ID: 1195846521

View in Genome Browser
Species Human (GRCh38)
Location X:109234993-109235015
Sequence GGTGGGAGGTGTTTGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20455
Summary {0: 300, 1: 1151, 2: 3915, 3: 6324, 4: 8765}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195846521_1195846530 0 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846530 X:109235016-109235038 AGACCCCACTTTCAGCACTGGGG No data
1195846521_1195846528 -2 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846528 X:109235014-109235036 CCAGACCCCACTTTCAGCACTGG No data
1195846521_1195846529 -1 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846529 X:109235015-109235037 CAGACCCCACTTTCAGCACTGGG No data
1195846521_1195846534 28 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846534 X:109235044-109235066 AATTCAACATGAGATTTGAGTGG 0: 103
1: 1835
2: 11362
3: 14611
4: 11691
1195846521_1195846536 30 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846536 X:109235046-109235068 TTCAACATGAGATTTGAGTGGGG 0: 97
1: 1784
2: 10938
3: 13095
4: 9677
1195846521_1195846535 29 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195846521 Original CRISPR GGTGGGAGGTGTTTGGGTCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr