ID: 1195813872

View in Genome Browser
Species Human (GRCh38)
Location X:108864062-108864084
Sequence CCTCAAGAACAGCAGCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195813872_1195813878 26 Left 1195813872 X:108864062-108864084 CCATCTAGCTGCTGTTCTTGAGG No data
Right 1195813878 X:108864111-108864133 CTCTGGATTCTACATTATCAGGG No data
1195813872_1195813875 9 Left 1195813872 X:108864062-108864084 CCATCTAGCTGCTGTTCTTGAGG No data
Right 1195813875 X:108864094-108864116 AGGTTGTAAAACCATCTCTCTGG No data
1195813872_1195813877 25 Left 1195813872 X:108864062-108864084 CCATCTAGCTGCTGTTCTTGAGG No data
Right 1195813877 X:108864110-108864132 TCTCTGGATTCTACATTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195813872 Original CRISPR CCTCAAGAACAGCAGCTAGA TGG (reversed) Intergenic
No off target data available for this crispr