ID: 1195861800

View in Genome Browser
Species Human (GRCh38)
Location X:109391012-109391034
Sequence CTCATTCTCCAGCTCTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195861799_1195861800 -7 Left 1195861799 X:109390996-109391018 CCAATGAATGGAGCTACTCATTC 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1195861800 X:109391012-109391034 CTCATTCTCCAGCTCTACTTTGG 0: 1
1: 0
2: 3
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195861800 Original CRISPR CTCATTCTCCAGCTCTACTT TGG Intronic
904743339 1:32695399-32695421 ATCTCTCTCCAGCTCTGCTTGGG + Exonic
905807466 1:40887257-40887279 CTCATTCTCCAGCAGTAATAGGG - Intergenic
905939124 1:41848895-41848917 CTCCAGCTCCAGCTCTTCTTGGG + Intronic
906672210 1:47664559-47664581 CTCTGTCTCCAGCTCTGCCTCGG - Intergenic
907362552 1:53930674-53930696 CTCAGCCTCCATCTCTACATTGG + Intronic
909477221 1:76094443-76094465 CTTATTCTCCAACACTCCTTTGG + Intronic
909487610 1:76191141-76191163 CTCATGCTCCATCTCTAGCTAGG - Intronic
911039920 1:93583365-93583387 CCCTGTCTCCAGCTCTCCTTTGG - Intronic
911896428 1:103441251-103441273 CTCATCTTTCATCTCTACTTTGG + Intergenic
913362382 1:117996245-117996267 CTCACTTTTCTGCTCTACTTTGG - Intronic
913386139 1:118260185-118260207 CTCCCTCTCCAGCTCTCCTCAGG + Intergenic
913707711 1:121443712-121443734 CTCAGTCTCCAGTTTTCCTTTGG + Intergenic
916167555 1:161977425-161977447 CTCTTTCTCCTGCTCAACTCTGG + Intergenic
916538711 1:165730568-165730590 ATCATTCTCCATCTTTACTAAGG - Intronic
916719473 1:167473497-167473519 CTCATTCTCAAGCTGCAGTTGGG - Intronic
917288043 1:173442004-173442026 TTCACTCTCCAGCCCTGCTTTGG - Intergenic
918104516 1:181405008-181405030 CTCATGCTGCAGCTCTAAGTAGG - Intergenic
1063651532 10:7942670-7942692 CACATTCCCCAGCGCTTCTTGGG - Intronic
1063666503 10:8063813-8063835 AGCATTCCCCAGCTCAACTTTGG + Intronic
1064586058 10:16840437-16840459 CCCATTTTCCATCTGTACTTGGG - Exonic
1065664126 10:28039952-28039974 GTCCTTCTCCAGCACTAGTTTGG + Intergenic
1066244806 10:33572063-33572085 CTCATTCTCCACCTTTCCCTAGG + Intergenic
1067323760 10:45246755-45246777 CCCATTTTCCATCTGTACTTGGG - Intergenic
1068602894 10:58974355-58974377 CTCATTTTTCAGGTTTACTTTGG - Intergenic
1069436046 10:68383888-68383910 CTCAGTTTCCACATCTACTTTGG + Exonic
1070563051 10:77582405-77582427 ATCATTTTCAAGCTCTGCTTAGG + Intronic
1070841890 10:79493141-79493163 CACATTCTCAAGCTCGACATGGG - Intergenic
1070970657 10:80564489-80564511 CTCTCTCTCCAGGTCTCCTTTGG + Intronic
1074572388 10:114635877-114635899 CTCATTCTCCAGGTTTCTTTTGG - Intronic
1074782194 10:116810025-116810047 CACATTCTTCAGTTCTCCTTCGG - Intergenic
