ID: 1195868919

View in Genome Browser
Species Human (GRCh38)
Location X:109465199-109465221
Sequence TTGATAGAAGGTCTTTTCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195868913_1195868919 23 Left 1195868913 X:109465153-109465175 CCAGCTTCTCAGGAATTTCACCT 0: 1
1: 0
2: 0
3: 17
4: 287
Right 1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1195868916_1195868919 -10 Left 1195868916 X:109465186-109465208 CCTCTGTGAAGGCTTGATAGAAG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 231
1195868914_1195868919 3 Left 1195868914 X:109465173-109465195 CCTCTTGCTGCTGCCTCTGTGAA 0: 1
1: 0
2: 1
3: 43
4: 370
Right 1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG 0: 1
1: 0
2: 0
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195868919 Original CRISPR TTGATAGAAGGTCTTTTCTT GGG Exonic
901545050 1:9949975-9949997 TTGATAGGAGATCTTTATTTGGG + Intronic
902192567 1:14773841-14773863 TGGAAAGATGGTGTTTTCTTTGG - Intronic
905767773 1:40616381-40616403 TTGATATAATGTCTATTCTTAGG + Intergenic
908171691 1:61511440-61511462 TTGAGAGAAGGGCAATTCTTGGG - Intergenic
908203968 1:61826015-61826037 TTGATGAAAGGTTTTTCCTTGGG - Intronic
909410668 1:75347104-75347126 TTAATAGAAAGTCTTTTACTTGG - Intronic
909586691 1:77298087-77298109 TTGGCAGAAGGTCATTTCTTTGG + Intronic
910865577 1:91785361-91785383 TAGATACAAGGTTTCTTCTTAGG + Intronic
911240636 1:95462004-95462026 AGGATAGAAGGTCTTTTCTCAGG + Intergenic
911426513 1:97720984-97721006 TTGGAAGCAGGTCTTTTATTTGG - Intronic
911999128 1:104808213-104808235 TTGAATGAAAGTCTTTTATTAGG - Intergenic
912033642 1:105282864-105282886 TAGAGAGAAGGTCTGTTGTTTGG - Intergenic
917581559 1:176383732-176383754 TTGATTGTGGGTCTTTTCATAGG + Intergenic
919602915 1:199644777-199644799 TGGATAGAAATTCTTTTTTTTGG - Intergenic
921277402 1:213533374-213533396 TTGATGGAAGGTCTTTCATGTGG + Intergenic
921460696 1:215423146-215423168 ATGATGAAAGGGCTTTTCTTAGG - Intergenic
1063532651 10:6849690-6849712 TTCTTAGAAGGGCTTTTTTTTGG + Intergenic
1063607192 10:7533112-7533134 TTCATAGAAGGTTCTTTGTTGGG + Intergenic
1066625961 10:37405740-37405762 TTTATAGAAGTTCTTTTCAGAGG + Intergenic
1069110717 10:64442521-64442543 TTGATAGAAACTGATTTCTTGGG - Intergenic
1069335583 10:67345930-67345952 TTGAATGAAGGTGTTTTCTCTGG + Intronic
1071034642 10:81230363-81230385 TTGATAGCAGGTATTTTTTTTGG - Intergenic
1072376563 10:94822553-94822575 TTGATAGAATGAATTTTTTTGGG + Intronic
1075867194 10:125734050-125734072 TTGATATAAACTCTTTTTTTAGG + Exonic
1076328444 10:129646440-129646462 GGGATAAAAGGTCTTTTATTTGG - Intronic
1078030627 11:7747449-7747471 TTATTAGAAGCTCTTTTCTGAGG - Intergenic
