ID: 1195846523

View in Genome Browser
Species Human (GRCh38)
Location X:109235000-109235022
Sequence GGGGTCTGGTGGGAGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14385
Summary {0: 37, 1: 678, 2: 2498, 3: 4982, 4: 6190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195846523_1195846530 -7 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846530 X:109235016-109235038 AGACCCCACTTTCAGCACTGGGG No data
1195846523_1195846528 -9 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846528 X:109235014-109235036 CCAGACCCCACTTTCAGCACTGG No data
1195846523_1195846536 23 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846536 X:109235046-109235068 TTCAACATGAGATTTGAGTGGGG 0: 97
1: 1784
2: 10938
3: 13095
4: 9677
1195846523_1195846534 21 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846534 X:109235044-109235066 AATTCAACATGAGATTTGAGTGG 0: 103
1: 1835
2: 11362
3: 14611
4: 11691
1195846523_1195846529 -8 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846529 X:109235015-109235037 CAGACCCCACTTTCAGCACTGGG No data
1195846523_1195846535 22 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195846523 Original CRISPR GGGGTCTGGTGGGAGGTGTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr