ID: 1195792990

View in Genome Browser
Species Human (GRCh38)
Location X:108609777-108609799
Sequence CAAAGTAATCCAATAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195792990 Original CRISPR CAAAGTAATCCAATAGAGAG GGG (reversed) Intronic
902163343 1:14550305-14550327 CACAGTAATGCAAAAGAGAATGG + Intergenic
902572734 1:17357044-17357066 CAAAGAGATCCCATCGAGAGAGG - Intronic
904020629 1:27461960-27461982 AAAAGTAATAAAATAGTGAGTGG - Intronic
905160611 1:36030029-36030051 AAAAGAAAACCAATAGAGTGTGG + Intronic
906832050 1:49043371-49043393 TAAGATAATCCCATAGAGAGTGG - Intronic
907370020 1:53995368-53995390 AAAAGCAATTAAATAGAGAGAGG + Intergenic
907538441 1:55188151-55188173 AAAAGTAATCCAATGGAGGAAGG + Intronic
907568110 1:55456261-55456283 CAAGGTAATCCAATGGGGAAAGG + Intergenic
909801402 1:79813271-79813293 GAAAGTCAGCAAATAGAGAGAGG - Intergenic
909814818 1:79978524-79978546 CAAGGAAATGTAATAGAGAGAGG - Intergenic
910492274 1:87785713-87785735 AAAACTAATCTAATAGAAAGGGG + Intergenic
912309613 1:108607184-108607206 CAAAGTCATCACATAGAGAATGG - Intronic
912427426 1:109607016-109607038 CAAAATAATCCAGTAGGGAATGG + Exonic
913146693 1:115998330-115998352 CAAAGTACTCCAAAAAATAGAGG - Intronic
913181032 1:116321705-116321727 AAAAGAAAGCCAATTGAGAGTGG + Intergenic
916719746 1:167475316-167475338 CAAAATAATCCAGGGGAGAGGGG - Intronic
916844401 1:168634297-168634319 CAAAGCAATTCAATGGAGAAAGG + Intergenic
916880534 1:169016043-169016065 CAGAGAAATCTAATAGAGTGGGG - Intergenic
917932657 1:179834010-179834032 TAAGATAATCCAGTAGAGAGGGG + Intergenic
918797066 1:188914047-188914069 CAGAGTAATGAAATATAGAGTGG - Intergenic
918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG + Intergenic
921300867 1:213750370-213750392 GAAAGTAAGTCAACAGAGAGGGG - Intergenic
921718528 1:218444768-218444790 CATAGTAAACTCATAGAGAGAGG + Intergenic
922024788 1:221740375-221740397 CAAAGGACCCCAATAGAGAATGG - Intronic
922318622 1:224464582-224464604 CAAGGCAATCCAATGGAGAAAGG - Intronic
922487197 1:225983185-225983207 CAAAGTAAATTAATAGAAAGAGG + Exonic
922599931 1:226842882-226842904 CAAGATAATTCAATAGGGAGAGG - Intergenic
922773076 1:228199747-228199769 AAAAGAAATCCAAGAGAGGGAGG - Intergenic
923600636 1:235399727-235399749 CAAATTAATCAAATACAAAGAGG + Intronic
924176552 1:241397121-241397143 CCAATTAAACCAATTGAGAGGGG - Intergenic
924184066 1:241468337-241468359 CAAAGAAAACTAAAAGAGAGAGG - Intergenic
924299259 1:242620592-242620614 CAAAGTAATTCAATTGGGAATGG - Intergenic
1067708599 10:48629476-48629498 CAAGGTAATTCAATGGAGAAAGG - Intronic
1067839340 10:49663611-49663633 GAATGCAATCCATTAGAGAGAGG + Intronic
1068506194 10:57902317-57902339 AAAAGTAATTCAATGGAGAAAGG + Intergenic
1068961831 10:62874588-62874610 CAAAGCCATCCAATAGGGAGAGG - Intronic
1070243757 10:74710257-74710279 CAAAGTGATCCAATGGGGAAAGG + Intergenic
1072297976 10:94030135-94030157 CAATGCAATCCAGAAGAGAGTGG - Intronic
1072594845 10:96862004-96862026 CAAAGTAATCAAATGCAAAGAGG - Intronic
1072942644 10:99780640-99780662 CTAAGTAATCAAAAAAAGAGAGG - Intergenic
1073187744 10:101626845-101626867 CAAGGTAAATCAATAGAGAGGGG + Intronic
1073978518 10:109127438-109127460 CAATCATATCCAATAGAGAGTGG - Intergenic
1074166600 10:110883682-110883704 CAAAATAATCCAAAACAGGGTGG - Intronic
1074272836 10:111971935-111971957 GAAAGTAAAACAATGGAGAGCGG + Intergenic
1074575727 10:114667394-114667416 CAAAATAATATAATAGGGAGAGG - Intronic
1075361153 10:121835769-121835791 CAAAATAATTCAAGAGAGGGTGG + Intronic
1076376979 10:129996542-129996564 CAAAGTATTCCAAAAGACAGAGG + Intergenic
1077293072 11:1808800-1808822 CAAAGTAAATCAATTGAGAGCGG + Intergenic
1080292116 11:30682713-30682735 CCAAATAACCAAATAGAGAGTGG + Intergenic
1081128430 11:39347531-39347553 CAAAGTAACATAATATAGAGCGG + Intergenic
1082225325 11:49699200-49699222 CAAAGTGTTCCAATATACAGAGG - Intergenic
1085144708 11:74183426-74183448 CCAAGTGATTCAAAAGAGAGTGG + Intronic
1085605582 11:77895070-77895092 CCAAGTAATTCAAGATAGAGAGG - Intronic
1085876111 11:80407325-80407347 CAACGAAATCCAAGAGAAAGTGG + Intergenic
1086623771 11:88920513-88920535 CAAAGTGTTCCAATATATAGAGG + Intronic
1086770515 11:90758919-90758941 AAAAGTAATTCAATGGAGAAAGG + Intergenic
1086999710 11:93403351-93403373 CCAAGTACTCTAAAAGAGAGTGG - Intronic
1087910994 11:103753244-103753266 CAGAGTAAAACAATAGGGAGTGG + Intergenic
1088039799 11:105365790-105365812 AAATGTAATCCAATATACAGGGG - Intergenic
1088569560 11:111209281-111209303 CAGAGTAATCCAATTGCTAGAGG + Intergenic
1089552468 11:119291033-119291055 CAATGGAAGCCAAAAGAGAGTGG - Intronic
1091711632 12:2744829-2744851 AAAAGTAACTCAATAGAGAAAGG + Intergenic
1091895526 12:4100565-4100587 AAAAGCAATCCAATGGAGAAAGG + Intergenic
1092662091 12:10749347-10749369 GAAAGTCAGCCAATAGAAAGAGG + Intergenic
1092955806 12:13548671-13548693 CATAGTAAGCTAAGAGAGAGGGG - Exonic
1093684507 12:22040968-22040990 AAAAGTAATCCAATAGAGAGGGG - Intergenic
1093871105 12:24292056-24292078 CAAAGGAATCCAAGAAAGAAAGG + Intergenic
1094144221 12:27211969-27211991 CCAAGCAATCCAACAAAGAGTGG - Intergenic
1094328252 12:29263907-29263929 CAAAGTATTCCAAAAAATAGAGG + Intronic
1094361038 12:29631493-29631515 CAAAGTAATTCAATGGAGAAAGG - Intronic
1097989213 12:65817613-65817635 TGAAGTAATCCAAAAGAGAAGGG + Intergenic
1098263398 12:68694599-68694621 CAAAGAAATAGAATAGACAGAGG + Intronic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099549002 12:84019611-84019633 CAAACTAATCCAAAAGCTAGTGG + Intergenic
1099641145 12:85286635-85286657 CAAAATAATTTAATAGAAAGAGG - Intronic
1100065323 12:90636949-90636971 TAAAGTAATACAATAGAGGAAGG + Intergenic
1100103500 12:91139725-91139747 CAAAGTTATCTACTAGAGGGAGG + Intergenic
1100327874 12:93557042-93557064 CAAGGTAATTCAATGGAGAAAGG - Intergenic
1100470550 12:94888994-94889016 CAAAGCCATCCAATAGAATGTGG - Intergenic
1101071851 12:101083703-101083725 CCAAGTATTCCAAGAAAGAGCGG + Exonic
1101203248 12:102459006-102459028 CAGAGCAAGGCAATAGAGAGTGG + Intronic
1104322800 12:127767748-127767770 CAAATGAATCCAATGGAGTGTGG + Intergenic
1107104714 13:36630730-36630752 TAAAGTAAACCAATAGGGAGGGG + Intergenic
1108085804 13:46791293-46791315 CAAAATAATCCAACAGAATGAGG + Intronic
1108100611 13:46950253-46950275 CAAAGTACTCCATTAGAAACTGG - Intergenic
1109176461 13:59163319-59163341 CAAAGTAATTCAATGGAAAAAGG - Intergenic
1110928492 13:81185768-81185790 CAAAGTAATCCAATGGGGATAGG + Intergenic
1111309473 13:86463730-86463752 CAAAACAATTCAATAGAGAAAGG + Intergenic
1111819099 13:93192217-93192239 CAAATTAATAGAATAGAAAGTGG + Intergenic
1113083384 13:106540623-106540645 CAAAGTAATACAAATCAGAGTGG - Intergenic
1116045981 14:39742905-39742927 CAAAGGAAACCAAAAAAGAGAGG - Intergenic
1117103030 14:52369913-52369935 AACAGTAATACAAAAGAGAGTGG + Intergenic
1117201192 14:53391775-53391797 CAAAGTAATCCAGAGGAGTGTGG - Intergenic
1117540949 14:56746053-56746075 CAAAGTAAGCAATTAGAGAAAGG - Intergenic
1119579206 14:75760658-75760680 CAAAGTAATCCAATGGTGAAAGG + Intronic
1119796568 14:77403429-77403451 CAAAATAATCCAATAGATGGGGG - Intronic
1120346691 14:83299386-83299408 CAAAGGAATGAAAGAGAGAGGGG - Intergenic
1122435929 14:101698425-101698447 CAAAGTATTCCAAAAAACAGAGG + Intergenic
1123956035 15:25335713-25335735 CAAAGAAATCCCAGAGACAGAGG + Intronic
1124989902 15:34661978-34662000 TAAAGTAATCCAATGGAGAAAGG + Intergenic
1125911000 15:43439032-43439054 CAAAATAATTCAGTAGGGAGGGG + Intronic
1126613407 15:50552128-50552150 CAAAGTAATCCACTAGGGCCAGG - Intergenic
1127113522 15:55700186-55700208 AAAAGGAATTCAATAGAGAAGGG + Intronic
1127220993 15:56880990-56881012 CAAGGTAATTCAATGGTGAGAGG + Intronic
1128227164 15:66010053-66010075 CAGCATAATCCAATAGAGAATGG + Intronic
1128851385 15:70960665-70960687 AAAAGCAATTCAATAGAGAAAGG + Intronic
1129124729 15:73429227-73429249 CAAAGAAACCCAATAGAAAATGG - Intergenic
1130936428 15:88474674-88474696 CAAAATAATCCATTGGTGAGGGG + Intronic
1130962343 15:88669617-88669639 CAAAGTATTCCAAAAAATAGAGG + Intergenic
1131141840 15:89982842-89982864 CAAAGGAACACAATAGAGTGAGG - Intergenic
1131203593 15:90422233-90422255 CAAGGTCATCCAATAGCTAGTGG - Intronic
1133621980 16:7535190-7535212 CAAAGTAATCCAATACATTACGG - Intronic
1135297313 16:21293123-21293145 CAAAGTAATTCAAATGAGAAAGG + Intronic
1138143497 16:54588238-54588260 CACAGTGATCCAAGAGGGAGAGG - Intergenic
1138247233 16:55477024-55477046 CAAGGCAATACAATAGAGAGTGG + Intronic
1140906765 16:79415759-79415781 CAAAGGCACCCAATAGAAAGGGG - Intergenic
1143795049 17:9329708-9329730 CAAAGTAATGCCAAAGTGAGCGG + Intronic
1143968654 17:10775930-10775952 CAAAGTATTCCAAAACTGAGTGG - Intergenic
1144704613 17:17359319-17359341 AAAAGTAATCCAAGAAACAGAGG + Intergenic
1145753829 17:27375335-27375357 CAAAGCAATTCAATGGAGAAGGG - Intergenic
1147545773 17:41400473-41400495 CAAAATAAGCCAATAGACTGAGG + Intergenic
1148658624 17:49309006-49309028 CAAAGAAATACAAGAGAAAGAGG + Intronic
1149643758 17:58223205-58223227 CAAGGTAATTCAATGGAGAAAGG + Intronic
1150093607 17:62352410-62352432 CAAAATAATGAACTAGAGAGTGG + Intergenic
1150165604 17:62939194-62939216 AAAAGCAATTCAATAGAGAAAGG - Intergenic
1153191604 18:2546901-2546923 CAAAGTAACCCATTGTAGAGGGG - Intronic
1153606078 18:6834663-6834685 CACAGCAATCCACAAGAGAGAGG + Intronic
1155077824 18:22377223-22377245 GAAAGCAATCCAATGGAGAAAGG + Intergenic
1155805157 18:30160919-30160941 CAGAGTAAGGCAGTAGAGAGTGG - Intergenic
1156271186 18:35533712-35533734 AAAAGTAATTCAATTAAGAGAGG + Intergenic
1156400846 18:36738695-36738717 CAAGGCAATTCAATAGAGAGAGG - Intronic
1156951912 18:42910733-42910755 CAAATTAATCCACTGGAAAGGGG - Intronic
1158751113 18:60262300-60262322 CAAAGAAATGGATTAGAGAGAGG + Intergenic
1159091705 18:63856574-63856596 CAAAGTATTCCAAAAAATAGAGG - Intergenic
1159699006 18:71600573-71600595 AAAAGGAATTCAATAGAGAAAGG - Intergenic
1159746440 18:72242333-72242355 CAAACTAATACAATAAAGAAAGG - Intergenic
1161743212 19:6037887-6037909 TAAAGCAATCCAATGGAGAAAGG + Intronic
1165188308 19:34040574-34040596 CAATGCAAACTAATAGAGAGGGG - Intergenic
926881770 2:17552581-17552603 CAAATTAACCCATTAGAGAGAGG - Intronic
927275040 2:21255321-21255343 CATAGTAGTCCAGGAGAGAGGGG - Intergenic
928234970 2:29531419-29531441 CAATGTAATTCAGTAGAGATTGG - Intronic
928244489 2:29615378-29615400 CAAAGTAAACAATTAGAGAAAGG - Intronic
928609611 2:32978750-32978772 CAAACTATTCCAAAAGATAGAGG - Intronic
929548605 2:42874877-42874899 GAGAATAATCCAATAAAGAGGGG + Intergenic
933313885 2:80692932-80692954 AAAAGTAATCTAAGACAGAGCGG + Intergenic
933575322 2:84060698-84060720 CCAAGTAAAAGAATAGAGAGGGG - Intergenic
933637164 2:84720760-84720782 CAGAGTAAACCAATAAAGATAGG - Intronic
935006718 2:99086030-99086052 CAAAGCAATCCAATGGGGAAAGG + Intronic
936443794 2:112580157-112580179 AGAAGTAATTCAATAGAGAAAGG - Intergenic
937483236 2:122285960-122285982 CAGAGTGATCAAATAGATAGTGG - Intergenic
937641221 2:124213939-124213961 CAAAATTGTCAAATAGAGAGAGG + Intronic
938124544 2:128662527-128662549 CACAGGAGTCCAAGAGAGAGTGG - Intergenic
939273908 2:139974967-139974989 CAAATTATTCCAAAAGATAGAGG + Intergenic
939587522 2:144023253-144023275 CAAAGTGAGCCAATGGAAAGAGG + Intronic
939599318 2:144168484-144168506 CAAAATAATCCGGTAGAGGGGGG + Intronic
940067315 2:149644320-149644342 CAAAGTAATAAAAAAGAAAGTGG - Intergenic
940656473 2:156493160-156493182 CAAAGGAAGCTAAGAGAGAGTGG + Intronic
941193036 2:162410760-162410782 CAAAGAACTCCAATAAAAAGTGG + Intronic
941692994 2:168520897-168520919 CAAAGTATACCAATTGAGCGTGG - Intronic
943120798 2:183733076-183733098 AAAGGTAATTCAATAGAGAAAGG + Intergenic
943196811 2:184763594-184763616 AAAAGTAAAGCAATAGAGAGTGG - Intronic
943485160 2:188470101-188470123 CAAAGTATTCCAAAAAATAGAGG - Intronic
943930317 2:193843203-193843225 AAAAAAAATCCAATACAGAGGGG + Intergenic
945339675 2:208638191-208638213 CAAAGTCAGGAAATAGAGAGAGG - Intronic
945666648 2:212752046-212752068 CAAAGTCATCCATGAAAGAGGGG - Intergenic
947415858 2:229894933-229894955 CAAAGTAAACCTTTAGAGAAAGG + Intronic
948229699 2:236341055-236341077 CAAAGTAATACAGTTGTGAGGGG - Intronic
1169751361 20:8998012-8998034 CCAAGCAATCCTAAAGAGAGGGG - Intergenic
1169854939 20:10092138-10092160 GAGTGTAATCCAATAGAAAGGGG - Intergenic
1171006186 20:21467690-21467712 CATAGGACTCCAATAGAGAGAGG + Intergenic
1171098823 20:22362033-22362055 TAAAGTCATCCAAAACAGAGAGG + Intergenic
1171291186 20:23984000-23984022 AAAATTAAACCAATAGAGATGGG - Intergenic
1172088446 20:32408328-32408350 CAAAGCTATTCAATAAAGAGGGG - Intronic
1172818898 20:37714167-37714189 CAAGAAATTCCAATAGAGAGTGG - Intronic
1172824995 20:37774281-37774303 TAAAGAAATCCCAGAGAGAGAGG + Intronic
1173482511 20:43414593-43414615 CAAAGCAATCCAATAAAGAAAGG + Intergenic
1173496857 20:43525714-43525736 CAATGTAATCCACTGGAAAGAGG - Intronic
1174615655 20:51833387-51833409 CAAGGTAATCCTTAAGAGAGAGG + Intergenic
1175080748 20:56418337-56418359 AAGAGTAAACCAAGAGAGAGAGG + Intronic
1177011697 21:15738334-15738356 CAAATTAATCAAAAAGACAGAGG - Intronic
1177795514 21:25774698-25774720 CAAGGTAATTCAATAGGGAAAGG + Intergenic
1178897781 21:36574283-36574305 CAAAGTAATTCAATGGAGAAAGG + Intronic
1184316412 22:43695707-43695729 CAAAGTAATTCATTGGAGAAGGG + Intronic
949301189 3:2585852-2585874 AAAAGTAACCCAATACAGAGGGG + Intronic
949913143 3:8931878-8931900 CAAAGTAATTCAATGGGGAAAGG + Intronic
950727908 3:14930105-14930127 TGAAGCAATCCAATAGGGAGAGG - Intronic
950788981 3:15457390-15457412 CAAAATAATACAACAGAGAATGG + Intronic
951095374 3:18623702-18623724 CAAAGTAATGAACTAGAGATTGG + Intergenic
953124590 3:40078476-40078498 GAAAGTCATACAATAGTGAGAGG - Intronic
954286325 3:49622031-49622053 TGAAATGATCCAATAGAGAGGGG + Intronic
955201377 3:56854905-56854927 CAAAGGAATCCAAGATGGAGTGG + Intronic
956217072 3:66859654-66859676 CAAGGTTATCCACTAGAAAGTGG + Intergenic
956304624 3:67810334-67810356 CACAGTAAAATAATAGAGAGGGG + Intergenic
956309166 3:67860129-67860151 CAACGATACCCAATAGAGAGTGG - Intergenic
956543269 3:70368627-70368649 AAAGGCAATTCAATAGAGAGAGG - Intergenic
956814951 3:72899788-72899810 CAAAATACTCCACTAGGGAGGGG + Intronic
957200070 3:77122596-77122618 CATAGTAAACCCATAGAGAATGG + Intronic
957393865 3:79615777-79615799 CAAGGTAATCCAATAAGGAATGG + Intronic
957485863 3:80861953-80861975 CAAAGTATTCCAATAAAAAGAGG + Intergenic
958763551 3:98337922-98337944 CACGGTAATTCAATAGAGAAAGG + Intergenic
959999462 3:112715456-112715478 CTAAATAATACAATAGAGAAAGG + Intergenic
960027115 3:113021915-113021937 CAAAGAAATACAATAAAGCGAGG - Intergenic
960029241 3:113041219-113041241 CAAAGTCATGCACTAGAGTGGGG - Intergenic
960728761 3:120700727-120700749 CAAAATAATCCAGTTGAGAGTGG + Intronic
961399322 3:126624717-126624739 CAAAGCAATTCAATAAAGAAAGG + Intronic
961960287 3:130847524-130847546 CAAAGTAGCACAATAAAGAGTGG - Intergenic
962143151 3:132811744-132811766 CAATGATATCTAATAGAGAGTGG - Intergenic
963448406 3:145444157-145444179 TAAAGTATTCCAAAAAAGAGAGG + Intergenic
964654815 3:159054685-159054707 CAAAGCAATACACTAGGGAGAGG + Intronic
965391152 3:168106004-168106026 AAAAGTAATCCTAAAGAGACAGG + Intergenic
965460809 3:168960345-168960367 CAAAGTAATTCAATGGAGAAAGG - Intergenic
965930918 3:174042469-174042491 CAAAGCAATGCAATAGAGAAAGG - Intronic
965943828 3:174216091-174216113 CACAGTAATGCAATTGAAAGTGG - Intronic
966188887 3:177253283-177253305 TAAAGTAATTCAAAAGAGAAAGG - Intergenic
966700750 3:182847490-182847512 CAGAATGATCCAATAGGGAGAGG - Intronic
968481304 4:834325-834347 CAAAATAAACCAACACAGAGAGG + Intergenic
970287612 4:14535657-14535679 CAAAGAACTGCAATAGGGAGTGG - Intergenic
971002955 4:22342726-22342748 CAGAGTTATCCAATAGTTAGAGG - Intergenic
973781718 4:54294290-54294312 CAAAGTAACCAAATTGAGAAAGG - Intronic
973841606 4:54866898-54866920 CAAAGCAATTCAGTAGAGAAAGG - Intergenic
974103156 4:57439552-57439574 CATAGTAATTCAATAAAGAAAGG + Intergenic
974309050 4:60180581-60180603 TAAAGTAATCCCATAAAGATAGG - Intergenic
975415029 4:74096196-74096218 GAAAGTAAAGCAATAAAGAGTGG + Intergenic
977954960 4:103016291-103016313 GAGAATAATCCAATAGAGGGGGG - Intronic
979387781 4:120089845-120089867 CAAAGACATCTAATAAAGAGTGG - Intergenic
979823205 4:125200150-125200172 AAAAGTAAAGAAATAGAGAGTGG + Intergenic
979843900 4:125483789-125483811 CTAAGTAAACCAAAAGAAAGTGG + Intronic
979974418 4:127178908-127178930 CAAAGAACTACAATATAGAGAGG - Intergenic
980751351 4:137093737-137093759 CAAAGAAATCCACAAGAGTGGGG - Intergenic
980762227 4:137250595-137250617 TGAAGTAATGCAATAGAAAGGGG + Intergenic
981212162 4:142120103-142120125 CAAGGTAATTCAATGGAGAATGG - Intronic
982768447 4:159374110-159374132 CAAAGTCCTGCAATGGAGAGGGG - Intergenic
983256865 4:165409732-165409754 CAAAATAATCTAATAAAGACTGG - Intronic
983389233 4:167107101-167107123 CAAACTATTCCAATAAATAGAGG + Intronic
984250416 4:177326298-177326320 CAAAGAAATTCAATGGAGAAAGG - Intronic
986086574 5:4457956-4457978 CAAAGTAATTCAATGGAGGAAGG + Intergenic
986657266 5:10027095-10027117 CAAAGTATTCCAAAAAATAGAGG - Intergenic
986949391 5:13063541-13063563 CAAAGAAAGCCAAAAGAGAATGG + Intergenic
988129430 5:27083469-27083491 CAAAGCAATCAAATAGAGGTAGG + Intronic
989478137 5:41897784-41897806 TAAAGTAATCCGGGAGAGAGAGG - Intergenic
992185960 5:74244884-74244906 CAAAGTAGCCCAATAAAGAGTGG - Intergenic
992623061 5:78612474-78612496 CAAAATAACCCCATAAAGAGAGG + Intronic
994184924 5:96807082-96807104 CAAAGAAATCCAAAAGCGTGAGG + Intronic
994648292 5:102497290-102497312 AAAAAAGATCCAATAGAGAGTGG + Intronic
994960173 5:106590345-106590367 CAAAATAATATAATAGACAGTGG + Intergenic
996284427 5:121771447-121771469 AAATGTAATCACATAGAGAGAGG + Intergenic
996331839 5:122338207-122338229 CAGAGTAATACAATATATAGGGG - Intronic
999024618 5:148213580-148213602 TAAACTATTCCAATTGAGAGTGG - Intronic
999071378 5:148747322-148747344 CCCAGTAAGACAATAGAGAGTGG + Intergenic
999087659 5:148907374-148907396 CAGAGTAATGTGATAGAGAGTGG + Intergenic
1000165994 5:158649179-158649201 CAGAATAATCCAGTAGAGAGGGG - Intergenic
1000365927 5:160491281-160491303 CAAAGTATTGAAATAGAGATTGG - Intergenic
1000815091 5:165911315-165911337 CAAAGTAGTGTAATGGAGAGTGG + Intergenic
1002619572 5:180478172-180478194 GAAAGTAATTCAATGGAGAAAGG - Intergenic
1003034578 6:2631801-2631823 CAAGTTAATGCAAGAGAGAGAGG + Intronic
1003249044 6:4408835-4408857 CAAACTAATCCAAAAGCTAGCGG + Intergenic
1003399157 6:5777402-5777424 CAAAGCAGTCCTATAGAGAAAGG + Intergenic
1003794978 6:9590972-9590994 CAATGAAATGCAATAGATAGGGG + Intergenic
1004243928 6:13954139-13954161 CAAAATAATCCAATGGGGAGGGG - Intronic
1005093627 6:22086230-22086252 CAAAGCAGCCCAATAGAGAGAGG + Intergenic
1005094855 6:22103726-22103748 CAAAGTACTTCAATAGATAAAGG - Intergenic
1005504931 6:26461260-26461282 CTAAGCAATCCAATTCAGAGTGG - Intronic
1006235419 6:32626608-32626630 CAGAGTGATACCATAGAGAGAGG - Intergenic
1010857808 6:80863664-80863686 CTATGTAATCAAAAAGAGAGTGG + Intergenic
1014036300 6:116770137-116770159 CAAGGTAATGAAATAGAGGGTGG - Intergenic
1014536291 6:122616929-122616951 CAAAGTCATTTAATAGAAAGTGG + Intronic
1014620215 6:123658437-123658459 TAAAGAAATCCAGGAGAGAGAGG + Intergenic
1014897637 6:126922723-126922745 CAAAGTAATGAAAAAGAGTGGGG - Intergenic
1015578336 6:134696983-134697005 CAAACTAATCCAAAAAATAGAGG - Intergenic
1016340177 6:143053733-143053755 CAGACTAATCCAAGAGAGAAAGG - Intergenic
1017203789 6:151783472-151783494 CATAGTAGTCTAATACAGAGTGG + Intronic
1017675015 6:156804360-156804382 CAATGTAATCCAAAATTGAGGGG - Intronic
1017700514 6:157064986-157065008 CAAACTACTCCAGTAGAGAATGG - Intronic
1018316995 6:162566733-162566755 CAAACTATTCCAAAAGACAGAGG + Intronic
1019773554 7:2898703-2898725 CAGAGTAATGCAATAGGGACAGG - Intergenic
1020512823 7:9080661-9080683 CAAAGTAATCCCACAGAGTAAGG - Intergenic
1020617821 7:10481729-10481751 CAAAATAATACAATAGGAAGTGG - Intergenic
1021476854 7:21071638-21071660 CAAAGCAAACCAGTAGAGATTGG + Intergenic
1021532938 7:21669793-21669815 CACATTAATTCAATAGAGAAAGG - Intronic
1022154936 7:27650812-27650834 CAAAGTAATGCGTTACAGAGTGG + Intronic
1022211108 7:28210342-28210364 CTAAGTAATCCTTTAGAGAAAGG - Intergenic
1022810441 7:33862748-33862770 CAGAGCAACCCAAGAGAGAGAGG - Intergenic
1022863952 7:34398025-34398047 GCAAGTGATCCAAGAGAGAGTGG + Intergenic
1024144182 7:46494865-46494887 CAAAGTTATAAAAAAGAGAGTGG + Intergenic
1024440525 7:49411251-49411273 CAAAGTAATCCAAAAGCAAGCGG + Intergenic
1024832538 7:53478231-53478253 AAAAGTAATTGAATTGAGAGGGG - Intergenic
1025847022 7:65209011-65209033 CCAAGTAATTCAAGATAGAGAGG + Intergenic
1025897267 7:65714906-65714928 CCAAGTAATTCAAGATAGAGAGG + Intergenic
1026127092 7:67588511-67588533 CAAACTATTCCAAAACAGAGAGG - Intergenic
1026627079 7:72004264-72004286 CAAAGTAATTCAATGGAGAAAGG + Intronic
1027331299 7:77097576-77097598 TAAAGTAATCCATCAGAGAAAGG + Intergenic
1029784477 7:102773767-102773789 TAAAGTAATCCATCAGAGAAAGG - Intronic
1030013384 7:105193770-105193792 CAAAGAAAACCAATACAAAGAGG + Intronic
1030505689 7:110418887-110418909 CAAAGTAATCTGATACAGGGAGG - Intergenic
1032473584 7:132196788-132196810 CAAATTAAAACAATAGGGAGTGG - Intronic
1032969532 7:137144314-137144336 CCAGGTAAGACAATAGAGAGAGG + Intergenic
1033270338 7:139926191-139926213 CAAACTATTCCAAAAAAGAGAGG - Intronic
1033873479 7:145785858-145785880 GAAAGCAAGCCAATAGAGAGTGG - Intergenic
1034395221 7:150818507-150818529 CAAAGCAATTCAATGGAGAAAGG + Intergenic
1035347293 7:158210904-158210926 CAAACTATTCCAAAAGATAGAGG + Intronic
1035994510 8:4531023-4531045 CAACGTAATCCAACAGAGAGCGG - Intronic
1036093836 8:5701263-5701285 CAAAGAAATCAGATAAAGAGAGG - Intergenic
1037034982 8:14155034-14155056 CAAACTACTCCAAAACAGAGTGG - Intronic
1037512467 8:19597926-19597948 GAAAATAAGGCAATAGAGAGAGG + Intronic
1037537655 8:19840653-19840675 CAAAGTAATTCAATAAGGAAAGG + Intronic
1037551109 8:19972553-19972575 CAATGTAATTCGATGGAGAGAGG - Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1038901651 8:31850812-31850834 ACAAGTAATCACATAGAGAGTGG - Intronic
1039141659 8:34396616-34396638 CAAAGAAATCCAGGAGAAAGTGG + Intergenic
1039515655 8:38130960-38130982 CAAAGAAATCCAGTGGAGAAAGG - Intronic
1041615012 8:59896395-59896417 CAAAGTATTCCAATGGTGAATGG - Intergenic
1042407862 8:68425903-68425925 AAAAGTAATTCAATGGAGAAAGG + Intronic
1043158301 8:76814640-76814662 CACAGTAATGCCAAAGAGAGTGG - Intronic
1043323475 8:79020100-79020122 CAGAGGAATTCAATAGAGAAAGG + Intergenic
1043361942 8:79483148-79483170 CAATGTATTCCAGTAAAGAGTGG + Intergenic
1043471099 8:80563614-80563636 CATGGTAATTCAATAGAGAAAGG - Intergenic
1043510073 8:80941919-80941941 CAAGATAATCGAATAGAGAAAGG - Intergenic
1043945597 8:86248317-86248339 CAAATTATTCCAATAAATAGAGG - Intronic
1043953381 8:86334953-86334975 CAAAGTAATTCAATGGGGAAAGG + Intergenic
1044690549 8:94872990-94873012 CAAAATAATCCAGAGGAGAGAGG - Intronic
1045155314 8:99462410-99462432 CACAGAAAACCAAAAGAGAGTGG - Intronic
1046119210 8:109824028-109824050 CAAAGTATTCCAAAAAATAGAGG - Intergenic
1046335770 8:112784861-112784883 CAAAGTAGTCCAAAAAATAGAGG + Intronic
1048949559 8:139484153-139484175 CAAAGTAATCCTCTAGTAAGTGG + Intergenic
1050965277 9:11793416-11793438 CAAAGTAAACCAAAAGAAAATGG + Intergenic
1051313103 9:15797897-15797919 CAAGGTAATTCAATAGAAAAAGG - Intronic
1052962789 9:34314764-34314786 CAAAGTCATGGAATAGAGACTGG + Intronic
1053327116 9:37163934-37163956 AAAAATAATTCAATAGAGAAAGG - Intronic
1057140555 9:92724371-92724393 AAAAGGAATGCAACAGAGAGGGG + Intronic
1059580290 9:115538982-115539004 CAAAGTAATTCAATGGAGAAAGG + Intergenic
1059944196 9:119391032-119391054 CAAGGTAATCCAAGACAGAAAGG + Intergenic
1060501047 9:124155678-124155700 CAAAGTAATCCAATGGGGAAAGG - Intergenic
1061638616 9:131932716-131932738 CAAAGTATTCCAAAAAACAGAGG + Intronic
1061789243 9:133050255-133050277 CAAACTAATCCTACAGAGAAGGG - Intronic
1062301587 9:135875669-135875691 CAAAGTAATTCAATAAGGAAAGG + Intronic
1185810765 X:3108075-3108097 CAAAATAATTCAGTAGAGATAGG - Intronic
1187592413 X:20732808-20732830 CAAAGTCATCCAAAAGAAATAGG - Intergenic
1188413451 X:29902494-29902516 CACAGTAATCAAATGAAGAGAGG - Intronic
1189113570 X:38320380-38320402 CAAGGAAATTCAATAGAGAAAGG - Intronic
1190226166 X:48547087-48547109 CAAAATAATCCTATAGAGTAGGG + Intronic
1193223065 X:78949992-78950014 AAAAGTTATCCTCTAGAGAGTGG + Intronic
1194679026 X:96829136-96829158 CAGACTAATACAATAGGGAGTGG - Intronic
1195792990 X:108609777-108609799 CAAAGTAATCCAATAGAGAGGGG - Intronic
1195821623 X:108951367-108951389 CAAAGTTATCCATTATAGAATGG + Intergenic
1196509060 X:116483936-116483958 CAAAGTATTCTAAAAGATAGAGG + Intergenic
1196972313 X:121123132-121123154 AAAAGCAATCCAATAGAGGAAGG - Intergenic
1197125176 X:122937232-122937254 GAAGGTAATTCAATAGAGAAAGG + Intergenic
1199147424 X:144385276-144385298 TAAAGCAATTCAATAGGGAGAGG - Intergenic
1199837208 X:151603462-151603484 CAAAGAAATAAAAAAGAGAGGGG - Intronic
1200861962 Y:8002658-8002680 CAAAGTAATTAAATAGAATGTGG + Intergenic