ID: 1195810721

View in Genome Browser
Species Human (GRCh38)
Location X:108825551-108825573
Sequence CAGTCCCAATGAAATGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2838
Summary {0: 4, 1: 142, 2: 756, 3: 1035, 4: 901}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195810707_1195810721 25 Left 1195810707 X:108825503-108825525 CCCACCCTGCTTCTGCTTGCCCT 0: 75
1: 252
2: 589
3: 812
4: 1291
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810709_1195810721 21 Left 1195810709 X:108825507-108825529 CCCTGCTTCTGCTTGCCCTCCAT 0: 31
1: 155
2: 365
3: 696
4: 1282
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810710_1195810721 20 Left 1195810710 X:108825508-108825530 CCTGCTTCTGCTTGCCCTCCATG 0: 28
1: 161
2: 384
3: 691
4: 1204
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810708_1195810721 24 Left 1195810708 X:108825504-108825526 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810716_1195810721 -10 Left 1195810716 X:108825538-108825560 CCCACTGTCCAACCAGTCCCAAT 0: 369
1: 925
2: 910
3: 710
4: 757
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810715_1195810721 2 Left 1195810715 X:108825526-108825548 CCATGGGCTGCACCCACTGTCCA 0: 495
1: 805
2: 644
3: 418
4: 401
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810714_1195810721 5 Left 1195810714 X:108825523-108825545 CCTCCATGGGCTGCACCCACTGT 0: 409
1: 676
2: 874
3: 616
4: 491
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901
1195810713_1195810721 6 Left 1195810713 X:108825522-108825544 CCCTCCATGGGCTGCACCCACTG 0: 432
1: 704
2: 901
3: 589
4: 545
Right 1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG 0: 4
1: 142
2: 756
3: 1035
4: 901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195810721 Original CRISPR CAGTCCCAATGAAATGAACT GGG Intergenic
Too many off-targets to display for this crispr