1078603620 11:12755762-12755784 TTGGTATCAGGTCTTTGCTTTGG + Intronic
1079295233 11:19227175-19227197 TTGTTAATAGGTCTTTTCCTTGG + Intronic
1080368175 11:31602282-31602304 TTTAAACAAGGTCTGTTCTTTGG - Intronic
1082018039 11:47506973-47506995 GTGACAGAGGGGCTTTTCTTTGG - Intronic
1083559185 11:63658665-63658687 TTGATAAAAGGTTTTTAATTGGG + Intronic
1084141564 11:67234478-67234500 GTGATAAAAGGGCTTTTTTTAGG + Intronic
1084742246 11:71147222-71147244 GTCATAGATGGTCTCTTCTTTGG + Intronic
1085041593 11:73329824-73329846 TTGTTTGTAGGTCATTTCTTAGG + Intronic
1085968605 11:81559366-81559388 TTGGTTGAAGGTGTTCTCTTGGG - Intergenic
1087154969 11:94893606-94893628 TTCATAGATTTTCTTTTCTTTGG + Intergenic
1087272662 11:96127276-96127298 TTAAAAGAAAGTCTTTTCTCTGG + Intronic
1087642007 11:100765015-100765037 TTGAAAAAAGGCCTTTTTTTTGG + Intronic
1089074688 11:115728746-115728768 TTAATAGATGGTCTTTTGTCTGG + Intergenic
1089475298 11:118755355-118755377 TTGGTAGAAGTTCTTTTTTGAGG - Intronic
1089841095 11:121418324-121418346 TTTTTAGAACATCTTTTCTTTGG + Intergenic
1090591592 11:128276194-128276216 TTCATAGAAATTCTTTTGTTAGG - Intergenic
1092646760 12:10582995-10583017 ATGATAGAATTTCTTTTCTATGG + Intergenic
1093170746 12:15857621-15857643 TTGAGAGAGGTTCTTTTCCTGGG + Intronic
1096399315 12:51291883-51291905 TGGATAGAGGCTCTCTTCTTTGG + Exonic
1097620925 12:61938566-61938588 TTGATACAATGACTTTTCTTTGG - Intronic
1098016922 12:66114933-66114955 TTGTTATAAATTCTTTTCTTTGG - Intergenic
1099101289 12:78443990-78444012 TTGGTAAAAGGTGTTTTATTGGG - Intergenic
1099222038 12:79926557-79926579 TTGATATAAGCTTTTTTATTAGG + Intronic
1099759067 12:86894202-86894224 TTGATGGAAGGTTTTGTATTAGG - Intergenic
1102679029 12:114677863-114677885 TTCAAAGAAATTCTTTTCTTTGG + Intronic
1104415464 12:128593996-128594018 TTGAGAGCAGGTCTTATGTTGGG - Intronic
1106826400 13:33526255-33526277 TTGTTAGCTGGTGTTTTCTTTGG + Intergenic
1107242274 13:38250782-38250804 TTGATAAAAAGTCCTTCCTTTGG - Intergenic
1107904339 13:45048294-45048316 TCGACAGAAGGCCTTTTCATAGG + Intergenic
1107921608 13:45214357-45214379 TCGACTGAAGGTCATTTCTTGGG - Intronic
1108312157 13:49204702-49204724 TTGTTTGAATGACTTTTCTTGGG + Intronic
1108402381 13:50059267-50059289 TTTTTAGAAGCTCTTTTCTTTGG - Intergenic
1109600530 13:64622067-64622089 TGGAAAGAATGTCTTATCTTAGG - Intergenic
1111034328 13:82651750-82651772 TTGATAGAAAGTGTTTTCAATGG + Intergenic
1111116196 13:83780451-83780473 CTGATAGCAGGTTTTTTATTTGG - Intergenic
1111361417 13:87182924-87182946 TTGTTAGGATCTCTTTTCTTTGG - Intergenic
1111684679 13:91487471-91487493 GGGATAGAAGGTTTTCTCTTTGG + Intronic
