ID: 1195810708

View in Genome Browser
Species Human (GRCh38)
Location X:108825504-108825526
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195810708_1195810720 23 Left 1195810708 X:108825504-108825526 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1195810720 X:108825550-108825572 CCAGTCCCAATGAAATGAACTGG 0: 4
1: 175
2: 425
3: 370
4: 317
1195810708_1195810721 24 Left 1195810708 X:108825504-108825526 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195810708 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr