ID: 1195827479

View in Genome Browser
Species Human (GRCh38)
Location X:109018022-109018044
Sequence GTGATGGTCTTAAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195827479_1195827483 -6 Left 1195827479 X:109018022-109018044 CCCTTTTTCCTTAAGACCATCAC No data
Right 1195827483 X:109018039-109018061 CATCACAGCCAATTTCTTTCTGG No data
1195827479_1195827486 28 Left 1195827479 X:109018022-109018044 CCCTTTTTCCTTAAGACCATCAC No data
Right 1195827486 X:109018073-109018095 CTTGACTGACTTATCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195827479 Original CRISPR GTGATGGTCTTAAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr