ID: 1195819221

View in Genome Browser
Species Human (GRCh38)
Location X:108925103-108925125
Sequence ATCGGATTTTCCCCTACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195819220_1195819221 -6 Left 1195819220 X:108925086-108925108 CCTTTGTCTATTTTCTAATCGGA No data
Right 1195819221 X:108925103-108925125 ATCGGATTTTCCCCTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195819221 Original CRISPR ATCGGATTTTCCCCTACTGC TGG Intergenic
No off target data available for this crispr