ID: 1195829471

View in Genome Browser
Species Human (GRCh38)
Location X:109040133-109040155
Sequence AGAGACAGGGCCTCCTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195829471_1195829478 0 Left 1195829471 X:109040133-109040155 CCACATAAGGAGGCCCTGTCTCT No data
Right 1195829478 X:109040156-109040178 GGGAGAGGCATGCAGAGGCTTGG No data
1195829471_1195829477 -5 Left 1195829471 X:109040133-109040155 CCACATAAGGAGGCCCTGTCTCT No data
Right 1195829477 X:109040151-109040173 TCTCTGGGAGAGGCATGCAGAGG No data
1195829471_1195829479 1 Left 1195829471 X:109040133-109040155 CCACATAAGGAGGCCCTGTCTCT No data
Right 1195829479 X:109040157-109040179 GGAGAGGCATGCAGAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195829471 Original CRISPR AGAGACAGGGCCTCCTTATG TGG (reversed) Intergenic
No off target data available for this crispr