ID: 1195808675

View in Genome Browser
Species Human (GRCh38)
Location X:108804382-108804404
Sequence CCATTGGCACAAAGAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195808666_1195808675 28 Left 1195808666 X:108804331-108804353 CCTATTAACCAAAAAAAGTCCAG 0: 4
1: 100
2: 1621
3: 1983
4: 1807
Right 1195808675 X:108804382-108804404 CCATTGGCACAAAGAGGAGCTGG No data
1195808669_1195808675 9 Left 1195808669 X:108804350-108804372 CCAGGTCCAGACAGATTCACAGC No data
Right 1195808675 X:108804382-108804404 CCATTGGCACAAAGAGGAGCTGG No data
1195808668_1195808675 20 Left 1195808668 X:108804339-108804361 CCAAAAAAAGTCCAGGTCCAGAC 0: 4
1: 973
2: 3237
3: 5812
4: 2170
Right 1195808675 X:108804382-108804404 CCATTGGCACAAAGAGGAGCTGG No data
1195808670_1195808675 3 Left 1195808670 X:108804356-108804378 CCAGACAGATTCACAGCCAAATT 0: 311
1: 1113
2: 3367
3: 7545
4: 4683
Right 1195808675 X:108804382-108804404 CCATTGGCACAAAGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195808675 Original CRISPR CCATTGGCACAAAGAGGAGC TGG Intergenic
No off target data available for this crispr