ID: 1195864834

View in Genome Browser
Species Human (GRCh38)
Location X:109420182-109420204
Sequence CTTGTCTAGTCCAAGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195864834 Original CRISPR CTTGTCTAGTCCAAGATTCT GGG (reversed) Intronic
901298824 1:8183425-8183447 CATCTCTAGCCCAAGGTTCTGGG - Intergenic
901739389 1:11332289-11332311 CTTGTGTAGTCCCAGCTACTTGG + Intergenic
902430103 1:16356242-16356264 CTTGCATAGTCCCAGATACTTGG + Intronic
904512501 1:31024090-31024112 CTTTTCAGGTCTAAGATTCTGGG - Intronic
907359005 1:53899799-53899821 CATGTCTAGTCCCAGCTACTTGG - Intronic
907414475 1:54304693-54304715 CTTGTCTAGCAAAACATTCTGGG - Intronic
908706076 1:66956293-66956315 CATGTATAGTCCCAGATACTTGG + Intronic
912151162 1:106860461-106860483 GTTATGTGGTCCAAGATTCTTGG - Intergenic
915254595 1:154616677-154616699 CTTGTATAGCCCTAGCTTCTTGG - Intronic
916377032 1:164166353-164166375 CTTATCTTGTCCCAGTTTCTAGG - Intergenic
918708861 1:187703369-187703391 CTTGTAGAATCCAAGAGTCTAGG + Intergenic
918886400 1:190199603-190199625 CTTGTGTAGTCTAAGGTTATTGG + Intronic
920936052 1:210436019-210436041 CTGGTCTGGGCAAAGATTCTAGG - Intronic
922310226 1:224381628-224381650 CGTGTCTAGTCCCAGCTACTTGG + Intergenic
1063317991 10:5025075-5025097 CTTGTGTGGTCCAAGGCTCTTGG + Intronic
1066563520 10:36695354-36695376 CTTGCCTAGTCCAAGATCCTAGG - Intergenic
1068135404 10:52947917-52947939 CTAGACTAGCCCAAGATTGTTGG - Intergenic
1068274723 10:54779126-54779148 CTTTTCTAAGGCAAGATTCTAGG + Intronic
1069633711 10:69912934-69912956 CTGTTCTGGTCCAAGATTCCAGG - Intronic
1071943799 10:90617668-90617690 ATTGTGAAGTGCAAGATTCTTGG - Intergenic
1072623078 10:97093374-97093396 CTTGGCTACTCCAAGATGCAAGG - Intronic
1072940667 10:99760757-99760779 CTCGGCTAATCCAATATTCTTGG + Intergenic
1074757965 10:116641072-116641094 CTTGTCTAGTCCCAGTTCTTAGG + Intronic
1075487880 10:122840851-122840873 CTGGTCTAGTTCCAGTTTCTTGG - Intronic
1081032311 11:38099237-38099259 CATCTTTAGTCCCAGATTCTTGG + Intergenic
1081095352 11:38926074-38926096 CTTTTGTAGTCCCAGATACTCGG + Intergenic
1086609921 11:88743334-88743356 TTTTACTAGTACAAGATTCTAGG + Intronic
1089097538 11:115931604-115931626 CTTGTCTCTTTCCAGATTCTAGG + Intergenic
1089343355 11:117774562-117774584 GTAGTCTGGTCCTAGATTCTAGG + Intronic
1089901241 11:121988049-121988071 CTTGTTTAGTCCAACATCCCCGG - Intergenic
1092684000 12:11020060-11020082 TTTGGCTAGTCCACAATTCTAGG - Intronic
1093097251 12:14985530-14985552 CTTGTCCAGCCCTATATTCTTGG - Intergenic
1093796443 12:23318631-23318653 CTTGTCTTGTTCCAGATTTTAGG - Intergenic
1096775650 12:53961861-53961883 CTTGTCGAGGCCCAGTTTCTTGG - Intergenic
1098089073 12:66881719-66881741 CTTGCCTAGTCCAAGGGTCCTGG - Intergenic
1099322344 12:81166161-81166183 GTTGTGTAGTCCAAGATACGTGG + Intronic
1099504164 12:83451427-83451449 ATTGTCTAGTTCAGCATTCTTGG - Intergenic
1101011488 12:100455120-100455142 TTGGTCTTCTCCAAGATTCTCGG - Intergenic
1102735654 12:115156978-115157000 TTTGTCTTGTGGAAGATTCTAGG + Intergenic
1104369543 12:128211551-128211573 CTTGTTTCTTCCAAGCTTCTTGG + Intergenic
1111696067 13:91626128-91626150 CTTTTCTATTCTAAGATTTTAGG - Intronic
1111987114 13:95076883-95076905 CATGTCTAGTCCCAGCTACTTGG - Intronic
1113062162 13:106334110-106334132 CTGGTCCAGTGCAAGAGTCTGGG - Intergenic
1113862764 13:113500594-113500616 TTTGTCTAGACCAAGTTCCTGGG - Intronic
1114782908 14:25559545-25559567 CTTCTCTAGCTTAAGATTCTTGG - Intergenic
1115536348 14:34376751-34376773 CTTCTCTATTCCAAAATACTTGG - Intronic
1117139342 14:52771365-52771387 CTTTGCAAGTCCAAAATTCTTGG - Exonic
1126929327 15:53630679-53630701 CTTTTCTATTCCTAGTTTCTTGG - Intronic
1127561133 15:60137324-60137346 CTCGTCTTGTTCAAGATTATTGG - Intergenic
1128257141 15:66205316-66205338 CCTGGATAGTCCAAGATACTTGG + Intronic
1128976023 15:72154153-72154175 CTTGTGTATTGAAAGATTCTGGG - Intergenic
1129924722 15:79353925-79353947 ATTGTCTAGACAAGGATTCTAGG - Intronic
1130012131 15:80160191-80160213 CTTGTCTAGTCCCATTTCCTAGG + Intronic
1132383432 15:101382553-101382575 CTTGTCTGGTCTTAGATTCAGGG - Intronic
1133577758 16:7110232-7110254 CTCGTGTAGTCCCAGCTTCTCGG + Intronic
1133828130 16:9297207-9297229 ATTGTCTGGTCACAGATTCTAGG + Intergenic
1137070231 16:35898573-35898595 CTAAACTAGTCCAAGATTGTTGG - Intergenic
1141782888 16:86176205-86176227 CTTGACTACTCCAAGATGCAGGG - Intergenic
1146417747 17:32652715-32652737 CTTGTCTGGTGCAGGATACTTGG - Intronic
1146683366 17:34824364-34824386 CTTGTCTAGTACCAGACTCAGGG + Intergenic
1147174124 17:38641374-38641396 CTTGTATAGTCCCAGCTACTTGG - Intergenic
1147647805 17:42044183-42044205 CATGTCTAGTCCCAGCTACTGGG + Intronic
1149268087 17:54949405-54949427 CTTGTCCAGTTCAAAGTTCTTGG + Intronic
1149346842 17:55747173-55747195 ATTGTCTACTAAAAGATTCTTGG - Intergenic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1155582633 18:27327248-27327270 CTTTTCTTGATCAAGATTCTTGG - Intergenic
1158154893 18:54414611-54414633 CTTGTATAGTCCCAGCTACTTGG + Intergenic
1163291248 19:16380925-16380947 CTTGTGTAGTCCTAGAGTCGAGG + Intronic
1163566198 19:18052657-18052679 CTTGTATAGTCCCAGCTACTGGG + Intergenic
1166332277 19:42085892-42085914 GTTGTCTAGTCCTAGCTACTTGG - Intergenic
927327037 2:21816907-21816929 ATTGACTATTCCAAAATTCTAGG - Intergenic
928632817 2:33211437-33211459 CTTGTCCAATCCCAGATACTGGG - Intronic
930284696 2:49413321-49413343 ATTATCTAGTCCATGGTTCTTGG + Intergenic
930702051 2:54468179-54468201 CTTCTCTAGTCCCAGCTACTTGG + Intronic
931144662 2:59504229-59504251 CTTCTCTATTCCATGAATCTGGG + Intergenic
931504987 2:62916058-62916080 CATGTGTAGTCCCAGATACTTGG + Intronic
933520205 2:83362270-83362292 CTAGTCTAGTCCATGATCATCGG + Intergenic
934061524 2:88298564-88298586 GTTGCCTAGTCCAACAATCTTGG + Intergenic
938161502 2:128988527-128988549 CTTGGCTAGTGCAGGGTTCTTGG + Intergenic
939447536 2:142329493-142329515 CTTCTTTTGTCCAAGATACTTGG - Intergenic
941069119 2:160936638-160936660 CTTGTTTTGACCAAGAGTCTGGG + Intergenic
941224103 2:162823652-162823674 CTTTTTTAGTCCATGTTTCTTGG + Intronic
942351768 2:175060062-175060084 CATGTGTAGTCCCAGCTTCTTGG - Intergenic
942960475 2:181824478-181824500 CTGGTCTAGGCCAAGAATTTAGG - Intergenic
944075352 2:195723524-195723546 CTGGTGGAGTCCAAGACTCTGGG - Intronic
948100034 2:235365960-235365982 TTTGTATTGTCCAAGAATCTTGG - Intergenic
948352061 2:237348971-237348993 CCTGTCAATTCTAAGATTCTTGG - Intronic
1172024921 20:31941971-31941993 CTTGTCCAGTGCAAACTTCTTGG - Intronic
1173468701 20:43305498-43305520 TTTGTCTAATCCTAGACTCTTGG + Intergenic
1173742275 20:45409126-45409148 CATCTCTAATCCAAAATTCTGGG + Intronic
1179006704 21:37521705-37521727 GTTGTCTTCTCCTAGATTCTAGG - Intergenic
1179090961 21:38265400-38265422 CATGTCTAGTCCAATATCCTGGG + Intronic
1180941946 22:19665470-19665492 CTTGTTAAGTCCAAGAACCTAGG - Intergenic
1181363997 22:22359846-22359868 CATGCCTAGTCCCAGATTTTGGG + Intergenic
949151409 3:772405-772427 CTTGTCTCTCCCAAGCTTCTTGG + Intergenic
950423702 3:12913461-12913483 CTGGTGTAGTCCGAGTTTCTGGG + Exonic
952886397 3:38014439-38014461 TTTGCCTAATCCAAAATTCTGGG - Intronic
954204351 3:49047100-49047122 CTTCTCTAGTTCAGCATTCTTGG + Exonic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
956261325 3:67345454-67345476 CATGTCTATTCCTAGATTTTTGG - Intergenic
956333561 3:68138426-68138448 TATGTTTAGTCAAAGATTCTGGG + Intronic
959064177 3:101640478-101640500 CTAGACTAGCCCAAGATTGTTGG + Intergenic
959234724 3:103705495-103705517 CTTGTCCAGTTCAATATTTTAGG - Intergenic
963762881 3:149302145-149302167 TTTGCCCAGTCCAATATTCTGGG + Intergenic
964217906 3:154308810-154308832 TTTGTCAAGTCCAAAATTTTGGG - Intronic
967625323 3:191676955-191676977 CTTGTGTAGTCCCAGCTACTTGG - Intergenic
967851203 3:194083892-194083914 CTGGTCTAGTTCAAGATGGTTGG - Intergenic
975373644 4:73616872-73616894 CTTCTCTACTCCAAGGTTCCAGG - Intronic
978253066 4:106656772-106656794 CTGGTGTAGTCCACTATTCTAGG + Intergenic
979864468 4:125736661-125736683 ACTGTTTAGTCCAATATTCTAGG - Intergenic
980553762 4:134375041-134375063 CTTGTCAAATCCAAATTTCTTGG + Intergenic
982678403 4:158402109-158402131 CTTGACTAGTCCAGGAATTTGGG + Intronic
982685874 4:158488391-158488413 CTTGCCTAAGCCAAGAATCTGGG - Intronic
982800618 4:159702237-159702259 TTTGTCTAGTCTGGGATTCTGGG + Intergenic
987403992 5:17506720-17506742 CCTGTCTAGGCCAGGAATCTTGG - Intergenic
990303075 5:54468334-54468356 CATGTCTAATCCAAGCTACTAGG - Intergenic
990564187 5:57012448-57012470 CTTATATAGGCCAAGAATCTTGG - Intergenic
996467353 5:123818757-123818779 CTTGTCTAGACCAGGAATTTTGG + Intergenic
996657602 5:125960172-125960194 CTGGTGTAGTCCAAGAGTCCAGG + Intergenic
999073177 5:148769560-148769582 ATTGTCTAGTCCAACATCCTGGG - Intergenic
999658770 5:153836318-153836340 CTTGTGTAGTACAAGAGTCCTGG + Intergenic
999689910 5:154137961-154137983 CTTTCCTGCTCCAAGATTCTAGG - Intronic
1000153430 5:158526722-158526744 CTTGGCTTGACCAAAATTCTAGG + Intergenic
1001826119 5:174746438-174746460 TCTGTCTAGTCCAACTTTCTTGG + Intergenic
1003623526 6:7723386-7723408 CTTGTCTACTCCCTGCTTCTGGG - Intergenic
1004646747 6:17569606-17569628 CTTGTCTTGTCTCAGATTTTTGG - Intergenic
1006039223 6:31239953-31239975 TTGGTCTAGTCCAGTATTCTGGG - Intergenic
1008878035 6:56350766-56350788 CTTCTCTAGTCCAAGGCCCTAGG - Intronic
1009698465 6:67142425-67142447 CTTGTCTCCTCCTAGATCCTGGG - Intergenic
1011941794 6:92851457-92851479 CTTGAGTAGACCAACATTCTTGG - Intergenic
1013177885 6:107692840-107692862 CTTGTCTAGTCCAACTCCCTGGG + Intergenic
1016657039 6:146531209-146531231 CTTGGTTAGTCCAAGGTACTCGG + Intergenic
1028874482 7:95805568-95805590 CTTATAGAATCCAAGATTCTAGG - Intronic
1032150615 7:129426512-129426534 CTTGTTGAGTCCCAGATACTTGG - Exonic
1034134258 7:148751199-148751221 CCTGGCTGGTCCAAAATTCTTGG - Intronic
1037659318 8:20913475-20913497 CTGTTCTGTTCCAAGATTCTTGG - Intergenic
1041467703 8:58173676-58173698 CTAGTCTGGTGCAAGATTCTTGG - Intronic
1046472926 8:114702576-114702598 CTTCTGTAGTCCCAGCTTCTCGG + Intergenic
1046515858 8:115259640-115259662 CTTGTCTACTACATGTTTCTTGG + Intergenic
1047648256 8:126891721-126891743 CTTGTCTAGGCCAGAAGTCTGGG - Intergenic
1048874462 8:138826383-138826405 CTTGGCTAGACCAAGTGTCTTGG + Intronic
1050943697 9:11491148-11491170 TTTATCTAGTCAAAGATGCTTGG - Intergenic
1052080466 9:24199877-24199899 CTTGTCTTGTTCATGATTTTAGG + Intergenic
1056122522 9:83503590-83503612 GGTGTCTAGACCAGGATTCTGGG - Intronic
1056252696 9:84766420-84766442 CTTGTCTTATCCAAGGTACTTGG + Intronic
1061310036 9:129756088-129756110 TGTGTCTGGTCCACGATTCTGGG - Intergenic
1186309538 X:8302694-8302716 TTTGGCTATTCCAAGCTTCTCGG + Intergenic
1189300232 X:39947202-39947224 CTTGTCTATTCCAAGCTGCCGGG - Intergenic
1189606210 X:42680856-42680878 CTTGGCTAGTCCAAGGCTATGGG + Intergenic
1189981783 X:46518481-46518503 CTTCTGTAGTCCAAGCTACTTGG + Intronic
1195864834 X:109420182-109420204 CTTGTCTAGTCCAAGATTCTGGG - Intronic
1196256935 X:113531243-113531265 CTTGTTTTGTGCAAGATTCTTGG + Intergenic
1197339453 X:125248114-125248136 CAAGGCTAGTCCAAGATTCAAGG + Intergenic
1198328852 X:135602539-135602561 CTTGTCTTGTGCAAGTTTCAAGG + Intergenic
1198337644 X:135682716-135682738 CTTGTCTTGTGCAAGTTTCAAGG - Intergenic
1198507755 X:137318223-137318245 CTTTTACAGACCAAGATTCTGGG - Intergenic
1199884053 X:152001529-152001551 TTTGTCTACCCCAAGATTATGGG + Intergenic