ID: 1195846526

View in Genome Browser
Species Human (GRCh38)
Location X:109235011-109235033
Sequence GTGCTGAAAGTGGGGTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195846526_1195846536 12 Left 1195846526 X:109235011-109235033 CCACCAGACCCCACTTTCAGCAC No data
Right 1195846536 X:109235046-109235068 TTCAACATGAGATTTGAGTGGGG 0: 97
1: 1784
2: 10938
3: 13095
4: 9677
1195846526_1195846534 10 Left 1195846526 X:109235011-109235033 CCACCAGACCCCACTTTCAGCAC No data
Right 1195846534 X:109235044-109235066 AATTCAACATGAGATTTGAGTGG 0: 103
1: 1835
2: 11362
3: 14611
4: 11691
1195846526_1195846535 11 Left 1195846526 X:109235011-109235033 CCACCAGACCCCACTTTCAGCAC No data
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195846526 Original CRISPR GTGCTGAAAGTGGGGTCTGG TGG (reversed) Intergenic
No off target data available for this crispr