1074979002 10:118604178-118604200 CTCAATCTCCATCTCTCCCTCGG + Intergenic
1075029984 10:119016579-119016601 CTCCTTCTCCTGCTCTCCTGTGG - Intergenic
1075359058 10:121813332-121813354 CTCATTCTCCATCTCAACCTTGG + Intronic
1075931248 10:126298008-126298030 CTCATTCGCCCTCTCTCCTTGGG - Intronic
1080082922 11:28242275-28242297 CTCATGCTCCATCTCTACTCTGG + Intronic
1080774347 11:35371777-35371799 CTCATTCTGCAGGTCTGGTTGGG - Intronic
1081431113 11:42977626-42977648 CTCATTCACCAACTCTAGGTTGG - Intergenic
1083953088 11:65967500-65967522 CTCCTTCTCCTCCTCCACTTCGG - Exonic
1084296374 11:68215155-68215177 CTCATTCTCGACCTTGACTTTGG + Intergenic
1084343587 11:68527125-68527147 TTCATTCTGGAGCTGTACTTTGG - Intronic
1085804009 11:79617953-79617975 ATCATTCTCCTGCTCTGCTCTGG + Intergenic
1086949385 11:92876105-92876127 CTCCCTCTCCAGCTCCTCTTTGG - Intronic
1087045226 11:93838979-93839001 CCCATGCTCCAGCCCCACTTAGG + Intronic
1088224234 11:107601993-107602015 CTCACTCTCCATCTCCATTTTGG + Intronic
1088412937 11:109555427-109555449 CTCTTTCTCCCACTCTACTCAGG - Intergenic
1088541934 11:110921832-110921854 CTCATTCTCCTGCTCAGCTGTGG + Intergenic
1091368311 11:135039635-135039657 CTCAGTTCCCAGCTCCACTTGGG - Intergenic
1091983065 12:4882118-4882140 CTTATGCTACATCTCTACTTCGG - Intergenic
1092562983 12:9636174-9636196 CTCATTCCTCAGATCTATTTTGG + Intergenic
1092866914 12:12769775-12769797 CTCAGTCTCCCCCTCTCCTTAGG - Intronic
1092885546 12:12921584-12921606 CACATCCTCCAGCTCTGCTGGGG + Intergenic
1092929843 12:13305543-13305565 CTCCTTTTCCAGTTCCACTTTGG + Intergenic
1093522342 12:20065966-20065988 CTCTTTCTCCAGCTCTGCACTGG - Intergenic
1095106745 12:38243096-38243118 CTCCTTCTCTAGGTCTTCTTTGG + Intergenic
1095494589 12:42771235-42771257 CTCTTTCTCTATCTCTACCTAGG - Intergenic
1096653851 12:53076164-53076186 ATTATTCTCCAGCTCCACTGAGG - Intronic
1096983999 12:55744645-55744667 CCCCTTTTCCAGCTCTCCTTAGG + Intronic
1097579645 12:61439030-61439052 CTTGCTCTCCAGATCTACTTGGG - Intergenic
1098010075 12:66041430-66041452 CCCATTCTCCAGCTCTTTATAGG - Intergenic
1100126468 12:91432592-91432614 CTCATTCTCTAGCTCTACTATGG - Intergenic
1101264912 12:103074129-103074151 CTCATTATTCAGTTTTACTTAGG - Intergenic
1102382556 12:112479875-112479897 CTCATTCTTCCTCTTTACTTTGG + Intronic
1103362065 12:120360340-120360362 GTGATCCTCCAGCTCTCCTTAGG + Intronic
1104793797 12:131501695-131501717 CTCATTCATCAGGTCTATTTTGG - Intergenic
1105628636 13:22138816-22138838 AGCATTTTCCAGCTTTACTTAGG - Intergenic
1105967392 13:25397167-25397189 CACATTCTCCAGTTGTCCTTAGG + Intronic
1109929764 13:69199704-69199726 ATCATTCCCCAGCTTTACTGAGG - Intergenic
1110336932 13:74344139-74344161 CTAATTCTCTTGCTATACTTGGG + Intergenic
1114268565 14:21087673-21087695 CTCTCTCTCTAGCTCTTCTTGGG + Intronic
1114282964 14:21211550-21211572 ATCATTCTTCATCTCTACTGCGG + Exonic
1114433593 14:22684464-22684486 CTCTTTCTCTACCTCTTCTTTGG - Intergenic
1117639562 14:57784200-57784222 CTCATTCTCTAGCACTGGTTTGG - Intronic
1120218118 14:81702679-81702701 GTCATTTTCCATCTCCACTTAGG + Intergenic
1120431257 14:84418901-84418923 ATCAATCTTCAGCTCAACTTGGG + Intergenic
1120825102 14:88947790-88947812 CTCATTCTGCAGCAATTCTTTGG + Intergenic
1125474880 15:40040314-40040336 CTCATTATACAGCCCTGCTTAGG - Intergenic
1126303510 15:47226843-47226865 CTCATTCCACATCTCTGCTTTGG + Intronic
1126817066 15:52464403-52464425 CTCATTTCCCATCTCTTCTTAGG + Intronic
1128673378 15:69591195-69591217 TCTATTCTCCAGCTCTCCTTTGG - Intergenic
1128927087 15:71666921-71666943 CTCTTCCCCCAGCTCTACATAGG - Intronic
1129459428 15:75693080-75693102 CTCCTGCTGCAGCTCTACTCTGG - Exonic
1129724533 15:77894806-77894828 CTCCTGCTGCAGCTCTACTCTGG + Intergenic
1130272561 15:82459603-82459625 CTCCTGCTGCAGCTCTACTCTGG + Intergenic
1130464913 15:84186956-84186978 CTCCTGCTGCAGCTCTACTCTGG + Intergenic
1130487775 15:84407848-84407870 CTCCTGCTGCAGCTCTACTCTGG - Intergenic
1130499352 15:84486581-84486603 CTCCTGCTGCAGCTCTACTCTGG - Intergenic
1130587203 15:85191570-85191592 CTCCTGCTGCAGCTCTACTCTGG + Intergenic
1131174785 15:90202523-90202545 TTGCTTCTCCAGCTCTTCTTGGG + Intronic
1131220155 15:90576984-90577006 CTCCTTCCCCAGCTTTACGTGGG + Intronic
1132178825 15:99736062-99736084 CTCAGCCACCAGCTGTACTTCGG + Intergenic
1133314411 16:4873607-4873629 CTCATTCTCACGGTCTGCTTAGG - Intronic
1134883388 16:17768178-17768200 CTCCTTCTCTTGCTCTACCTGGG - Intergenic
1134909104 16:18008184-18008206 CTCTTTGTCCAGATCTTCTTGGG + Intergenic
1135139901 16:19912318-19912340 CGCAGTCTTCAGCTCTACTCTGG + Intergenic
1139028663 16:62851615-62851637 CTCACTTTCTAGCTCTACTGAGG + Intergenic
1140129730 16:72149935-72149957 ATCATTCTCCTCCTCTTCTTAGG - Intronic
1141818444 16:86428982-86429004 ACCATTCTCCACCTCTCCTTAGG - Intergenic
1143408142 17:6691620-6691642 CACAGTCTCCAGCTTTACTTCGG - Intronic
1143951874 17:10639073-10639095 GTCATTCTCCAGATCTAATATGG + Exonic
1144825026 17:18100962-18100984 CCCATTCCCCAGCTCTCCCTGGG - Intronic
1146553052 17:33798734-33798756 CTCATTCCCCAGCTCAATTTAGG + Intronic
1146644905 17:34570938-34570960 CTCCTTCCCCATCTCTTCTTGGG - Intergenic
1146832521 17:36082094-36082116 CTCTTATTCCAGCTCTACTGGGG + Intergenic
1147189242 17:38729449-38729471 CACTTTCTCCAGCTCAACTTGGG + Exonic
1149292396 17:55229975-55229997 GTCATTGTCCAGCTTTCCTTTGG + Intergenic
1151850122 17:76685077-76685099 CTCCTCCTCCAGCTCCTCTTTGG + Exonic
1155344582 18:24845895-24845917 ATCATTCCCCAGCACAACTTTGG - Intergenic
1156982995 18:43314237-43314259 CTCATTTTCCAACTCTAATTAGG - Intergenic
1157148916 18:45195112-45195134 CTCTTTCTCCAGATCTAAATAGG - Intergenic
1158487368 18:57879500-57879522 CTCATTTTCAAACTCTACTCAGG - Intergenic
1160931042 19:1569557-1569579 CTCTTCCTCCAGCTGTCCTTCGG + Intergenic
1162447028 19:10729737-10729759 CCCTTCCTCCAGCTCTACCTGGG + Intronic
926986243 2:18627340-18627362 CTCATTCTCCAACTGACCTTAGG + Intergenic
928277037 2:29911557-29911579 TTCCTTCTCCAGCTCTCTTTAGG - Intronic
928315456 2:30241038-30241060 CTCATCTTCCAGCTTTTCTTAGG + Intronic
928869287 2:35957967-35957989 CTCCTTTTCCTGCTTTACTTGGG - Intergenic
930135295 2:47897280-47897302 CTGATTTGCCAACTCTACTTGGG - Intronic
931008793 2:57883197-57883219 GTCATTCTCTACTTCTACTTTGG + Intergenic
933319280 2:80752951-80752973 CTCATTTTACAGCTCTTATTTGG + Intergenic
933646466 2:84816849-84816871 CTCATTCTTCAGCTGTCCCTTGG - Intronic
936485810 2:112924652-112924674 CTGCTTCTCCAGCTACACTTGGG - Intergenic
937458130 2:122061754-122061776 CTCAAATTCCAGCTCTACCTTGG - Intergenic
937684280 2:124678714-124678736 CTCCTTCTCCAACTCTCCTTGGG + Intronic
938026256 2:127951494-127951516 CTCAGCCTCCAGCACTTCTTAGG + Intronic
938039288 2:128062593-128062615 TTCATTTTCCATCTCTGCTTTGG + Intergenic
938967329 2:136399965-136399987 CTCAATCTCCAGCCCTCCTCTGG - Intergenic
941104804 2:161340832-161340854 CTCCTCCTCCAGCTCCTCTTTGG + Intronic
941590985 2:167420078-167420100 CTCATTCTAGAGCTTCACTTTGG - Intergenic
943360470 2:186912679-186912701 CTGATTCTTCATGTCTACTTGGG + Intergenic
943661375 2:190562867-190562889 CTCATTCCCCTGCTCTGTTTTGG + Intergenic
944057883 2:195542418-195542440 CTCATGCTCTAGGTCTACTTTGG + Intergenic
944893069 2:204137217-204137239 GACATTTTCCAGCTCTACTTTGG + Intergenic
1168874902 20:1164675-1164697 CTCTTTCCCCAGCTCCACTCTGG + Intronic
1170782256 20:19436727-19436749 CTCTCTCCCCATCTCTACTTGGG + Intronic
1171484226 20:25476129-25476151 CTCTCTCTCCAGCGCTATTTTGG + Exonic
1172437950 20:34943347-34943369 GTCATTTTCTAGCTCTTCTTCGG - Intronic
1176003477 20:62845767-62845789 CCCATTCTCCAGCTCTTCCTTGG - Intronic
1176656419 21:9592199-9592221 CTCTTTCTCCATCTCTGCCTGGG - Intergenic
1179426762 21:41285954-41285976 CTGAAACTCCAGCTCTTCTTGGG + Intergenic
1179573154 21:42290095-42290117 CTCATTGGCCTGCTGTACTTGGG + Exonic
1181960967 22:26621695-26621717 CTCATTCTCCTGCTCTAGTCAGG + Intergenic
1182116115 22:27757464-27757486 CTCATTCTCAAGCTCTGCCTGGG - Intronic
1182173861 22:28262782-28262804 CTAGTTCTCCATTTCTACTTGGG - Intronic
1182541388 22:31044589-31044611 CACATTCACCAGCTCCACTTCGG - Intergenic
1182702988 22:32255505-32255527 CTCATTCTCACACTCTACCTAGG - Intergenic
1182772904 22:32808692-32808714 CTCATTCTCTAGGTCTCCTTTGG + Intronic
1183371272 22:37433796-37433818 CTCCTCCTCCAGCTCTCCCTGGG - Intergenic
1183784759 22:40022948-40022970 CTAATTCCCCAGCACTGCTTTGG + Intronic
950312151 3:11968062-11968084 CTCATCTTCCAGCTCAACTGTGG - Intergenic
951842675 3:27050967-27050989 CTCATTCTGCAGCTCTCTGTGGG + Intergenic
956585510 3:70860505-70860527 CTCATTCATCATCTCTGCTTCGG - Intergenic
957961758 3:87264168-87264190 CTCATTCTTCATCTCTACTGTGG - Intronic
961129575 3:124453440-124453462 CTCTTTCTCCAGCATTTCTTGGG + Intronic
961649752 3:128411425-128411447 CTCAAACTCCAGCTCTATCTGGG - Intergenic
961990712 3:131187467-131187489 CTCATTTTCCAGTTCTTCCTTGG + Intronic
962434143 3:135348913-135348935 TGCATTCTCCAGCTGTCCTTGGG + Intergenic
964800099 3:160546923-160546945 CTCACTCTCCGGCCCTTCTTTGG + Intronic
966472906 3:180311805-180311827 CACATTTTCCTGCTGTACTTAGG + Intergenic
967180089 3:186896004-186896026 CTCACTCCCCACCTCTACTAGGG + Intergenic
967543959 3:190701764-190701786 CTTATTCACCACCTCTACTCGGG + Intergenic
967702475 3:192609348-192609370 CCCACTCTCCAGATATACTTTGG + Intronic
967868399 3:194208940-194208962 CTGTTTCTCCATCTGTACTTGGG - Intergenic
970210501 4:13705010-13705032 CTCATTCTTCATCTGTATTTGGG + Intergenic
971035621 4:22689739-22689761 CCCACTCTCCAGGTCTACTATGG - Intergenic
971865898 4:32171558-32171580 CTTATTCTCCTGGGCTACTTAGG + Intergenic
972293438 4:37713699-37713721 CTCATTTTTCAGGTTTACTTTGG + Intergenic
973717169 4:53688426-53688448 CACATTCTGCAGCTCTCCCTTGG + Intronic
973902997 4:55496773-55496795 CTTATTCTCCAGCTACACTAAGG + Intronic
975818457 4:78244434-78244456 CTCATGCTGCTCCTCTACTTAGG - Intronic
976359788 4:84164206-84164228 CTTATTCTCCAGCTGTATTGCGG + Intergenic
976483297 4:85570015-85570037 CTCATTTTTCAGTTCTACTTAGG + Intronic
976483300 4:85570082-85570104 CTTATTTTTCAGTTCTACTTAGG + Intronic
976770363 4:88645693-88645715 CTCACTGTCCCGCTCTACCTGGG - Intronic
979205201 4:118031002-118031024 GGCCTTCTCCACCTCTACTTGGG + Intergenic
979443019 4:120774724-120774746 CTCATTTTACAGTTCTTCTTTGG - Intronic
979500879 4:121438592-121438614 CTCAATCTCCTGCTAGACTTTGG + Intergenic
980998236 4:139802124-139802146 CTAACTCTCCAGCTCCACTGGGG + Intronic
981966711 4:150612622-150612644 CTCAATGACCATCTCTACTTTGG + Intronic
983120370 4:163876469-163876491 TTCAGTCTTCAGCTCTAATTTGG + Intronic
985608032 5:869188-869210 CTCATTTTCCAGGTTGACTTTGG - Intronic
989382136 5:40820166-40820188 CTCAACCTCAACCTCTACTTAGG + Intergenic
990483329 5:56233136-56233158 CTCATTCATCAGCTGTACATGGG + Intronic
990883620 5:60567981-60568003 CTCACTCTCCTGCTCCACTATGG - Intergenic
991603655 5:68378857-68378879 CTGCTTCCCCAGCTCTTCTTGGG - Intergenic
993722147 5:91332156-91332178 CTCATTCACAAGCTATACATTGG + Intergenic
997237606 5:132282628-132282650 GGCATTTTCCAGCTCAACTTTGG + Intronic
998064946 5:139150557-139150579 CTCATTTTGCTGCTCTGCTTGGG - Intronic
998079373 5:139261913-139261935 CTCTTTGTCCAGGTCTCCTTGGG + Intronic
998510271 5:142707221-142707243 ATCTTTCTCCAGCTCTTCATTGG + Intergenic
998675389 5:144402302-144402324 CTCCTTCCCCACCTCTCCTTAGG + Intronic
999219103 5:149960422-149960444 CTCTTTATCCAGTACTACTTGGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1001801713 5:174550141-174550163 TTGATTTTCCTGCTCTACTTGGG + Intergenic
1002012567 5:176295522-176295544 TTCATTCTGCAGCTCTACTTCGG + Intronic
1002215247 5:177627092-177627114 TTCATTCTGCAGCTCTACTTTGG - Intergenic
1002492866 5:179591641-179591663 GTAAGTCTCCAGCTCAACTTTGG - Exonic
1002945639 6:1758634-1758656 CACATTCTCCAGCTCCACCCAGG - Intronic
1006867281 6:37219111-37219133 CTCCTTCCCCAAATCTACTTTGG + Intronic
1007091786 6:39189360-39189382 CCCCTTCTCCACCTCTGCTTGGG + Exonic
1007662789 6:43496737-43496759 CTCAACCTCCAGCTCTGTTTAGG + Intronic
1007679658 6:43625468-43625490 CCCATTGTCCAGCTCTCCCTGGG + Exonic
1009394913 6:63188236-63188258 CTCATTCTCAGGCTCTGTTTTGG + Intergenic
1014879392 6:126704077-126704099 CTCTTTCTCCATGGCTACTTAGG + Intergenic
1015082529 6:129245139-129245161 CTCTTTCTCCATATCTACTAAGG - Intronic
1015333845 6:132011847-132011869 CTCTTGCTCCAGCTCTCCCTAGG - Intergenic
1015986621 6:138891025-138891047 CTCATTTTTCAGGTTTACTTTGG - Intronic
1018089283 6:160331770-160331792 CTCTCCCTCCATCTCTACTTTGG - Intergenic
1018493243 6:164319212-164319234 CTCTTCCCCCAACTCTACTTTGG + Intergenic
1019949825 7:4362359-4362381 CTCATTCACCCCCTCTGCTTTGG + Intergenic
1023305326 7:38819830-38819852 CTCACTCTACAGCTCTAAATTGG + Intronic
1027738130 7:81962007-81962029 ATCATCCTCCATCTCAACTTGGG + Exonic
1029102805 7:98147842-98147864 CTCATTCTCCTGGTTTCCTTTGG + Intronic
1029157295 7:98526293-98526315 CTCATTCACCTTCTCCACTTAGG + Intergenic
1031192491 7:118571749-118571771 TTCATTTTCCAGCTTTACTGAGG - Intergenic
1031693796 7:124823214-124823236 ATCATTTTTCAGCTCAACTTAGG + Exonic