1112552946 13:100438730-100438752 TTGGTAAAGGGTGTTTTCTTGGG - Intronic
1113391348 13:109900370-109900392 TGGATAGAATTTCTTTTCCTAGG - Intergenic
1115389008 14:32832692-32832714 TTGTTAGAAAGTTCTTTCTTAGG + Exonic
1116203044 14:41824569-41824591 TTGTTAGCAGGTTTTTTATTGGG + Intronic
1116542933 14:46121476-46121498 TTGAATGAAGATGTTTTCTTTGG + Intergenic
1116815292 14:49578212-49578234 TTGATGGTAAGTTTTTTCTTAGG - Intronic
1117659998 14:57993488-57993510 TTAGTAGAAGGTGGTTTCTTTGG - Intergenic
1123845647 15:24298456-24298478 TTTATAGAAGGTCTGTCCATAGG - Intergenic
1123864683 15:24506165-24506187 TTTATAGAAGGTCTGTCCATAGG - Intergenic
1125162751 15:36665101-36665123 TTGATAAAAAGTCGTATCTTTGG + Intronic
1126206056 15:46046178-46046200 TTGGTAGAATGATTTTTCTTTGG + Intergenic
1130046263 15:80447516-80447538 TTGATACCAGGCCTTGTCTTTGG + Intronic
1132124000 15:99204169-99204191 TTGATAGAAGGCATTTTAATCGG + Intronic
1133082921 16:3337880-3337902 TTCATTGAATGTGTTTTCTTAGG + Intergenic
1135714730 16:24752701-24752723 TTCTTAGAAGCTCTTTTCATTGG - Intronic
1136648531 16:31644812-31644834 TTGATTGACAGTTTTTTCTTTGG + Intergenic
1137849817 16:51730565-51730587 TAGATAAAAGTTCTTTTCTCAGG + Intergenic
1141208618 16:81955707-81955729 TTGGTAGAGTTTCTTTTCTTGGG - Intronic
1145414767 17:22705409-22705431 TTGCTTGAAGGTCTTCTCTCTGG - Intergenic
1147628456 17:41915084-41915106 TGGAAAAATGGTCTTTTCTTGGG - Intronic
1147640228 17:41993111-41993133 TTGACTGATGGTCTTTTATTTGG - Intronic
1150770203 17:68034775-68034797 ATAAGAGAATGTCTTTTCTTAGG + Intergenic
1151091484 17:71444919-71444941 TTGATATTAAGTCTTTTCTTTGG + Intergenic
1154408958 18:14125188-14125210 ATGATTGGTGGTCTTTTCTTTGG - Intronic
1155433200 18:25783486-25783508 TTATTAGAGAGTCTTTTCTTTGG - Intergenic
1155626709 18:27843358-27843380 TTGCTAGAATTACTTTTCTTTGG - Intergenic
1156356599 18:36347401-36347423 TTGATAGAGGCTCTTGCCTTTGG + Intronic
1161436250 19:4265134-4265156 TTGATAGCAGGTGTTTTATTTGG + Intronic
1161905385 19:7152654-7152676 TTGGTGGAAGGTCATTACTTAGG - Intronic
1167452379 19:49579304-49579326 TTTATAGAAGGTCATTGGTTTGG + Intronic
927356619 2:22181038-22181060 TTTAAAAATGGTCTTTTCTTAGG - Intergenic
927882192 2:26696652-26696674 GTAATAGAAAGTCATTTCTTAGG + Intronic
930719659 2:54626886-54626908 ATGATAGCAGGTCTCTTCCTGGG - Intronic
930931067 2:56884192-56884214 TAGATATAAGGTTTTTGCTTTGG - Intergenic
930951715 2:57150576-57150598 TTGATAGAAGTTTTCTTTTTTGG - Intergenic
933380772 2:81541158-81541180 TTGACAGACAGTCTTTGCTTAGG + Intergenic
933414688 2:81970926-81970948 TTTATAGAAAGTGTTTTTTTAGG + Intergenic
935298073 2:101667849-101667871 ATATTTGAAGGTCTTTTCTTAGG + Intergenic
936881877 2:117262810-117262832 TAGATAGAAAGTCTATTATTAGG + Intergenic
939136046 2:138295266-138295288 ATGTTAAAAGTTCTTTTCTTAGG + Intergenic
939221164 2:139302896-139302918 TTGGTATAAGCTCATTTCTTTGG + Intergenic
940349527 2:152666414-152666436 TTAAGAGAAAGGCTTTTCTTGGG - Intronic
940888216 2:159009415-159009437 ATGATAGAATGTCTTTTTTATGG - Intronic
941066525 2:160909292-160909314 TTATTATAATGTCTTTTCTTGGG + Intergenic
941424789 2:165329041-165329063 TTGACATAATCTCTTTTCTTGGG + Intronic
941740545 2:169030391-169030413 TTAATAGAAGTTCTTTTCTGTGG - Intronic
941841716 2:170092239-170092261 TTGATAGGAGTTCTTTATTTTGG - Intergenic
943486002 2:188482834-188482856 CTGATTGAAGGTCTTCTCTCAGG - Intronic
943978567 2:194515050-194515072 TTGATAAAATCTCTTTTCTATGG - Intergenic
945141734 2:206693758-206693780 TTGGTAGAAGTTCTTAACTTGGG - Intronic
945823908 2:214697473-214697495 TTCATAGATTTTCTTTTCTTTGG - Intergenic
1171293836 20:23999192-23999214 TTGAAAGAAGGACTTTTGCTTGG + Intergenic
1174315674 20:49698979-49699001 TTGATAGGTGGTTTTTGCTTAGG - Intronic
1174976063 20:55336103-55336125 TTGTAAGAAGGTCTTTTGTATGG + Intergenic
1176864250 21:14034700-14034722 ATGATTGGTGGTCTTTTCTTTGG + Intergenic
1177490736 21:21822782-21822804 TTGATAGAACTATTTTTCTTTGG + Intergenic
1178629299 21:34245321-34245343 AGGATAAAAGGTCTTTACTTGGG - Intergenic
1179151331 21:38811050-38811072 TTAATAGAAGGATTTTTCTAAGG - Intronic
1180569016 22:16698803-16698825 ATGAGTGAATGTCTTTTCTTAGG - Intergenic
951131078 3:19045513-19045535 TTGATAGAATGTTTCTTCTTTGG - Intergenic
951187647 3:19732893-19732915 TTGGTAGAAGATCGTTTATTTGG - Intergenic
951917199 3:27814318-27814340 TTGTTAGAAGGGCTTTTGTTTGG - Intergenic
952431756 3:33230404-33230426 TTGATAAAAGGTAGTTTCATAGG + Intergenic
953711116 3:45272067-45272089 TGAAAACAAGGTCTTTTCTTTGG + Intergenic
954347245 3:50010431-50010453 TTGATACAGGGTCTCTTTTTTGG + Intronic
955071797 3:55577896-55577918 TTGAGAGAAGGGCTTTGCTGAGG + Intronic
956330858 3:68106055-68106077 TAGATAGAAGGGCTTTCTTTTGG - Intronic
957192286 3:77024996-77025018 AGGACAGAAGGTCTGTTCTTTGG + Intronic
958067797 3:88566593-88566615 TTGTTTGTAGGTCTTTTCATGGG - Intergenic
959067022 3:101667871-101667893 TTGATATAATTTCTTTTCTTTGG - Intronic
959370849 3:105523173-105523195 TTTATGGCAGGTGTTTTCTTTGG - Intronic
959764179 3:110004601-110004623 TTAATAGAAGGGTTTATCTTTGG - Intergenic
961286782 3:125812280-125812302 TTCATAGATTTTCTTTTCTTTGG + Intergenic
961844890 3:129753965-129753987 TTGTTAGTGGGTCTTTTGTTTGG - Intronic
962022688 3:131516620-131516642 TTGATATAATGGCTTCTCTTGGG - Intergenic
962023116 3:131520777-131520799 TTGAGAGAATGTGTGTTCTTTGG + Intergenic
964777736 3:160296707-160296729 TTGATAGAAAGGCTTTGCCTGGG + Intronic
964908001 3:161742253-161742275 TTGAAATAAGGTATTTTATTGGG + Intergenic
965928413 3:174011834-174011856 AGGAGAGAAGGTTTTTTCTTAGG - Intronic
967118938 3:186365549-186365571 TTGTTCGCAGGTCTTTTCTCTGG - Intergenic
968377842 4:58737-58759 TTGATTGCTGGTCTTGTCTTCGG + Intronic
970219183 4:13792124-13792146 TTGATAGTAATTCTTATCTTTGG + Intergenic
970686268 4:18571086-18571108 TTGATACAGGGTCTCCTCTTAGG + Intergenic
970850177 4:20592733-20592755 TTGATGGAAGTTCTCTTCTCGGG + Intronic
971075388 4:23142420-23142442 TTTATAGAAAGTTTTTTCTTTGG - Intergenic
972038039 4:34551531-34551553 TTGAGAGAATTTCTTGTCTTTGG - Intergenic
972223307 4:36981636-36981658 TAGATAGAAAGTCTTTGCATTGG - Intergenic
973083104 4:46019367-46019389 TAGATGGAAGGTGTTTTGTTTGG + Intergenic
973111623 4:46404422-46404444 TTGATAACAGGTCTTGTATTAGG - Intronic
974321996 4:60362622-60362644 TTGATAGAAGTACATTTCGTAGG + Intergenic
974880707 4:67753733-67753755 TTGATATAAGGTCTTATCAAAGG - Intronic
977069686 4:92369211-92369233 ATGATAGAAAGTCTATTATTAGG - Intronic
978008980 4:103654833-103654855 TTGAAAGATACTCTTTTCTTGGG - Intronic
978421164 4:108534179-108534201 TTTTTAGAATGTCTCTTCTTTGG + Intergenic
978483719 4:109225609-109225631 TTGATATAATTTCTTTTCTTTGG - Intronic
979007866 4:115325404-115325426 TTCATTGAAGGTCTATTATTTGG + Intergenic
979924443 4:126543111-126543133 ATGAAAGCAGGTCTTTTCCTGGG - Intergenic
980296734 4:130928828-130928850 TTTTTAAAATGTCTTTTCTTTGG + Intergenic
980538520 4:134162055-134162077 TTGTTACAAGGTTTTTGCTTTGG - Intergenic
980759516 4:137211746-137211768 ATGATAGAAGTTCTAGTCTTAGG - Intergenic
981394599 4:144233267-144233289 TTGATTGAGGGGCTTTTCTTTGG + Intergenic
981452773 4:144918510-144918532 TAGATAAAAAGTCTTTTCTGAGG - Intergenic
981780959 4:148428337-148428359 TTGGTAGAAAGTCTTTCCATTGG - Intronic
982432877 4:155342362-155342384 ATTATAGAATGTCTTTTGTTTGG - Intergenic
982981609 4:162144014-162144036 ATTATAGAAGCTCTTTACTTGGG - Intronic
983112696 4:163772702-163772724 TTTAAAGCAGGGCTTTTCTTTGG - Intronic
983404234 4:167305476-167305498 TTGATTGAAGGATTTTTCTCAGG - Intergenic
983655703 4:170081667-170081689 TAGATAGCAGCTTTTTTCTTTGG - Intronic
985919204 5:2956401-2956423 TTCATAGATTTTCTTTTCTTTGG + Intergenic
987312327 5:16692849-16692871 TTAATAAAAGCTCTATTCTTAGG - Intronic
989585626 5:43072140-43072162 TTTAGAGAATGTCTTTTTTTGGG + Intronic
991361264 5:65823090-65823112 TTTCTAGTGGGTCTTTTCTTAGG - Exonic
991444022 5:66680800-66680822 TTGATAAAAGTTCTTTTTATGGG + Intronic
993014400 5:82519385-82519407 TTAATACTAGATCTTTTCTTTGG - Intergenic
