ID: 1195791397

View in Genome Browser
Species Human (GRCh38)
Location X:108591605-108591627
Sequence CCTTGGAGTCCTTTATCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195791397_1195791401 -5 Left 1195791397 X:108591605-108591627 CCAGGTGATAAAGGACTCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1195791401 X:108591623-108591645 CAAGGAGAACAAGGAGTGAAAGG 0: 1
1: 0
2: 2
3: 56
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195791397 Original CRISPR CCTTGGAGTCCTTTATCACC TGG (reversed) Exonic
900434623 1:2623477-2623499 CCTTGGAGGGCCTTATCACTCGG - Intronic
901344470 1:8527659-8527681 CATTGGAATCCATTATCACAGGG - Intronic
901499278 1:9641599-9641621 CCCTGGAGTCCTGGAGCACCTGG + Intergenic
901702638 1:11053815-11053837 CCTTGGAGCCCTAACTCACCCGG - Intergenic
906557125 1:46722701-46722723 TCTTGGAGTCCTCTCTTACCTGG + Intergenic
907284789 1:53372680-53372702 CCTTCCAGGCCTTTGTCACCTGG + Intergenic
907458311 1:54590207-54590229 CTCTAGAGTCCTTCATCACCTGG + Intronic
913347330 1:117821315-117821337 CCTGGAAGTCCTTCATCCCCAGG + Intergenic
920435865 1:205946720-205946742 CCTGGGAGTCCTTCCCCACCTGG - Intergenic
920955925 1:210620081-210620103 CCCTGTGGTCCTTCATCACCGGG - Intronic
1065118346 10:22504005-22504027 CCCGGGTGTCATTTATCACCAGG + Intergenic
1065983384 10:30925757-30925779 CCTTGGAGTCCTCTAGCAGCTGG - Intronic
1067162211 10:43836675-43836697 CCTTGGGGGCCTATACCACCAGG - Intergenic
1068921854 10:62493222-62493244 CCTTGAAGTCCTGTCTTACCTGG - Intronic
1070463864 10:76698635-76698657 CTTTTGAGTTCTTTACCACCTGG + Intergenic
1070799230 10:79235316-79235338 GCCAGGAGTCCTTCATCACCCGG - Intronic
1074418834 10:113291369-113291391 CTTTGAAGGCCTTTAACACCAGG - Intergenic
1074589865 10:114802446-114802468 CCTGGGAGTACTCTATCACCAGG - Intergenic
1075971914 10:126662292-126662314 CATTCGGGTCCTTTACCACCTGG - Intronic
1079517827 11:21289532-21289554 CCTTGGGTGCCTGTATCACCAGG + Intronic
1081198750 11:40192473-40192495 CCTTGGGTGCCTTTACCACCAGG + Intronic
1082787235 11:57323980-57324002 CCTTGGTGGCCTTGGTCACCTGG - Intronic
1085826832 11:79857057-79857079 ACTTGGAGTCCACTGTCACCAGG - Intergenic
1087203083 11:95365693-95365715 CCTTGGATTCATTTCCCACCTGG + Intergenic
1088037674 11:105336816-105336838 CCTTGGAGTCTTTTAGAAGCAGG - Intergenic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1094005876 12:25750593-25750615 CCTAGGAGTTCATTACCACCTGG - Intergenic
1094034535 12:26053629-26053651 CTTTGGAAGCCTTTATCCCCAGG + Intronic
1098132048 12:67361290-67361312 CCTTGGGGTTATTTATCACTGGG + Intergenic
1098582008 12:72111303-72111325 GCTTACAGTCCTTTATCACCAGG - Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1106482118 13:30144424-30144446 CTTTGGAGTCCCTAATTACCGGG + Intergenic
1107629736 13:42331176-42331198 CCTTGGTGACCTCTATCATCTGG - Intergenic
1108373880 13:49795632-49795654 CCTTGGAGACCTTAATCTCTGGG + Intergenic
1113918623 13:113890428-113890450 CCTTGGCCTCCTTTAGCACTGGG + Intergenic
1122476156 14:102010829-102010851 CCCTGGAGTCCAGTATCACAGGG + Exonic
1123430604 15:20212377-20212399 CCTTGGAGGAGTTTATAACCTGG - Intergenic
1128152126 15:65369726-65369748 CCCTGGAGGCCTCTATCACCTGG - Intronic
1130888633 15:88114452-88114474 GCTTGGAGTCTTTTCTCACTTGG + Intronic
1131181298 15:90241702-90241724 ACTTGGAGTCCTTGATAAGCAGG + Exonic
1141335150 16:83147599-83147621 CCTTGAAGTCCTTTTTCTTCGGG + Intronic
1142365254 16:89646696-89646718 TCATGGAGTCCTCCATCACCTGG + Exonic
1144167391 17:12625723-12625745 CCTGCGAGTCCTTTGTCCCCTGG + Intergenic
1147832924 17:43309794-43309816 CCTTGGTGTCATCCATCACCTGG + Intergenic
1151523495 17:74647853-74647875 CGGTGGTGTCCTTTATCTCCAGG - Intergenic
1151707173 17:75775316-75775338 CCTTGGATACTTTTAGCACCTGG - Intergenic
1153782967 18:8510272-8510294 CTCTGGAGTCCTTCATCATCTGG + Intergenic
1154016903 18:10626935-10626957 CCTAGGAGTACTTTGTCTCCAGG + Intergenic
1155571678 18:27201570-27201592 CTTTGGAGTCCTGTATTATCTGG - Intergenic
1159878366 18:73834555-73834577 CCCTGGAGACCTTTATCACCTGG - Intergenic
1161281174 19:3446512-3446534 CCTTGGAGTTCCTTACCTCCAGG - Intronic
1163273247 19:16266815-16266837 CCTTGAAGGCCCTTATCAGCAGG - Intergenic
1166844356 19:45717704-45717726 CCTTGGTGTTCTTAATCCCCGGG - Intronic
1167035545 19:46993203-46993225 CCTTGGAGTTGTTTACCACCTGG + Intronic
1167452642 19:49581239-49581261 CCTTTAAGTCCTTTATCCCAAGG + Intronic
1167749949 19:51373378-51373400 GCCTGGTGGCCTTTATCACCAGG + Intergenic
927096365 2:19750410-19750432 CCTTGGGATCCTGTCTCACCAGG - Intergenic
927431491 2:23030073-23030095 CCTTGGATTCCTTTTGCATCTGG - Intergenic
927786882 2:25980789-25980811 CCTTGGGGTCCTCGTTCACCCGG + Exonic
928033281 2:27799242-27799264 CCTTGGAGACTTTCATCACTTGG - Intronic
928909353 2:36403084-36403106 CTTTGCAGTGATTTATCACCAGG + Intronic
929434572 2:41918703-41918725 CCTGGGAGTCTTCTATCAGCAGG - Intergenic
931651610 2:64473568-64473590 CCTTGGTGTCCTCTACCACCTGG - Intergenic
935254131 2:101293609-101293631 CCTTGGAGTCCTTTAGTTACAGG - Intronic
937868295 2:126770118-126770140 CCTTGGGTGCCTTTATCTCCTGG + Intergenic
940434394 2:153633585-153633607 CATAGGAGACATTTATCACCTGG + Intergenic
940515903 2:154683822-154683844 CCTTGGGGTCCTTTATGAAAAGG - Intergenic
941514982 2:166462388-166462410 CCCTGAAGTACTTTATCACCAGG - Exonic
945682286 2:212928484-212928506 CTATGGAGTCCATTATCACTGGG + Intergenic
1168839789 20:902738-902760 CCTTGGGGTCCTTTGGCATCCGG - Intronic
1174065606 20:47862754-47862776 CCTTGGAGACCTTGATCAGAGGG - Intergenic
1174779235 20:53372922-53372944 TCTTGAAGTCCTTTATTCCCTGG - Intronic
1179230495 21:39499801-39499823 CCTGGGTTTCCTTTATGACCAGG + Exonic
1182048149 22:27292549-27292571 CCATGGAGTCCTGCATCAACGGG + Intergenic
1183183103 22:36274786-36274808 CCTTGGATTCCCTTCTCACTGGG - Intergenic
954855959 3:53643602-53643624 CCTTGGAGACTTTGCTCACCAGG + Intronic
955045099 3:55352234-55352256 CCGTGGATTCCTTGGTCACCTGG + Intergenic
956019978 3:64923881-64923903 CCATGGTGTCCTTTTTCACAAGG - Intergenic
957624098 3:82636816-82636838 CCTAGGATTCCTTTATGCCCAGG - Intergenic
958140323 3:89554396-89554418 TCTTTGAGTCCTTATTCACCTGG + Intergenic
959041113 3:101424184-101424206 CCCTGGGGTCCTGTATCACTGGG + Intronic
959881253 3:111447234-111447256 CCTTGGGTTCCTATACCACCAGG - Intronic
960048493 3:113219375-113219397 GCTTGGAGTGCTTTAACACAAGG - Intronic
963102212 3:141618607-141618629 CCTTGGAGTCATTTACAATCTGG - Intergenic
964277568 3:155024179-155024201 ACTGGGATTCCTTTTTCACCAGG + Intronic
967724277 3:192846978-192847000 CCCTGGACTCCTTTATCTACAGG + Intronic
967838954 3:193988701-193988723 CCTTGGAGTTATATATTACCTGG - Intergenic
971017921 4:22507627-22507649 GCTTGGAGTCCTCCAGCACCAGG - Intronic
971922464 4:32959719-32959741 CCTTGAACTCCTTTATTGCCAGG - Intergenic
973148806 4:46862105-46862127 CCTTGGAGTCCTTGAGCTGCTGG - Intronic
974611821 4:64227934-64227956 TCTTGGTGTCCTTTATGAACTGG - Intergenic
976513426 4:85936440-85936462 CTTTGGAGTCCTTTATACCTGGG + Intronic
977432273 4:96944995-96945017 CCTTGAATTGCTATATCACCAGG - Intergenic
977960068 4:103075699-103075721 CCTTGGAGTCCTTAGTTTCCAGG - Intronic
982278266 4:153658825-153658847 CCTTGGAGTCCTTGCCCTCCCGG - Intergenic
982879913 4:160700865-160700887 CCTTTCACTCCTTCATCACCAGG + Intergenic
983369120 4:166836729-166836751 CCTTTGAGTACTTTCTGACCAGG + Intronic
985800613 5:2003443-2003465 ACTTGGGTTCCTTTATCATCAGG - Intergenic
987273895 5:16341868-16341890 CCTTGGAGTCTTTTATAAAGAGG - Intergenic
990164382 5:52978054-52978076 CCTTGGGTTCCTATACCACCAGG - Intergenic
994379174 5:99050413-99050435 CATTGAAGTACTTTTTCACCAGG - Intergenic
995471184 5:112503612-112503634 CCTTGGATGCCTACATCACCAGG + Intergenic
1000255389 5:159533422-159533444 CCTTGAACTTCTTTATCTCCAGG - Intergenic
1000984402 5:167851020-167851042 CCTTGGAGAAATTTATCTCCTGG - Intronic
1002369611 5:178741201-178741223 CCCTGGATTGCTTTATCTCCAGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003268818 6:4589657-4589679 GTTTGGAATCCTTTCTCACCTGG - Intergenic
1006117496 6:31782866-31782888 CCGTGGAGTCCCTCATGACCTGG - Intronic
1006636918 6:35467787-35467809 CCTTGTATTCCTGTAGCACCTGG + Intergenic
1008393035 6:50974928-50974950 CCTTGAGGTGCTTTATTACCAGG - Intergenic
1008551256 6:52633386-52633408 CATTGGTGTCTTTTATCACAGGG - Intergenic
1009933314 6:70202958-70202980 CCTTGGTGTCCATTCCCACCTGG + Intronic
1015739931 6:136442878-136442900 CTTTGGATTCCTCTAGCACCTGG + Intronic
1020505728 7:8985379-8985401 CCTTGGAGTCCTTAAGTAACAGG + Intergenic
1022728932 7:33004957-33004979 TCTTGGAGTCATTTAGCACAAGG + Intronic
1023937605 7:44750459-44750481 CCTTTGACTCCATTGTCACCTGG + Intronic
1029412018 7:100419348-100419370 CCTTTGACTCCTTTATTCCCAGG - Intronic
1030209944 7:106986347-106986369 CCTTGGACTCCTTTCTTTCCAGG - Intergenic
1031954057 7:127924074-127924096 CCCTGGAGTCCTTTACCCTCAGG + Intronic
1034314441 7:150117102-150117124 CCTTGGGTGCCTATATCACCAGG + Intergenic
1034487211 7:151373568-151373590 CCCTGGAGTCCTTGCTCCCCAGG + Intronic
1034792454 7:153983667-153983689 CCTTGGGTGCCTATATCACCAGG - Intronic
1034959737 7:155357845-155357867 CCTTGGAGTCCTTTCCCCCACGG - Exonic
1039864215 8:41487331-41487353 CCTTTGATTCCTCTTTCACCTGG + Intergenic
1044446116 8:92278384-92278406 ACTTGCATTTCTTTATCACCAGG + Intergenic
1046299553 8:112269331-112269353 CCTTAGATTCATTTATCACCTGG + Intronic
1046812046 8:118543873-118543895 CCTTTCATTCCTTTATCTCCAGG + Intronic
1046981906 8:120345488-120345510 CCTGGGGGTCCTTGTTCACCAGG - Exonic
1047192503 8:122690884-122690906 CCCTGGAGGCCTTTGTGACCAGG - Intergenic
1047321744 8:123792365-123792387 CCTAGGAGTCCTTAATCCCTTGG + Intronic
1048200895 8:132373105-132373127 CCATGCAGGCCTTTTTCACCAGG + Intronic
1048490104 8:134884482-134884504 CCTTTGAGTCCTCTTGCACCTGG - Intergenic
1048846077 8:138604741-138604763 CCTGGGACTCCTTTCTCTCCTGG + Exonic
1050061079 9:1710462-1710484 CATGGGAGTCATGTATCACCTGG - Intergenic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1057140694 9:92725209-92725231 CCTCAGGGTCCTTCATCACCTGG + Intronic
1190304970 X:49076709-49076731 CCTTGGAGTCCTTGCCCTCCCGG + Exonic
1190598043 X:52066104-52066126 TCTTGTAGTCCTTAATCATCAGG + Exonic
1190610781 X:52187969-52187991 TCTTGTAGTCCTTAATCATCAGG - Exonic
1192812116 X:74556235-74556257 CCTGGGAGGCCTTTTTCAACTGG + Intergenic
1195791397 X:108591605-108591627 CCTTGGAGTCCTTTATCACCTGG - Exonic
1198557386 X:137809504-137809526 CTTGGGGGTCCTTTAGCACCAGG + Intergenic
1198639108 X:138736539-138736561 ACATTGAGTCCATTATCACCTGG - Intronic