1032342671 7:131089968-131089990 CTCATTCTCCAAATCTCTTTAGG + Intergenic
1035928057 8:3750802-3750824 CTCTGTCTCCAGCTGTCCTTAGG + Intronic
1043027531 8:75089308-75089330 CACATTCTCAAGCTCTCCTAGGG + Intergenic
1045682663 8:104679347-104679369 CTCATTCCCCAGTTCCAGTTAGG - Intronic
1047788340 8:128176518-128176540 CTCATTTTCCATCTCTGCTTGGG + Intergenic
1047949478 8:129918743-129918765 CTCATTCAGCATCTATACTTTGG - Intronic
1048218600 8:132519876-132519898 GTCATTCTTCAACTCTACTCAGG + Intergenic
1049929139 9:439423-439445 CCCATACTCCAGCTGGACTTGGG + Intronic
1051742803 9:20267823-20267845 CTCATTCACCCACTCTTCTTAGG - Intergenic
1052776559 9:32738864-32738886 CTCATTCTCCAGCTTTTTCTGGG + Intergenic
1052965237 9:34335681-34335703 CTCATTCTCCATCTATATTCTGG - Intronic
1053109465 9:35445132-35445154 CACATTCTCCATCTCTAAATTGG + Intergenic
1053143740 9:35698086-35698108 CTCATTCTCCTGCTCTTCAAAGG + Exonic
1056189744 9:84173180-84173202 CTCATTCTCCAGCTTTCTTAGGG + Intergenic
1057861678 9:98645636-98645658 CCCATTCTCCAGCCCTGCCTGGG + Intronic
1057917942 9:99071958-99071980 CTCATTCTCCAAGTCTAAATGGG - Intergenic
1058458734 9:105162879-105162901 CTTTCTCACCAGCTCTACTTAGG + Intergenic
1059600383 9:115770829-115770851 TTCAATTTCCAGCTCTAGTTTGG + Intergenic
1059666441 9:116450704-116450726 CTCATTCTCAAGCCTCACTTGGG - Intronic
1060074387 9:120578955-120578977 CTGTTTATCCAGCTCTACTATGG - Intronic
1060807289 9:126585782-126585804 CTCCTTCTCCAGCTACATTTTGG - Intergenic
1061100453 9:128487994-128488016 CTCATTCTCCAGCTTGAATGCGG - Exonic
1061267018 9:129512140-129512162 CTCCTTCTCCAACTCCTCTTTGG + Intergenic
1203634134 Un_KI270750v1:95681-95703 CTCTTTCTCCATCTCTGCCTGGG - Intergenic
1186562888 X:10631667-10631689 TGCTTTCTCCAGCTCTATTTTGG + Intronic
1186592973 X:10950811-10950833 CTCAATCTCCAGCACTTCCTGGG - Intergenic
1188887646 X:35569874-35569896 CTCTTTCTCCAGCTATACACAGG + Intergenic
1188945294 X:36293505-36293527 CTTTTTCTCCAGCTATACGTAGG - Intronic
1192458072 X:71294252-71294274 CATATTGTCCAGCTCCACTTTGG - Exonic
1194842011 X:98754345-98754367 CTCAGTGTCCTGCTCTACTATGG + Intergenic
1195026412 X:100882135-100882157 CTCATTCTGCAGCTAGGCTTGGG + Intergenic
1195861800 X:109391012-109391034 CTCATTCTCCAGCTCTACTTTGG + Intronic
1198889631 X:141378575-141378597 CTCCTTCTGCAGCTCCTCTTAGG - Intergenic
1199701921 X:150385975-150385997 CTCATGGTCCAGCACTAGTTAGG + Intronic
1200064055 X:153496388-153496410 CTCATACACCAGCTCTCCTGGGG - Intronic
1202370317 Y:24191717-24191739 CTCCTGCTGCAGCTCTACTCTGG - Intergenic
1202500467 Y:25478400-25478422 CTCCTGCTGCAGCTCTACTCTGG + Intergenic