ID: 1195819925

View in Genome Browser
Species Human (GRCh38)
Location X:108933519-108933541
Sequence TCGAACCATCCCTGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195819924_1195819925 24 Left 1195819924 X:108933472-108933494 CCTTTATTCTGTTGGTATGATGT No data
Right 1195819925 X:108933519-108933541 TCGAACCATCCCTGTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195819925 Original CRISPR TCGAACCATCCCTGTATCCC AGG Intergenic
No off target data available for this crispr