ID: 1195811431

View in Genome Browser
Species Human (GRCh38)
Location X:108835943-108835965
Sequence CAAGTAACCCAATTTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5308
Summary {0: 4, 1: 121, 2: 480, 3: 1377, 4: 3326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195811430_1195811431 -8 Left 1195811430 X:108835928-108835950 CCAGAACTTTTACAACAAGTAAC No data
Right 1195811431 X:108835943-108835965 CAAGTAACCCAATTTAAAAATGG 0: 4
1: 121
2: 480
3: 1377
4: 3326
1195811427_1195811431 11 Left 1195811427 X:108835909-108835931 CCATCCACTATCTCCATTTCCAG No data
Right 1195811431 X:108835943-108835965 CAAGTAACCCAATTTAAAAATGG 0: 4
1: 121
2: 480
3: 1377
4: 3326
1195811429_1195811431 -2 Left 1195811429 X:108835922-108835944 CCATTTCCAGAACTTTTACAACA No data
Right 1195811431 X:108835943-108835965 CAAGTAACCCAATTTAAAAATGG 0: 4
1: 121
2: 480
3: 1377
4: 3326
1195811428_1195811431 7 Left 1195811428 X:108835913-108835935 CCACTATCTCCATTTCCAGAACT No data
Right 1195811431 X:108835943-108835965 CAAGTAACCCAATTTAAAAATGG 0: 4
1: 121
2: 480
3: 1377
4: 3326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195811431 Original CRISPR CAAGTAACCCAATTTAAAAA TGG Intergenic
Too many off-targets to display for this crispr