ID: 1195831664

View in Genome Browser
Species Human (GRCh38)
Location X:109066124-109066146
Sequence CTGGCTTATTTCACTTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195831662_1195831664 2 Left 1195831662 X:109066099-109066121 CCATGCAGTATTTGTCTTTCTAT No data
Right 1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195831664 Original CRISPR CTGGCTTATTTCACTTATCA TGG Intergenic
No off target data available for this crispr