ID: 1195846535

View in Genome Browser
Species Human (GRCh38)
Location X:109235045-109235067
Sequence ATTCAACATGAGATTTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38474
Summary {0: 90, 1: 1709, 2: 11232, 3: 13453, 4: 11990}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195846522_1195846535 23 Left 1195846522 X:109234999-109235021 CCCAAACACCTCCCACCAGACCC 0: 27
1: 427
2: 1075
3: 1737
4: 2132
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846525_1195846535 12 Left 1195846525 X:109235010-109235032 CCCACCAGACCCCACTTTCAGCA No data
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846521_1195846535 29 Left 1195846521 X:109234993-109235015 CCATGACCCAAACACCTCCCACC 0: 300
1: 1151
2: 3915
3: 6324
4: 8765
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846532_1195846535 2 Left 1195846532 X:109235020-109235042 CCCACTTTCAGCACTGGGGATTA 0: 5
1: 35
2: 319
3: 1650
4: 3463
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846524_1195846535 15 Left 1195846524 X:109235007-109235029 CCTCCCACCAGACCCCACTTTCA No data
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846531_1195846535 3 Left 1195846531 X:109235019-109235041 CCCCACTTTCAGCACTGGGGATT 0: 5
1: 34
2: 309
3: 1526
4: 3285
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846523_1195846535 22 Left 1195846523 X:109235000-109235022 CCAAACACCTCCCACCAGACCCC 0: 37
1: 678
2: 2498
3: 4982
4: 6190
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846533_1195846535 1 Left 1195846533 X:109235021-109235043 CCACTTTCAGCACTGGGGATTAC 0: 4
1: 34
2: 318
3: 1683
4: 3483
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846526_1195846535 11 Left 1195846526 X:109235011-109235033 CCACCAGACCCCACTTTCAGCAC No data
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990
1195846527_1195846535 8 Left 1195846527 X:109235014-109235036 CCAGACCCCACTTTCAGCACTGG No data
Right 1195846535 X:109235045-109235067 ATTCAACATGAGATTTGAGTGGG 0: 90
1: 1709
2: 11232
3: 13453
4: 11990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195846535 Original CRISPR ATTCAACATGAGATTTGAGT GGG Intergenic
Too many off-targets to display for this crispr