ID: 1195819220

View in Genome Browser
Species Human (GRCh38)
Location X:108925086-108925108
Sequence TCCGATTAGAAAATAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195819220_1195819221 -6 Left 1195819220 X:108925086-108925108 CCTTTGTCTATTTTCTAATCGGA No data
Right 1195819221 X:108925103-108925125 ATCGGATTTTCCCCTACTGCTGG No data
1195819220_1195819222 -5 Left 1195819220 X:108925086-108925108 CCTTTGTCTATTTTCTAATCGGA No data
Right 1195819222 X:108925104-108925126 TCGGATTTTCCCCTACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195819220 Original CRISPR TCCGATTAGAAAATAGACAA AGG (reversed) Intergenic