ID: 1195804026

View in Genome Browser
Species Human (GRCh38)
Location X:108742768-108742790
Sequence GTAGTAGCCAGGACAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195804026_1195804035 27 Left 1195804026 X:108742768-108742790 CCACCCATTGTCCTGGCTACTAC No data
Right 1195804035 X:108742818-108742840 TCCACTATCCCGCAACTACAAGG No data
1195804026_1195804030 -8 Left 1195804026 X:108742768-108742790 CCACCCATTGTCCTGGCTACTAC No data
Right 1195804030 X:108742783-108742805 GCTACTACAACACCTCCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195804026 Original CRISPR GTAGTAGCCAGGACAATGGG TGG (reversed) Intergenic
No off target data available for this crispr