ID: 1195821681

View in Genome Browser
Species Human (GRCh38)
Location X:108951932-108951954
Sequence ATACAAAAACAGCTTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195821681_1195821683 7 Left 1195821681 X:108951932-108951954 CCTTGCTCAAGCTGTTTTTGTAT No data
Right 1195821683 X:108951962-108951984 ATTAAATAGGACACAAGTTTAGG No data
1195821681_1195821684 8 Left 1195821681 X:108951932-108951954 CCTTGCTCAAGCTGTTTTTGTAT No data
Right 1195821684 X:108951963-108951985 TTAAATAGGACACAAGTTTAGGG No data
1195821681_1195821682 -6 Left 1195821681 X:108951932-108951954 CCTTGCTCAAGCTGTTTTTGTAT No data
Right 1195821682 X:108951949-108951971 TTGTATAAGAGTAATTAAATAGG No data
1195821681_1195821685 22 Left 1195821681 X:108951932-108951954 CCTTGCTCAAGCTGTTTTTGTAT No data
Right 1195821685 X:108951977-108951999 AGTTTAGGGAGCATGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195821681 Original CRISPR ATACAAAAACAGCTTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr