ID: 1195858613

View in Genome Browser
Species Human (GRCh38)
Location X:109357282-109357304
Sequence CTTGATCTCTGAAAAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195858609_1195858613 -7 Left 1195858609 X:109357266-109357288 CCATGACCCAAAGCCACTTGATC No data
Right 1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG No data
1195858607_1195858613 -1 Left 1195858607 X:109357260-109357282 CCATTCCCATGACCCAAAGCCAC No data
Right 1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG No data
1195858608_1195858613 -6 Left 1195858608 X:109357265-109357287 CCCATGACCCAAAGCCACTTGAT No data
Right 1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195858613 Original CRISPR CTTGATCTCTGAAAAGCCAG TGG Intergenic
No off target data available for this crispr