ID: 1195850343

View in Genome Browser
Species Human (GRCh38)
Location X:109275990-109276012
Sequence GGGTCCTAAGGAACACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195850338_1195850343 26 Left 1195850338 X:109275941-109275963 CCTCATATGTGACTTGATTTGTA No data
Right 1195850343 X:109275990-109276012 GGGTCCTAAGGAACACCAGCTGG No data
1195850341_1195850343 -10 Left 1195850341 X:109275977-109275999 CCAACAGTCTCTTGGGTCCTAAG No data
Right 1195850343 X:109275990-109276012 GGGTCCTAAGGAACACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195850343 Original CRISPR GGGTCCTAAGGAACACCAGC TGG Intergenic
No off target data available for this crispr