ID: 1195811432

View in Genome Browser
Species Human (GRCh38)
Location X:108835949-108835971
Sequence ACCCAATTTAAAAATGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195811429_1195811432 4 Left 1195811429 X:108835922-108835944 CCATTTCCAGAACTTTTACAACA No data
Right 1195811432 X:108835949-108835971 ACCCAATTTAAAAATGGTAAAGG No data
1195811430_1195811432 -2 Left 1195811430 X:108835928-108835950 CCAGAACTTTTACAACAAGTAAC No data
Right 1195811432 X:108835949-108835971 ACCCAATTTAAAAATGGTAAAGG No data
1195811428_1195811432 13 Left 1195811428 X:108835913-108835935 CCACTATCTCCATTTCCAGAACT No data
Right 1195811432 X:108835949-108835971 ACCCAATTTAAAAATGGTAAAGG No data
1195811427_1195811432 17 Left 1195811427 X:108835909-108835931 CCATCCACTATCTCCATTTCCAG No data
Right 1195811432 X:108835949-108835971 ACCCAATTTAAAAATGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195811432 Original CRISPR ACCCAATTTAAAAATGGTAA AGG Intergenic
No off target data available for this crispr