994365149 5:98907212-98907234 TTGTTAGAATGTCTTTACCTTGG + Intronic
994886722 5:105573171-105573193 TATTTAGAAGGTCTTTTATTAGG + Intergenic
996485818 5:124032888-124032910 TTGTCAGTAGCTCTTTTCTTTGG - Intergenic
1003479623 6:6519108-6519130 TTGAAAGAAGTGCTTTTCCTTGG - Intergenic
1004314642 6:14575222-14575244 TTGATAGAACTCCATTTCTTTGG + Intergenic
1006209427 6:32382735-32382757 TTGATACATGGTCTTTAATTTGG - Intergenic
1006278808 6:33029655-33029677 TTCAAAGAAGCTCTTTTCCTGGG - Intergenic
1006322816 6:33330438-33330460 CTGATTGAAGACCTTTTCTTAGG + Intergenic
1009710590 6:67313188-67313210 TTAATTGAAAGTCTTGTCTTTGG + Intergenic
1010396351 6:75396839-75396861 TTCAAAGAAGGTCTTTGCTCAGG + Intronic
1011193214 6:84755406-84755428 TTCATTGAAGGACTTTTTTTTGG - Intronic
1013340750 6:109213425-109213447 TTTATAGATTGCCTTTTCTTTGG + Intergenic
1013651516 6:112199805-112199827 GAGATAGAGGGTGTTTTCTTTGG + Intronic
1014615133 6:123589019-123589041 TTCGTAAAAGGTCTTTTCATGGG - Intronic
1015341081 6:132101719-132101741 TTAATAGAAAGTCTTCCCTTTGG + Intergenic
1016660394 6:146570930-146570952 TTGGTAAATGTTCTTTTCTTTGG - Intergenic
1017186640 6:151608304-151608326 TTCATAGAGGTCCTTTTCTTTGG + Intronic
1017336100 6:153262115-153262137 TTAACAGAAGGGCCTTTCTTAGG + Intergenic
1019006119 6:168798155-168798177 TTGGGTGAATGTCTTTTCTTTGG - Intergenic
1019799701 7:3079200-3079222 TTGATATAGGGTCTTTTCTGAGG + Intergenic
1020473642 7:8568765-8568787 TTGATGGAGGGCTTTTTCTTTGG + Intronic
1020568479 7:9826328-9826350 TTGCTAGAAGGGCTCTTTTTTGG + Intergenic
1020846503 7:13291222-13291244 TTGATGGAATGTCTGTACTTAGG - Intergenic
1021615908 7:22503084-22503106 TAGAGAGGAGGTCTGTTCTTGGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022236100 7:28462032-28462054 TTGATACAAGGTTTCTTTTTGGG - Intronic
1023574401 7:41610435-41610457 TGCCTAGAATGTCTTTTCTTTGG + Intergenic
1028376564 7:90151258-90151280 TAGAGAGGAGGTCTGTTCTTGGG - Intergenic
1028532482 7:91852577-91852599 TTGACAGCAGGTTTTTTATTTGG - Intronic
1030744294 7:113146417-113146439 TTGATACAAGGTCTTTAATAAGG - Intergenic
1030899157 7:115100938-115100960 CTGATAAAAGTTCTTTCCTTTGG + Intergenic
1031530626 7:122871930-122871952 TTGCTAGACTCTCTTTTCTTGGG + Intronic
1032281221 7:130503506-130503528 TTTATAGAAAATATTTTCTTGGG + Intronic
1033004236 7:137543620-137543642 TTTACAGATGGTCTTTTCTTTGG - Intronic
1033175589 7:139120779-139120801 TTGAAAAAATGTCTTTTTTTCGG + Intergenic
1034727068 7:153346248-153346270 ATTATGGAAGGTCTTTTTTTTGG + Intergenic
1036288987 8:7470575-7470597 TTGGTAGAAGGTGTTTTCGGAGG + Intronic
1036332487 8:7840953-7840975 TTGGTAGAAGGTGTTTTCGGAGG - Intronic
1036588960 8:10150454-10150476 TTGATAAAAGGTAATTTGTTCGG - Intronic
1038975479 8:32691005-32691027 TTTATAGATTGTCTTTTCTTGGG - Intronic
1039334027 8:36570379-36570401 TTGATTTAATGTCTTCTCTTTGG - Intergenic
1040771037 8:50976157-50976179 TGGACTGAAGGTCTATTCTTTGG + Intergenic
1041480551 8:58315433-58315455 TTGATAACATGTCTTTTCATGGG - Intergenic
1043479955 8:80642939-80642961 TTTATAGAAGATCATTTCTCAGG + Intronic
1044158376 8:88879942-88879964 TGGATAGAAGCTATTTTATTAGG + Intergenic
1044801047 8:95956878-95956900 TTGATAGCATGTCTTTTGCTAGG - Intergenic
1045375635 8:101571263-101571285 TTAATAGCAGGTGTTTTCTAAGG + Intronic
1046091630 8:109510058-109510080 TTGATAGAGTGTTATTTCTTAGG + Intronic
1046484834 8:114874319-114874341 TTTATTGAAGATCTTTTCCTAGG + Intergenic
1049978357 9:881621-881643 TTGAGAGCAGATCTTTTCTGTGG + Intronic
1050173703 9:2848795-2848817 TTGATAAAAGTTATTTCCTTTGG + Intergenic
1050930935 9:11325551-11325573 TTTATTGAAGCTGTTTTCTTGGG + Intergenic
1052001347 9:23285452-23285474 GTGATAAAATGTCTCTTCTTTGG - Intergenic
1057957190 9:99420014-99420036 ATGATACATGGACTTTTCTTTGG - Intergenic
1059473486 9:114525052-114525074 TTTTTAGGAGGTCTGTTCTTGGG - Intergenic
1059588755 9:115634557-115634579 ATGGTAGAATGTCTTTTCTGTGG - Intergenic
1059709906 9:116858015-116858037 TGGATAGAGGATTTTTTCTTGGG - Intronic
1060041102 9:120302296-120302318 TTGTTAGACTGTGTTTTCTTAGG - Intergenic
1203571396 Un_KI270744v1:135510-135532 TTGATTGCTGGTCTTGTCTTCGG - Intergenic
1186691314 X:11978755-11978777 TTAAAAGATGTTCTTTTCTTTGG - Intergenic
1186974849 X:14890994-14891016 TTTATGGAAGGCCTTTTCATTGG + Intronic
1189254273 X:39625440-39625462 ATGATAGAAGGTATTTTCTATGG - Intergenic
1189481328 X:41394379-41394401 TTGGTAAAAGGTTTTTTGTTTGG - Intergenic
1190689512 X:52901707-52901729 TTGATACAAGGTCTTTTACCTGG + Intronic
1190696471 X:52954085-52954107 TTGATACAAGGTCTTTTACCTGG - Intronic
1192405632 X:70883269-70883291 TTTATAGAAGTTCTTTTCATCGG - Intronic
1193006867 X:76628987-76629009 TTGATATAACATTTTTTCTTTGG - Intergenic
1193890606 X:87041409-87041431 TTGCTAAAAGGTCGTTGCTTGGG + Intergenic
1195747803 X:108136255-108136277 TAGAGAGAATGTGTTTTCTTTGG + Intronic
1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG + Exonic
1198417143 X:136431920-136431942 TTGAAAGAAGTTTTTTTCCTAGG - Intergenic
1198446559 X:136723172-136723194 TGGATAGAAGGTTTTTTGGTGGG + Intronic
1199789456 X:151138605-151138627 TTGAAAAAAGGTGTTTTTTTTGG + Intergenic
1200297652 X:154939014-154939036 TTGTTTGAAGGTCTTTGCATTGG + Intronic
1201696290 Y:16830598-16830620 TTTAAAGCAGGACTTTTCTTGGG - Intergenic