACTGG + Intronic
1101713012 12:107286267-107286289 TGGTTCAGAAAAGAAAAAGCTGG + Intergenic
1101906298 12:108829029-108829051 GGTTTAAGAAAAGTAAAAACTGG + Intronic
1101995310 12:109521326-109521348 TATTTAAGGGGAGCAACAGCAGG + Intronic
1102162246 12:110778953-110778975 TATGTAAGAAGAGGAAAAGAGGG + Intergenic
1104419425 12:128622705-128622727 TGTTCAAGAAGGGCAGAGGCAGG + Intronic
1104832833 12:131766110-131766132 TCCTTAAGCAAAGCAAAAGCTGG + Exonic
1106247124 13:27960212-27960234 TGTTTAAGAAAAACAAAATTGGG - Intergenic
1110195692 13:72785431-72785453 TGTTTAATCAGAGCAAAATGGGG - Intronic
1111493781 13:89021206-89021228 TCTTAAAGAAGAGCCAAGGCAGG + Intergenic
1111883387 13:93987715-93987737 TGATTAGGAAGAGTAAAAGAAGG - Intronic
1112624347 13:101086123-101086145 TATTCAAGAATAACAAAAGCTGG - Intronic
1112685562 13:101821247-101821269 TTTTTAAAAAGAGCAAAATTTGG - Intronic
1113192355 13:107763583-107763605 TGTATAAGACAAGCAAAAGCAGG - Intronic
1113316275 13:109182875-109182897 TGTTTGAAACTAGCAAAAGCTGG + Intronic
1113498703 13:110755662-110755684 TGTCTAGGAAGAGCAAAGACAGG - Intergenic
1114612054 14:24049236-24049258 TGTTTAAGAAGAGGAAAGTGAGG - Intergenic
1115927817 14:38456655-38456677 TGTTGAAGAAGAAGAAAGGCAGG - Intergenic
1118054070 14:62060058-62060080 TTTTTAAGAAGAGCAAAGTAGGG - Intronic
1118785661 14:69043703-69043725 TGTCTTAGAAGAGCAGAAGTAGG - Intergenic
1119354693 14:73996172-73996194 TGATTAAGAAGAGCTGAAACAGG - Intronic
1119374796 14:74181286-74181308 TTTTTAAGAAGAAAAAAAGCCGG + Intronic
1120546859 14:85822260-85822282 TTATTAAGAACAGCCAAAGCAGG - Intergenic
1120736807 14:88062443-88062465 AGTTTCAGGAGAGCAAAAGAAGG + Intergenic
1120837575 14:89055285-89055307 TATTAAAAAAGAGCAAAAGCTGG + Intergenic
1120887453 14:89462982-89463004 TTTTTAAGAAGAGGAAGAGAGGG - Intronic
1121690411 14:95874325-95874347 TGTTTAAGCATAGCAAAAGCTGG - Intergenic
1121912095 14:97800982-97801004 TGTTTTGGAGGAGAAAAAGCAGG + Intergenic
1123906990 15:24931294-24931316 TGTTAAAGAAAAACAAAAGCTGG + Intronic
1125299793 15:38242673-38242695 AGTCTAAAAAGAGCAAAACCAGG + Intergenic
1125803378 15:42470498-42470520 TTTTTAAAAAAAGGAAAAGCTGG - Intronic
1126257861 15:46649190-46649212 TGTGAAAGAAGAGAGAAAGCGGG - Intergenic
1127937652 15:63658091-63658113 TGTTTAAGAAGTGATTAAGCAGG - Intronic
1129641892 15:77388443-77388465 TGTTTAAGCAGGGGAAAAGGAGG - Intronic
1129975476 15:79817827-79817849 TGTTTAGGAAAAGAAAAAGATGG - Intergenic
1130241659 15:82199044-82199066 TTTTTAAAAAGAAAAAAAGCAGG - Intronic
1131233863 15:90679896-90679918 TGTTTAAAAAGAGTAGAACCTGG - Intergenic
1133243747 16:4432641-4432663 TGTTTAAAAAGTGAATAAGCCGG - Intronic
1133971314 16:10570124-10570146 TGTTTAAGCCCAGCAAGAGCTGG - Intronic
1134452711 16:14373375-14373397 TGCTTAAAAGGAGCAAAATCTGG - Intergenic
1135530134 16:23245998-23246020 TGTTTAAAAAAAAAAAAAGCTGG + Intergenic
1137923832 16:52520392-52520414 TGTTTACAACAAGCAAAAGCTGG + Intronic
1138561085 16:57801582-57801604 TGTTCAGGCAGAGGAAAAGCCGG + Intronic
1139527337 16:67525018-67525040 TGCTGAACCAGAGCAAAAGCTGG - Intronic
1139658807 16:68406022-68406044 TGTTGACCAAGGGCAAAAGCAGG - Intronic
1140103989 16:71942490-71942512 TGTTCAATAAGTGCAAAACCAGG - Intronic
1140576581 16:76176906-76176928 TGTTTAAGAATAGCCAGAACTGG - Intergenic
1143284330 17:5777859-5777881 TATCCAAGAGGAGCAAAAGCAGG + Intronic
1148788388 17:50158120-50158142 AGTCTAACAAGAGCAAAAGTTGG - Intergenic
1150425950 17:65077227-65077249 TGTTTAAGATGATCACTAGCTGG + Intergenic
1151095356 17:71491156-71491178 TGTTTAAGTACAGTAATAGCTGG - Intergenic
1153324685 18:3806369-3806391 AGTCTAAGAATGGCAAAAGCAGG - Intronic
1153630513 18:7064937-7064959 TGATTAAGAATAGCCAAGGCCGG + Intronic
1154022020 18:10672315-10672337 TGTTTCAGAAGTTCAAAAGCAGG + Intronic
1155266962 18:24103777-24103799 AGGGCAAGAAGAGCAAAAGCAGG - Intronic
1156193102 18:34742700-34742722 TTTTTAAGAAGAGAAAACGAAGG - Intronic
1156951488 18:42905447-42905469 TTTTTAAGAAGAGAAAAACATGG + Intronic
1158086539 18:53657771-53657793 AGTTTAAGAAGAGCAGAAGAGGG - Intergenic
1158531070 18:58262186-58262208 TGTTAAATATTAGCAAAAGCAGG + Intronic
1158724009 18:59951651-59951673 TGTTTTAAAAGAGCATAAGGAGG - Intergenic
1161193077 19:2970329-2970351 TGTTTAAGAATTGCTTAAGCAGG + Intergenic
1165986699 19:39775870-39775892 TGTATATGAAGTTCAAAAGCTGG + Intergenic
1166091770 19:40513847-40513869 TGGGTAACAAGAGCAAATGCTGG - Intronic
1167394510 19:49219210-49219232 TGTTTCAGAAAAGAAAAAGACGG + Intergenic
1168618408 19:57856706-57856728 TGCTTAAGGAGAGGAAAAGGTGG - Intronic
925142308 2:1558719-1558741 TGTTTAAGAAGATCAGAAGGAGG - Intergenic
927589839 2:24345097-24345119 TGTATAATAAGTGTAAAAGCTGG - Intronic
927632144 2:24783817-24783839 TGTTAAAGAAGGACAAAAGCTGG + Intergenic
928262644 2:29781727-29781749 TGTTTTGCAAGAGAAAAAGCTGG + Intronic
928719676 2:34104982-34105004 TCTTAAAAAAGAACAAAAGCGGG + Intergenic
929173621 2:38956079-38956101 TGTTTTACAAGAGAAAATGCAGG + Intronic
929366860 2:41169381-41169403 TATTTTAGAAGAGGAAAATCAGG + Intergenic
929495388 2:42437226-42437248 TGTTTAAAAAGATCAGAAACTGG - Intergenic
930711492 2:54554964-54554986 GGGTTAATAAAAGCAAAAGCTGG - Intronic
933791135 2:85884684-85884706 TGTTTATGAAAAGCAAAAAGGGG + Intronic
934850123 2:97693694-97693716 TGCTGAAGCAGAGAAAAAGCTGG - Intergenic
935255355 2:101305452-101305474 GGATTAAACAGAGCAAAAGCTGG - Intronic
935821689 2:106899303-106899325 TGTTTAATAAGAGCAATCACTGG - Intergenic
937225197 2:120364806-120364828 TGTTTATCAAGGGCAAAAACTGG - Intergenic
937554575 2:123137804-123137826 TGTCCCAGAAGAGCAAAAACTGG + Intergenic
937714809 2:125019925-125019947 TTTCTCAGAAAAGCAAAAGCTGG - Intergenic
937842136 2:126534642-126534664 TGGTTAAGGAGAGGAAAAGGGGG + Intergenic
938210121 2:129460036-129460058 AGTTTAAGGAGAGGACAAGCAGG + Intergenic
940237884 2:151530353-151530375 AATTTAAGAAGAGCAAAAGTGGG - Intronic
940250006 2:151664730-151664752 AGGTTAACAACAGCAAAAGCTGG - Intronic
943419811 2:187655988-187656010 TGTGTAAGAAGAGCACAATGTGG + Intergenic
943533451 2:189116451-189116473 TGTTTAAGGAAAGCAAAATGAGG - Intronic
944025662 2:195163667-195163689 ATTTTAAAAAGAGAAAAAGCAGG + Intergenic
944321862 2:198355137-198355159 TGTTAAAGATGAGGAAATGCAGG + Intronic
947342041 2:229150509-229150531 TGTATAGGAACAGGAAAAGCAGG - Intronic
947841649 2:233211547-233211569 TTTTTAAAAATAGCAGAAGCAGG - Intronic
1169030292 20:2401434-2401456 TGTTTAAGCAGGGAAAAGGCGGG - Intronic
1169560004 20:6789667-6789689 TGTCTTAGCAGAGAAAAAGCTGG + Intergenic
1170381691 20:15767111-15767133 TTTTTTAAAAGAGAAAAAGCTGG - Intronic
1170507836 20:17047040-17047062 TATTTAAGGCCAGCAAAAGCAGG - Intergenic
1170939502 20:20836724-20836746 TTTCTTAGAAGAGCAAATGCAGG + Intergenic
1172660745 20:36566730-36566752 TAGAAAAGAAGAGCAAAAGCAGG + Intergenic
1172858924 20:38032351-38032373 AGTGCAATAAGAGCAAAAGCAGG + Intronic
1174102113 20:48135715-48135737 TGTCTAAAAAGAGCACAAGACGG - Intergenic
1177486407 21:21762357-21762379 TATTTAAGAATAGCTAAAGCTGG + Intergenic
1178746590 21:35256953-35256975 AGTTTCAGAAGAGAAAAAGGGGG + Intronic
1179943753 21:44656378-44656400 CTGTTCAGAAGAGCAAAAGCTGG - Intronic
1182614466 22:31577580-31577602 TTTTTAAGAAGAGAAGAGGCTGG + Intronic
1182727818 22:32461871-32461893 TGTTTTAAAAGAGCAAAAATAGG + Intronic
1182748540 22:32624118-32624140 TGTTTCAGAAAAGCAATAACCGG - Intronic
1184371590 22:44085607-44085629 TTTTTTAAAAAAGCAAAAGCAGG - Intronic
1184611039 22:45603354-45603376 TGATTAAGAAAAGGAAATGCCGG - Intergenic
949171678 3:1006550-1006572 TGTTTAAGAAGAACACCAGCTGG + Intergenic
949521499 3:4859172-4859194 ATTTTAAAATGAGCAAAAGCAGG + Intronic
951348104 3:21571200-21571222 TTTTTATGAAGTGCAAAAGCAGG - Intronic
952153355 3:30616592-30616614 TGTTTCAGAAGAGAAAATACTGG - Intronic
952429580 3:33209811-33209833 TGATTAAAAAGAGCCAAAGAGGG - Intronic
952661166 3:35849624-35849646 TGTTTAAGAAGCACAAGTGCAGG + Intergenic
952848101 3:37705488-37705510 TGTTTAAGAAAACCAAATGTAGG + Intronic
953829488 3:46283165-46283187 AGTTCAAGAATAGCAAAAACGGG + Intergenic
954349065 3:50027146-50027168 TGGTTAGGAGGAGAAAAAGCTGG + Intronic
955357794 3:58245875-58245897 TTTTAAATAAGAGGAAAAGCAGG - Intronic
956686873 3:71837525-71837547 TGTTAAACAAGATCAAATGCTGG - Intergenic
956888536 3:73586128-73586150 TTTTTAAAAAGAGCAAAATCAGG + Intronic
957831039 3:85519225-85519247 TGTCTAAGAAAGGCAAAAACGGG - Intronic
959158337 3:102694074-102694096 TGGTTAAAAAAATCAAAAGCTGG + Intergenic
959315261 3:104797340-104797362 TGTCTAAGAAAGGAAAAAGCTGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960244590 3:115386276-115386298 TGTTTGAAAGGAGCAAATGCAGG - Intergenic
960912492 3:122663259-122663281 TGTTTAAAAAGGGTAAAACCAGG - Intergenic
960933050 3:122874044-122874066 TATTTAAAAAGAACAACAGCAGG + Intronic
961188901 3:124940725-124940747 TCTTTAAGATGAGTAAAGGCCGG - Intronic
961425141 3:126839282-126839304 GGTTTAGGAAGAGTACAAGCAGG + Intronic
962376751 3:134864640-134864662 GGTTTCAGAAAAGCAAAAGCAGG - Intronic
962624054 3:137207905-137207927 TCTTTAAAAGGAGAAAAAGCTGG + Intergenic
963135968 3:141904678-141904700 TGTTTAAAAAGAATAAAATCAGG - Intronic
964709227 3:159654046-159654068 TATTTAAAAAGATAAAAAGCAGG - Intronic
964922675 3:161916821-161916843 TGTCTCAGAAGAGGAAAAGTAGG - Intergenic
966169989 3:177069270-177069292 TGTATTAGAAGACCAAAATCAGG + Intronic
966325066 3:178744793-178744815 TGTGTAAGAAGAGCAAAATCAGG - Intronic
967457886 3:189710806-189710828 TGTGTAAGAAGAGCAGGAGGTGG - Intronic
967461669 3:189754824-189754846 TGTATAGGAAGAACAAAAGGAGG - Intronic
967635273 3:191793654-191793676 TATTTAAAAAGAGCAGAAACAGG + Intergenic
968254832 3:197259392-197259414 TTTTTCATAAGAGGAAAAGCAGG - Intronic
968260334 3:197317022-197317044 TGTATAAGCAGGGCAAAGGCTGG + Intergenic
968334091 3:197898505-197898527 TGCTCAAGAAAAGCAAAAGATGG + Intronic
968376630 4:48323-48345 TTTTAAAGAAAAGCAACAGCTGG - Intergenic
971227456 4:24768163-24768185 TGTTTAAGATCAGCAAACACAGG - Intergenic
971285247 4:25282601-25282623 TGAATAAAAACAGCAAAAGCAGG - Intergenic
971573963 4:28250758-28250780 TGTGTAAGAAGAGCACAAGAGGG + Intergenic
972232535 4:37092228-37092250 TCTTTAAGAAGACCAAAAATAGG + Intergenic
972258729 4:37386662-37386684 TGTATAAGTAGGGAAAAAGCAGG - Intronic
972554707 4:40170312-40170334 TGTCTAATAAGAGCACATGCAGG + Intergenic
972651097 4:41018476-41018498 TGATGGAGAAGAGCAAAGGCAGG + Intronic
972723953 4:41729381-41729403 TGGTCAAGAGGAGCAAAAGGAGG + Intergenic
973198279 4:47471055-47471077 GATTTAAGAAGAGCAATAGAGGG + Intergenic
973936846 4:55854552-55854574 TGTTTATGAAGACCTGAAGCCGG - Intronic
975978983 4:80133930-80133952 TTTTAAAAAAGAGCAAAAACAGG + Intergenic
977550288 4:98434980-98435002 AGTTTATGAATAGCATAAGCTGG + Intronic
978846150 4:113275183-113275205 TGTTTAAAGAGAGCTGAAGCTGG + Intronic
979563859 4:122131991-122132013 GGTTGAAGCAAAGCAAAAGCAGG + Intergenic
982027092 4:151261727-151261749 TGCTAAACAAGAACAAAAGCAGG - Intronic
983265440 4:165503134-165503156 TACTTAAGAACAGCAAAACCAGG - Intergenic
984123221 4:175771814-175771836 TGATTGAGAAGAATAAAAGCAGG - Intronic
986011231 5:3717614-3717636 TGTTTAAGAGGACCACAAGAGGG + Intergenic
986366718 5:7040215-7040237 TTTTTAATTAGAGGAAAAGCTGG + Intergenic
988294457 5:29336913-29336935 TGTTTTAGAATATGAAAAGCAGG - Intergenic
988540657 5:32105889-32105911 TGTGTAAAAAGTCCAAAAGCTGG + Intronic
988774330 5:34463709-34463731 TGAATAAGAGGAGGAAAAGCAGG + Intergenic
989745845 5:44828605-44828627 TGTGTATGAAAAGCAAAGGCAGG + Intergenic
990731892 5:58817844-58817866 TATATGTGAAGAGCAAAAGCAGG + Intronic
990737223 5:58877523-58877545 TCTTTAAAAAGATCTAAAGCTGG - Intergenic
990848312 5:60170861-60170883 TTTTAAAGAGGAGAAAAAGCTGG + Intronic
992389325 5:76315765-76315787 AGTTTAACAAGAGCCTAAGCAGG + Intronic
994700957 5:103134733-103134755 TCTTTAACAAAAACAAAAGCAGG + Intronic
995463839 5:112430428-112430450 TGATTAAGAAGATGAATAGCTGG - Intergenic
995860828 5:116638796-116638818 TTTTTATGAAGTTCAAAAGCTGG - Intergenic
996062691 5:119049612-119049634 TGTTTAAGAATTGCTTAAGCAGG + Intronic
996178777 5:120393155-120393177 TGGTTATTAAGAGCAAAACCTGG + Intergenic
996620092 5:125489937-125489959 TGTTTAAAAATACCAAAAACTGG - Intergenic
996772668 5:127101486-127101508 TTTTTGAGCAGAGAAAAAGCAGG - Intergenic
997938882 5:138138878-138138900 TGATTAAGAATAGCAATAGTAGG + Intronic
998273186 5:140725850-140725872 TGTTTTGGGAGCGCAAAAGCTGG + Intergenic
999717247 5:154371222-154371244 TTTTTAAGAAGAGAGAAATCTGG - Intronic
999728931 5:154461013-154461035 TATTTATTAAGAGCAAAAGTCGG - Exonic
1000344216 5:160300819-160300841 TGTTTAAAAGGAGCAGGAGCCGG - Intronic
1002292974 5:178212201-178212223 TGTTTGTGGAGAGCAAAGGCTGG - Intronic
1002494311 5:179601467-179601489 TGTTTTTCAAGAGCAAAAGGTGG - Intronic
1004828357 6:19449302-19449324 TGTTTAAAAAGAACAAAAACGGG - Intergenic
1005256313 6:24007155-24007177 TGTTTTAGAAGGACAAAGGCGGG + Intergenic
1006696637 6:35936335-35936357 TGTTAAAGTAGAGTAAAAGATGG - Intergenic
1007287748 6:40759975-40759997 TGTTCAAGGAGAGGAAATGCAGG + Intergenic
1008114589 6:47533457-47533479 TGTTTGAGCAGAGCAAAGGTTGG + Intronic
1008454064 6:51688309-51688331 TGTTTAAGAATAGCAAATTTTGG - Intronic
1009906957 6:69881874-69881896 TGTTGAAGAAGATGACAAGCTGG + Intronic
1010434640 6:75814907-75814929 AGTTTTGGAAGAGTAAAAGCAGG - Intronic
1011050924 6:83149012-83149034 TGTTTAAGAAAAAAAAAAGTGGG + Intronic
1012244065 6:96906546-96906568 TGTTTTAGAAGAGAAAGACCAGG + Intergenic
1012882682 6:104809943-104809965 TGATTAAGATGAGGAAAAACTGG + Intronic
1013985376 6:116186172-116186194 TGTTTAAGGAGAACAAAGGTAGG + Intronic
1014323576 6:119963176-119963198 TGTTTAAAAAGAGAACAAGCTGG - Intergenic
1014751570 6:125262753-125262775 TTTATAAGAATACCAAAAGCTGG - Intronic
1015137764 6:129892694-129892716 TATTTAAGGAGAGAAATAGCTGG - Intergenic
1016644995 6:146397180-146397202 TTTTTAAAAAGCACAAAAGCTGG + Intronic
1017277583 6:152587996-152588018 TGTTTAAGAATAATAATAGCAGG + Intronic
1017874034 6:158509511-158509533 TGTTTAATAAGAGCAAATATAGG + Exonic
1018515895 6:164579785-164579807 AGTTTAAGATGAGGAAAAGCAGG - Intergenic
1019313574 7:374495-374517 TGTCTCAGAAGAGCAATGGCGGG + Intergenic
1019665083 7:2247840-2247862 TTTTTAAGACGAGCAACAGCCGG + Intronic
1021355108 7:19644613-19644635 TGTGGAAGAAGAGGATAAGCTGG + Intergenic
1023274511 7:38503336-38503358 TGTTTAAGAAAAGCTGCAGCCGG - Intronic
1024389163 7:48787214-48787236 CCTTAAAGAAGAACAAAAGCTGG - Intergenic
1024399997 7:48913338-48913360 TGTTTCAGATGAGAAAATGCTGG + Intergenic
1025877303 7:65494773-65494795 TAATTAATAAGAGGAAAAGCAGG + Intergenic
1025992199 7:66504673-66504695 TGTTGAAGAAGAAAAGAAGCGGG + Intergenic
1027529962 7:79317928-79317950 AGGTTAAGTACAGCAAAAGCTGG - Intronic
1027559349 7:79707584-79707606 TCTATAAGAAAATCAAAAGCAGG - Intergenic
1028064214 7:86361560-86361582 TTTTTAAGAAAAACAAAACCAGG + Intergenic
1028269182 7:88767003-88767025 TGTTTAAGAAAAGAAAAAACTGG - Intronic
1029747915 7:102526759-102526781 TTTATATAAAGAGCAAAAGCAGG - Intergenic
1029765864 7:102625849-102625871 TTTATATAAAGAGCAAAAGCAGG - Intronic
1029946477 7:104538699-104538721 TGATAAAGAATAGCAAAAGTGGG + Intronic
1030430984 7:109448408-109448430 TGTTTAAAATGGGCAAAAGTGGG - Intergenic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030753880 7:113265850-113265872 TTTTTAATTACAGCAAAAGCTGG - Intergenic
1032146297 7:129384535-129384557 TGTGTATGAACAACAAAAGCAGG + Intronic
1033136721 7:138791102-138791124 TGTTTATGAAGATGAAAAACAGG + Intronic
1033754598 7:144387729-144387751 TGTTAAAGAAGGTCAAAAGCTGG - Intergenic
1035104240 7:156428835-156428857 TCATTATGCAGAGCAAAAGCAGG + Intergenic
1035104309 7:156429227-156429249 TCATTATGCAGAGCAAAAGCAGG + Intergenic
1036080741 8:5552982-5553004 TGTTTAAGAAGAGGAACACATGG - Intergenic
1037348581 8:17924600-17924622 TGTTTAGAAAGATCAAAAGAAGG - Intronic
1038913945 8:31998982-31999004 TCTTTAAGAAGACCCAAAGCAGG + Intronic
1039706510 8:40012883-40012905 TGGATAAGAAGAGTAACAGCAGG - Intronic
1040656846 8:49520531-49520553 TTTTTTAAAAGAGCAGAAGCCGG + Intergenic
1040698105 8:50027126-50027148 TGTTTAAAACAAGCAAAAGTGGG + Intronic
1041234829 8:55789794-55789816 TGTTCAAGTAAGGCAAAAGCTGG - Intronic
1043796685 8:84550621-84550643 TATTTTATAAGAGCAAAAGTAGG + Intronic
1045553979 8:103197317-103197339 TTTTTAAGAAGAGGAAACTCAGG - Intronic
1050015824 9:1232883-1232905 TTGTTAAGAAAAGCAAAAGCTGG + Intergenic
1050232472 9:3541570-3541592 TGTTTAGTAAGAGGAAAAACTGG + Intergenic
1051441970 9:17094546-17094568 AGTTTAAAAATAACAAAAGCAGG - Intergenic
1051775630 9:20630101-20630123 TGCTTAATAAGAACAAAAGTAGG + Intergenic
1051896746 9:21995626-21995648 TGTTTGGGAACAGTAAAAGCAGG + Intronic
1052389493 9:27862520-27862542 TTTTTAAGAAGTTCAAACGCTGG + Intergenic
1052525246 9:29609145-29609167 TGTTTAAGAAGAAAAAAATAAGG + Intergenic
1052553962 9:29988701-29988723 TATTTATGAAAAGTAAAAGCAGG - Intergenic
1052667209 9:31510411-31510433 TATTCAAGGTGAGCAAAAGCTGG - Intergenic
1052743387 9:32415730-32415752 TGTTCGAGAAGAGCAAAAGAGGG - Intronic
1053853325 9:42312301-42312323 TCTTTAAAAAGAGGAAAAACAGG - Intergenic
1054758155 9:68979847-68979869 TGTCTAAAAATAGCAAAAGTGGG + Intronic
1055776364 9:79770640-79770662 TTTTTATTAAGAGCAAAAGGCGG + Intergenic
1057087543 9:92225429-92225451 AGTTAAAGAACAGCAAAAGAGGG + Intronic
1058019316 9:100070053-100070075 AGTTTTAGAAGAGCAAAATGTGG - Intronic
1059204504 9:112451560-112451582 ACTTTAAAAAGAGCAAGAGCTGG - Intronic
1062295937 9:135826549-135826571 TGTTTGAGAGGAGCTAAAACCGG - Intronic
1203572600 Un_KI270744v1:145823-145845 TTTTAAAGAAAAGCAACAGCTGG + Intergenic
1186073004 X:5843270-5843292 TTTTTATGAAGACAAAAAGCTGG + Intronic
1187676700 X:21723400-21723422 AGTTAAAGATGAGAAAAAGCTGG + Intronic
1191072699 X:56419226-56419248 TGTTCAATAAGTTCAAAAGCTGG - Intergenic
1192435787 X:71142909-71142931 TGTTGAAGAAGAGGAAGAGAGGG - Intergenic
1192584486 X:72308456-72308478 TTTGTTAGAAGAGCAAATGCAGG - Intergenic
1193561678 X:83025097-83025119 AGTATAAGAAGAGAAAAAGAAGG + Intergenic
1193574296 X:83180530-83180552 TGTGTAAGAAGAGTAAAATGTGG - Intergenic
1194649184 X:96495485-96495507 TATTTAGGATGAGCAAAATCAGG + Intergenic
1194661869 X:96636828-96636850 TGTTTAAGAAGAGGAACAGCAGG + Intergenic
1195362417 X:104096117-104096139 TATTTAAGCAGAGGAAAATCAGG + Intergenic
1195790215 X:108576326-108576348 TGTTTAAGAAGAGCAAAAGCAGG + Intronic
1197272669 X:124442628-124442650 AGTTTAAGAAGGGGAAAAGAAGG + Intronic
1197776645 X:130122443-130122465 TGTATGATAAGAGCCAAAGCTGG + Intergenic
1198703670 X:139423520-139423542 TTTTTAAAAAAAGCAAAAGAGGG - Intergenic
1201429398 Y:13889663-13889685 AGTACAAGAAGAGCAGAAGCTGG - Intergenic
1201720082 Y:17087032-17087054 TTTTTAATAAGAGAAAAGGCAGG - Intergenic