ID: 1195805544

View in Genome Browser
Species Human (GRCh38)
Location X:108761489-108761511
Sequence CTAATTGGGAGGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195805544_1195805553 9 Left 1195805544 X:108761489-108761511 CCTGCCTCAGCCCTCCCAATTAG No data
Right 1195805553 X:108761521-108761543 CAGGCATGTGCCACCACACCTGG 0: 3478
1: 17987
2: 56069
3: 123305
4: 203360
1195805544_1195805550 -10 Left 1195805544 X:108761489-108761511 CCTGCCTCAGCCCTCCCAATTAG No data
Right 1195805550 X:108761502-108761524 TCCCAATTAGCTGGGACTACAGG 0: 190
1: 44198
2: 160151
3: 235801
4: 539472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195805544 Original CRISPR CTAATTGGGAGGGCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr