ID: 1195846531

View in Genome Browser
Species Human (GRCh38)
Location X:109235019-109235041
Sequence AATCCCCAGTGCTGAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5159
Summary {0: 5, 1: 34, 2: 309, 3: 1526, 4: 3285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195846531_1195846535 3 Left 1195846531 X:109235019-109235041 CCCCACTTTCAGCACTGGGGATT 0: 5
1: 34
2: 309
3: 1526
4: 3285
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846531_1195846536 4 Left 1195846531 X:109235019-109235041 CCCCACTTTCAGCACTGGGGATT 0: 5
1: 34
2: 309
3: 1526
4: 3285
Right 1195846536 X:109235046-109235068 TTCAACATGAGATTTGAGTGGGG 0: 97
1: 1784
2: 10938
3: 13095
4: 9677
1195846531_1195846534 2 Left 1195846531 X:109235019-109235041 CCCCACTTTCAGCACTGGGGATT 0: 5
1: 34
2: 309
3: 1526
4: 3285
Right 1195846534 X:109235044-109235066 AATTCAACATGAGATTTGAGTGG 0: 103
1: 1835
2: 11362
3: 14611
4: 11691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195846531 Original CRISPR AATCCCCAGTGCTGAAAGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr