ID: 1195811427

View in Genome Browser
Species Human (GRCh38)
Location X:108835909-108835931
Sequence CTGGAAATGGAGATAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195811427_1195811432 17 Left 1195811427 X:108835909-108835931 CCATCCACTATCTCCATTTCCAG No data
Right 1195811432 X:108835949-108835971 ACCCAATTTAAAAATGGTAAAGG No data
1195811427_1195811431 11 Left 1195811427 X:108835909-108835931 CCATCCACTATCTCCATTTCCAG No data
Right 1195811431 X:108835943-108835965 CAAGTAACCCAATTTAAAAATGG 0: 4
1: 121
2: 480
3: 1377
4: 3326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195811427 Original CRISPR CTGGAAATGGAGATAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr