ID: 1195869333

View in Genome Browser
Species Human (GRCh38)
Location X:109469790-109469812
Sequence CTGTGTAAGAGGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 674}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195869320_1195869333 23 Left 1195869320 X:109469744-109469766 CCTACACTCTCCCTCTCAGTTTT 0: 1
1: 0
2: 2
3: 38
4: 453
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869325_1195869333 -3 Left 1195869325 X:109469770-109469792 CCACCCAGCCTAATAAATGGCTG 0: 1
1: 0
2: 2
3: 10
4: 122
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869321_1195869333 13 Left 1195869321 X:109469754-109469776 CCCTCTCAGTTTTCTCCCACCCA 0: 1
1: 0
2: 5
3: 43
4: 387
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869324_1195869333 -2 Left 1195869324 X:109469769-109469791 CCCACCCAGCCTAATAAATGGCT 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869326_1195869333 -6 Left 1195869326 X:109469773-109469795 CCCAGCCTAATAAATGGCTGTGT 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869327_1195869333 -7 Left 1195869327 X:109469774-109469796 CCAGCCTAATAAATGGCTGTGTA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674
1195869322_1195869333 12 Left 1195869322 X:109469755-109469777 CCTCTCAGTTTTCTCCCACCCAG 0: 1
1: 0
2: 2
3: 36
4: 284
Right 1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG 0: 1
1: 0
2: 5
3: 66
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195869333 Original CRISPR CTGTGTAAGAGGAAGGTGGG AGG Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900783372 1:4632147-4632169 CTTTGTAAGAGGCAGACGGGAGG - Intergenic
902439693 1:16421454-16421476 CTGTGTAGGAGAAAGGCAGGGGG - Intronic
902453387 1:16513787-16513809 CTGTGTAAGAGGTGACTGGGGGG + Intergenic
903050020 1:20593816-20593838 CTGTGTGAGGCCAAGGTGGGAGG - Intronic
903582406 1:24381526-24381548 AAGTGTATGAGGCAGGTGGGTGG - Intronic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
904614050 1:31740321-31740343 CTGCCTAGGAGGAAGGAGGGCGG - Intronic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
904766337 1:32851420-32851442 CTTTGAGAGAGCAAGGTGGGTGG + Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905893932 1:41533308-41533330 CTGTGGGAGAGGACAGTGGGTGG - Intronic
906221209 1:44080956-44080978 CTGTGGCAGACCAAGGTGGGTGG - Intergenic
906316155 1:44787488-44787510 TTGGGTTAGAGGGAGGTGGGTGG + Intronic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
906444240 1:45880735-45880757 CTGTGGGAGACCAAGGTGGGAGG + Intronic
908227215 1:62068036-62068058 CTGTGTAAGGCCGAGGTGGGTGG - Intronic
908357575 1:63337688-63337710 CTTTGGGAGAGCAAGGTGGGTGG + Intergenic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
909851413 1:80469406-80469428 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
912191600 1:107347268-107347290 CTTTGGAAGATCAAGGTGGGAGG + Intronic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914701856 1:150141617-150141639 ATGTATAGAAGGAAGGTGGGTGG - Intronic
917063479 1:171066305-171066327 CTTTATAAGAGGAATATGGGAGG + Intergenic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917170239 1:172164798-172164820 CAGTGTATGAGGAAGGTAGTGGG + Intronic
917271714 1:173282698-173282720 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
917352778 1:174095130-174095152 CTTTGGAAGACCAAGGTGGGAGG - Intergenic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917895991 1:179487749-179487771 CTTTGTAAGGCCAAGGTGGGAGG + Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921800744 1:219399571-219399593 CAGTGTAAGAGGGAGCAGGGGGG + Intergenic
923082310 1:230669913-230669935 CAGTGTACGAGGAAGGTGCAGGG + Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
924754948 1:246932094-246932116 CGGTGAAAGAAGGAGGTGGGAGG + Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063255257 10:4320671-4320693 CTGTGTTGGAGGAAGATGAGAGG - Intergenic
1064083860 10:12330235-12330257 CTGTGGGAGATCAAGGTGGGAGG - Intergenic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1064370800 10:14750366-14750388 CTTTGGGAGAGCAAGGTGGGTGG + Intronic
1064456110 10:15488831-15488853 CCGTTTCAGAGGCAGGTGGGAGG - Intergenic
1065466629 10:26031328-26031350 CAATGTTAGAGAAAGGTGGGTGG - Intronic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1069388289 10:67904600-67904622 CTTTGTGAGACCAAGGTGGGCGG + Intronic
1069498528 10:68929188-68929210 CTGTGGGAGACGGAGGTGGGTGG - Intronic
1069498601 10:68929665-68929687 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
1070447082 10:76515798-76515820 CTGTTTAAGAGGATGGGGGCTGG - Intronic
1070497973 10:77041755-77041777 ATGGGTAAGAGGAAGATGAGAGG + Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072956737 10:99893490-99893512 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074390404 10:113052835-113052857 ATGTCTAATAGAAAGGTGGGAGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075918868 10:126193020-126193042 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078480069 11:11667852-11667874 GTATGTAAGAGGTAGATGGGAGG + Intergenic
1079459243 11:20665575-20665597 ATGGGTTGGAGGAAGGTGGGAGG + Intergenic
1079619181 11:22532624-22532646 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1080204123 11:29709400-29709422 TTGTGTATGAGGACAGTGGGAGG - Intergenic
1080376506 11:31719013-31719035 CTTTGGGAGAGCAAGGTGGGAGG + Intronic
1080518200 11:33042609-33042631 ATGTTTAAGAGGAATGTGTGGGG - Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081632698 11:44700628-44700650 CTCTGTAAGAGGATGGTAGGAGG + Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083118909 11:60491718-60491740 CCGTCCAGGAGGAAGGTGGGGGG + Intergenic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1084022639 11:66426727-66426749 CTGTGTAAAAGGAAGGGTGGAGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085501409 11:77028348-77028370 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089968701 11:122674970-122674992 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090807348 11:130210660-130210682 CTTTGTCAGAGGAAGATGGGCGG + Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091758055 12:3068373-3068395 CAGTGTAAGAGGATGGTTGGTGG - Intergenic
1092036298 12:5338104-5338126 CTTTGGGAGAGCAAGGTGGGAGG + Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092710049 12:11326416-11326438 CTTTGGAAGAGTGAGGTGGGAGG - Intergenic
1092713806 12:11366910-11366932 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092717518 12:11406087-11406109 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092746552 12:11677900-11677922 CTGTGCCAGAGGACGCTGGGAGG - Intronic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093491412 12:19709313-19709335 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1095792757 12:46185445-46185467 CTGTAAAAAAGGAAAGTGGGTGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096632809 12:52939840-52939862 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097172596 12:57125937-57125959 CTTTGGGAGACGAAGGTGGGAGG - Intronic
1097648839 12:62269662-62269684 CTTTGGAAGACTAAGGTGGGAGG - Intronic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099461068 12:82921852-82921874 CTTTGCAAGATCAAGGTGGGAGG + Intronic
1099704855 12:86138928-86138950 CTGTGCAAGAGGATGTGGGGAGG + Intronic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1100146162 12:91680257-91680279 CTTTGTAAGACGAAGGCGGGCGG - Intergenic
1100620939 12:96272242-96272264 CTGTGGAAGAGCAAGATGGCAGG + Intergenic
1100936918 12:99680195-99680217 CTTTGGGAGACGAAGGTGGGTGG + Intronic
1100977830 12:100141064-100141086 CTGGGTATGAGAAAGGCGGGAGG + Intronic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1101183820 12:102251224-102251246 CCGTCCAAGAGGGAGGTGGGGGG - Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102845041 12:116171567-116171589 CATTGCAAGAGGAAGGTGGTTGG - Intronic
1102898700 12:116619421-116619443 CCTTGTAAGAGGGAGGAGGGAGG + Intergenic
1103061753 12:117863896-117863918 CTGTATAAGAGGGAAGTAGGAGG - Intronic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103999246 12:124849817-124849839 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1104988923 12:132613748-132613770 CTTTGGGAGAGCAAGGTGGGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105500293 13:20965895-20965917 CTGTGGGAGACCAAGGTGGGTGG - Intergenic
1106753354 13:32797039-32797061 CTGGGTAAGAGGAAGGCCTGGGG + Intergenic
1107212996 13:37880674-37880696 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1107829319 13:44360342-44360364 CTTTGGAAGACCAAGGTGGGAGG - Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108467548 13:50732136-50732158 CTGTGTTATAGAAACGTGGGTGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG + Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115518487 14:34209088-34209110 CTGTTTAAGAGGAAAGGAGGAGG + Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1117152452 14:52903292-52903314 CTTTGGGAGACGAAGGTGGGAGG + Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117401606 14:55363570-55363592 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1117461801 14:55952748-55952770 CTCTGTAATTGGAAGGAGGGAGG + Intergenic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1117702952 14:58433308-58433330 CTGTGGGAGACCAAGGTGGGCGG - Intronic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1118433560 14:65747746-65747768 CTCAGAAAGAGGAGGGTGGGAGG + Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1121970644 14:98352904-98352926 CTGTGTCAGAGGAATCTTGGGGG - Intergenic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123630474 15:22257290-22257312 CGGTGTAAGAGGGAGGTAGTGGG - Intergenic
1123711201 15:22989035-22989057 CAGTGTCAGAGAAAGGTGTGAGG - Intronic
1125558503 15:40607001-40607023 CTTTGGAAGACCAAGGTGGGTGG - Intronic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1127072936 15:55302966-55302988 CCGTCCAAGAGGGAGGTGGGGGG + Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1127667984 15:61167829-61167851 CTGTGTAGGAGAGTGGTGGGTGG - Intronic
1127691099 15:61398599-61398621 CTGAGGAAGAGAAAGGTTGGTGG + Intergenic
1127782865 15:62332258-62332280 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1127938257 15:63665288-63665310 CTTTGGAAGACCAAGGTGGGTGG + Intronic
1127965815 15:63922160-63922182 CAGTGAGATAGGAAGGTGGGTGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1129054069 15:72807087-72807109 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129996536 15:80011279-80011301 CTTTGGAAGACCAAGGTGGGCGG + Intergenic
1130308355 15:82730655-82730677 CTCTTGAAGAGTAAGGTGGGAGG + Intergenic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1132673378 16:1111640-1111662 CTTTGTAAGGCCAAGGTGGGTGG - Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1136547512 16:30964105-30964127 CTGTGTCAGAGGAAGAGCGGCGG - Exonic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1138085271 16:54127646-54127668 CTTTGGGAGAGCAAGGTGGGAGG - Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138605411 16:58085364-58085386 TTGTGTCAGAGGATGCTGGGCGG - Intergenic
1138642201 16:58396142-58396164 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
1139206745 16:65036418-65036440 CTGTGGAAGAGGAACATGGCAGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139921322 16:70462254-70462276 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140629808 16:76837723-76837745 CTTTGAGAGAGCAAGGTGGGAGG + Intergenic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141570571 16:84931183-84931205 CTTTCTAAGAGGGAGGTGAGGGG - Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1141972616 16:87493357-87493379 CGGTGTAAGAGGGAGGTAGTGGG + Intergenic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142275208 16:89114787-89114809 ATGTCTCAGAGGAAGGCGGGGGG + Intronic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142751604 17:1991987-1992009 GTGTGTACAAGGAAGGAGGGTGG - Intronic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143942486 17:10556959-10556981 CTCTGGAAGACCAAGGTGGGAGG + Intergenic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1145090654 17:19983133-19983155 CTTTGTAAGGCCAAGGTGGGTGG + Intergenic
1145095191 17:20019131-20019153 CTGTGGGAGACCAAGGTGGGAGG + Intronic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146191778 17:30774245-30774267 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1146454548 17:32998704-32998726 CTCTAAAGGAGGAAGGTGGGTGG + Intergenic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149925981 17:60702832-60702854 CTTTGGGAGATGAAGGTGGGCGG - Intronic
1150339613 17:64356023-64356045 CCTTGTAAGAGGGAGTTGGGGGG - Intronic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151720824 17:75855079-75855101 CGGGGTTGGAGGAAGGTGGGTGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1153073260 18:1131530-1131552 GTGTGTAGGAGGATGGAGGGAGG + Intergenic
1153186821 18:2495233-2495255 CTGTGTGAGAGAAAGTTGAGAGG - Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153451431 18:5234391-5234413 CTTTGGAAGACAAAGGTGGGAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154250881 18:12743697-12743719 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155621180 18:27782223-27782245 CTATGTAAGAGAAAGGTTGTTGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155961237 18:31996914-31996936 CTTTGGAAGACCAAGGTGGGCGG + Intergenic
1157195414 18:45616852-45616874 CTTTGAAAGACCAAGGTGGGCGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158050894 18:53218090-53218112 CTTTGTGAGACCAAGGTGGGAGG - Intronic
1159508814 18:69369370-69369392 GGGTATCAGAGGAAGGTGGGGGG + Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160705200 19:526313-526335 CCGTTTAAGAGGGCGGTGGGGGG - Intergenic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1161942222 19:7412496-7412518 CTTTGGGAGACGAAGGTGGGCGG + Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162748121 19:12810904-12810926 CTTTGAAAGACCAAGGTGGGAGG - Intronic
1163203962 19:15788738-15788760 CTGTGGGAGACCAAGGTGGGTGG - Intergenic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165333965 19:35156199-35156221 CTGTGTCAGAGGAGAATGGGTGG + Intronic
1165503300 19:36207298-36207320 CTTTGGAAGATCAAGGTGGGCGG + Intronic
1165710871 19:38009901-38009923 GTGGGTTGGAGGAAGGTGGGTGG + Intronic
1165901029 19:39169438-39169460 CGGTGTAAGATGAGGATGGGAGG + Intronic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1166259492 19:41627631-41627653 CTGTGGTGGAGGGAGGTGGGTGG + Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166499929 19:43332843-43332865 CTGTGGTGGAGGGAGGTGGGTGG + Intergenic
1166816055 19:45546910-45546932 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167586914 19:50380574-50380596 CGGAGTAAGAGGAAGGGGAGAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
1168498728 19:56875686-56875708 CTGAGTAGGAGTAAGGAGGGAGG + Intergenic
1168504790 19:56924352-56924374 CGGTGTTGGAGGAACGTGGGTGG - Intergenic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925519479 2:4726014-4726036 CTGTGTGTGAGGTTGGTGGGAGG + Intergenic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
928427640 2:31192259-31192281 AGGTGGAAGAGCAAGGTGGGAGG - Intronic
929188224 2:39117269-39117291 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929690091 2:44067029-44067051 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
931364494 2:61607014-61607036 CTGTGTAAAAAACAGGTGGGAGG - Intergenic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932905634 2:75747097-75747119 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934688441 2:96338602-96338624 CCTTGTAAGAGGAAGGTCGTCGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935782400 2:106519662-106519684 CTGTGTTACACGAAGGTGGACGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
937062552 2:118991369-118991391 CTTTGGGAGACGAAGGTGGGAGG - Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
940257895 2:151750451-151750473 CTGTGGGAGATCAAGGTGGGAGG + Intergenic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
941673507 2:168319966-168319988 CTTTGTGAGACCAAGGTGGGTGG + Intergenic
941815173 2:169788868-169788890 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
942407018 2:175667027-175667049 CAGTGTAGGAGGAGGTTGGGGGG - Intergenic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943045547 2:182857375-182857397 CTCTGTAAGGCCAAGGTGGGTGG + Intronic
944014572 2:195019732-195019754 TTGTGTAGGAGAAAGTTGGGGGG - Intergenic
944498443 2:200332488-200332510 CTGTGGGAGACCAAGGTGGGAGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
944721649 2:202428698-202428720 ATGTGTAAGAGAAAGGCTGGAGG - Intronic
944735367 2:202558073-202558095 CTGTGGAAGACTGAGGTGGGTGG + Intronic
944803167 2:203256210-203256232 CTTTGCGAGATGAAGGTGGGAGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
945683148 2:212937516-212937538 CCTTGTAAGAGGGAGGTGGGAGG + Intergenic
945990012 2:216388271-216388293 CTGACTAACAGGCAGGTGGGAGG - Intergenic
946037364 2:216754785-216754807 ATGTGTAGGAGGGAGGTGGCAGG + Intergenic
946354274 2:219175255-219175277 CTTTGGAAGACCAAGGTGGGTGG + Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947204725 2:227649940-227649962 CTTTGAAAGACCAAGGTGGGAGG + Intergenic
947798016 2:232906328-232906350 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
947798094 2:232906504-232906526 CCGTGTGGGAGGGAGGTGGGGGG + Intronic
948178686 2:235963073-235963095 GTCTCTTAGAGGAAGGTGGGTGG + Intronic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169316568 20:4595953-4595975 CTTTGTAAGGCCAAGGTGGGTGG - Intergenic
1169621130 20:7507735-7507757 CTTTGGAAGACCAAGGTGGGTGG + Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1169917446 20:10697681-10697703 CTTTGCAAGACCAAGGTGGGAGG - Intergenic
1170511274 20:17079554-17079576 CTGTGTATCAGGAAAGTTGGTGG + Intergenic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1170797818 20:19565047-19565069 CTTTGGAAGACTAAGGTGGGTGG - Intronic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172797512 20:37551404-37551426 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG + Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173289487 20:41701913-41701935 TTGTGTGAAAGGAAGGAGGGAGG + Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1174590647 20:51641969-51641991 CTTTATGAGAGGAAAGTGGGAGG + Intronic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1174988344 20:55481043-55481065 ATGTTTAAGAGGAAAGTAGGTGG - Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176411867 21:6453557-6453579 CGGGGTAGGAGGAAGGTGAGCGG + Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1177608999 21:23421658-23421680 CTTTGGGAGACGAAGGTGGGAGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179106860 21:38408806-38408828 ATGTGTAGGAGGAAGGGGAGGGG + Intronic
1179223291 21:39428855-39428877 CTTTGTGAGACCAAGGTGGGAGG - Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179665011 21:42905087-42905109 CTCTTTAAGATGAAGGTTGGGGG - Intronic
1179687361 21:43061879-43061901 CGGGGTAGGAGGAAGGTGAGCGG + Intronic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1180904894 22:19402860-19402882 CTTTGGAAGATGCAGGTGGGAGG + Intronic
1180930740 22:19589141-19589163 CTTTGGGAGACGAAGGTGGGAGG - Intergenic
1181273935 22:21676987-21677009 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1182106316 22:27692304-27692326 CCTTGTAAGAGGAAGGCAGGAGG + Intergenic
1182116595 22:27760104-27760126 CTTTGTGAGACCAAGGTGGGTGG + Intronic
1182366764 22:29784400-29784422 CTTTGAAAGACGGAGGTGGGTGG - Intergenic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1183598284 22:38825215-38825237 CTGGGCATGAGGAAGATGGGTGG + Intronic
1185276044 22:49950548-49950570 CTGTGTTATAGGGGGGTGGGGGG + Intergenic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950294253 3:11814717-11814739 CTTTGGAAGACCAAGGTGGGAGG + Intronic
950756025 3:15173392-15173414 CAGTGTAAGAGGAAGGTCTGGGG - Intergenic
950949136 3:16980278-16980300 CCGTCCAAGAGGGAGGTGGGGGG - Intronic
951969170 3:28423846-28423868 CTATTTGAGAGGAAGGAGGGTGG - Intronic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952225378 3:31370097-31370119 CTCTGTAAGAGGAATGTCAGTGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955974763 3:64469242-64469264 CTGGGAAAGAGGAAGATGGCAGG + Intergenic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
956849967 3:73219976-73219998 CTGGGTAAGAGGAAGGGCTGAGG + Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958727591 3:97924709-97924731 CCCTGTAAGAGGAAGGTAGGAGG - Intronic
959391939 3:105786047-105786069 CTGTGTGAGAGGATCGGGGGGGG + Intronic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960807565 3:121598757-121598779 CTGTGGGAGACCAAGGTGGGAGG - Intronic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962754115 3:138455390-138455412 CTGGGTGGGAGAAAGGTGGGAGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963362707 3:144296311-144296333 CTTTGTAGGACCAAGGTGGGTGG + Intergenic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
963666478 3:148194579-148194601 CTGTGAGAGAGGAAGCTGGTTGG + Intergenic
964665211 3:159164522-159164544 CTTTGTAAGGCCAAGGTGGGCGG + Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965246396 3:166276663-166276685 ATGAGTAAGAGGAAGGTAAGAGG + Intergenic
966219068 3:177532843-177532865 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
966729670 3:183140161-183140183 CTGTGTGAGACTGAGGTGGGTGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968720537 4:2199818-2199840 CTTTGGGAGAGCAAGGTGGGCGG - Intronic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
969305913 4:6326247-6326269 GTGTGTAAGAAGAAGCAGGGAGG + Intronic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971893803 4:32563159-32563181 CTTTATAAGAGGAAGGTAGTGGG - Intergenic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
972985614 4:44760788-44760810 CTTTGTAAAATGAAGGTGGCAGG + Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
973626405 4:52777049-52777071 CTTTGGGAGAGCAAGGTGGGAGG - Intergenic
974873933 4:67679164-67679186 CTTTATATGAGAAAGGTGGGAGG + Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
976403152 4:84630694-84630716 CTTTGGAAGACCAAGGTGGGAGG + Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
979153812 4:117356695-117356717 CTTTGTAAGGCCAAGGTGGGTGG + Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983090629 4:163497668-163497690 CCATGTAAGAGGAAGGCAGGAGG - Intronic
984533536 4:180945018-180945040 CTGTCCGGGAGGAAGGTGGGGGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987441476 5:17961988-17962010 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
987441586 5:17963339-17963361 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
988390783 5:30627138-30627160 ATGTGTAAGAGGAGTGTTGGGGG - Intergenic
988636338 5:32988640-32988662 CTGTCTACTAGGGAGGTGGGGGG - Intergenic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
990147018 5:52773505-52773527 CTGTGTGACAGGAAAATGGGTGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
992403612 5:76434340-76434362 CTCAGAAAGAGGAGGGTGGGAGG - Intronic
993331457 5:86605325-86605347 CTTTGTGAGACCAAGGTGGGTGG - Intergenic
993762104 5:91808151-91808173 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997400811 5:133600408-133600430 CTGTGTAGGATAAAGGGGGGGGG + Intronic
997662126 5:135597392-135597414 CAGTGTCAGAGGCAGGTCGGAGG - Intergenic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
998188702 5:140003415-140003437 CCTTGTAAGAGGGAGGTAGGAGG + Intronic
998823134 5:146074818-146074840 CTGTGCCAGAGAAAGGTTGGGGG - Intronic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000596420 5:163219748-163219770 CTGTGAAAGAGGAAGCTGCTGGG + Intergenic
1001566120 5:172700603-172700625 CTGTGGAGGAGTAAGGCGGGAGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1004305608 6:14499374-14499396 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1004735510 6:18402263-18402285 CTGTGTAAAATGAAGGTGCTAGG + Intronic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006240482 6:32673402-32673424 CTTTGAAAGACCAAGGTGGGCGG + Intergenic
1006437068 6:34031216-34031238 CGGGCTAAGAGGCAGGTGGGTGG - Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007197039 6:40071276-40071298 CTGAGTAAAAGGAAACTGGGGGG - Intergenic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007498983 6:42280990-42281012 CTTTGTATGTGGACGGTGGGAGG + Intronic
1007800409 6:44387681-44387703 CTGCGCAAGCGCAAGGTGGGAGG - Exonic
1007851285 6:44804907-44804929 CCCTGTAAGAGCAAGGTGTGAGG - Intergenic
1008055458 6:46941089-46941111 CTTTGGAAGATCAAGGTGGGAGG + Intronic
1008461894 6:51785139-51785161 CAATGAAAGAGGGAGGTGGGAGG + Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010726213 6:79336743-79336765 CTTTGGGAGATGAAGGTGGGAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013001468 6:106027059-106027081 TTGTGGAAGAATAAGGTGGGTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1014015937 6:116529876-116529898 GTGTGTAAGAGGAGTGTGTGCGG + Intronic
1014545307 6:122728462-122728484 CTTTGGGAGAGCAAGGTGGGTGG + Intergenic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015848633 6:137548995-137549017 CTTTGGGAGACGAAGGTGGGTGG - Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017385218 6:153875173-153875195 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017620065 6:156287397-156287419 CTGTGGGAGACCAAGGTGGGTGG + Intergenic
1017857064 6:158359149-158359171 CTAGGTAAGAGGAAGAGGGGAGG - Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021127889 7:16874871-16874893 CTTTGTGAGACCAAGGTGGGTGG + Intronic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021672198 7:23045929-23045951 CCGTCTGGGAGGAAGGTGGGGGG - Intergenic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1025262713 7:57430478-57430500 CTGTTTTTGAGGAAGGTAGGTGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026481104 7:70780320-70780342 CTGCCTAAGAGGATGGTAGGCGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028151599 7:87379868-87379890 CTTTGGGAGACGAAGGTGGGAGG + Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028763978 7:94529644-94529666 CTGAGTAATAGGAATGTGGCTGG + Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029365946 7:100116393-100116415 CTTTGGGAGACGAAGGTGGGCGG + Intronic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1029670487 7:102027139-102027161 CTTTGGGAGATGAAGGTGGGCGG + Intronic
1030804136 7:113893081-113893103 CTGTGTAAAAGAAAGGTAGTGGG - Intronic
1031209331 7:118802441-118802463 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1035406053 7:158598130-158598152 CTTTGTGAGACCAAGGTGGGAGG + Intergenic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038536634 8:28358351-28358373 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1041520925 8:58755539-58755561 CTTTGTAAGGCCAAGGTGGGAGG - Intergenic
1041536016 8:58926239-58926261 CTGGGTGAGAGGAAGATGGCTGG + Intronic
1042616006 8:70650089-70650111 CTTTGGGAGATGAAGGTGGGAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043251970 8:78086359-78086381 CTCTGTGGGAGAAAGGTGGGAGG - Intergenic
1043448146 8:80339610-80339632 CTTTGGAAGACAAAGGTGGGTGG - Intergenic
1043456016 8:80412798-80412820 CTTTGGAAGACCAAGGTGGGTGG - Intergenic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1045382923 8:101644752-101644774 CGGAGTAAGAGGAAAGTGTGTGG + Intronic
1045529907 8:102974624-102974646 CTTTGTAAGAGGCAGGCAGGAGG - Intronic
1045899742 8:107263108-107263130 CTTTGGGAGAGCAAGGTGGGCGG + Intronic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1047419359 8:124693650-124693672 GTGTGTAGGAGGAAGGCAGGTGG - Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047687284 8:127316463-127316485 CCGTCTGGGAGGAAGGTGGGGGG + Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048823640 8:138402021-138402043 GTGTGTGTGAGGAGGGTGGGAGG + Intronic
1048934008 8:139340347-139340369 CTGTGTAGGAGTAAGCTGGCTGG - Intergenic
1049083038 8:140457620-140457642 CTGTGTAAGTGCAAAGCGGGGGG - Intronic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049406966 8:142455896-142455918 CTCTGTGACAGGAGGGTGGGTGG + Intronic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050236322 9:3584785-3584807 CTTTGGAAGACCAAGGTGGGAGG + Intergenic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1050815708 9:9809027-9809049 CTCTGTGAGACTAAGGTGGGAGG - Intronic
1050822882 9:9904137-9904159 CTGTGTCAGACAAAGATGGGTGG + Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052161229 9:25262390-25262412 CCTTTTAAGAGGAAGGTGTGAGG + Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1052503731 9:29325966-29325988 CTGGATGAGAGGAAGGTTGGAGG - Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1053407532 9:37890458-37890480 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1053470965 9:38346020-38346042 CCGGGTAAGATGCAGGTGGGAGG - Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056647272 9:88424797-88424819 GTGTGTAAGAGCCAGGCGGGAGG + Intronic
1057059612 9:91991792-91991814 CTGCGGAAGAGGCGGGTGGGGGG - Intergenic
1057148656 9:92776523-92776545 CTTTGGAAGACCAAGGTGGGGGG - Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059216012 9:112562907-112562929 CTTTGGAAGACCAAGGTGGGAGG - Intronic
1059228568 9:112696133-112696155 CTTTGTGAGACTAAGGTGGGAGG - Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1060900561 9:127253814-127253836 CTGTTTAACAGGAAGAAGGGAGG + Intronic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061383953 9:130277156-130277178 CTGGGCAAGAGGAGGGTGTGGGG - Intergenic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1185992015 X:4901799-4901821 CTTTGGGAGATGAAGGTGGGTGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186179350 X:6957905-6957927 CTTTGGAAGACCAAGGTGGGTGG + Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187148232 X:16657131-16657153 CTTTGGGAGACGAAGGTGGGTGG - Intronic
1188024266 X:25192587-25192609 CTGGGTGTGAGGAATGTGGGTGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189220730 X:39369442-39369464 CTGTGCAAGAGGGAGGTGCCAGG - Intergenic
1189358693 X:40331367-40331389 CTGTTTAAGAAGAATGTGCGTGG - Intergenic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190379661 X:49827722-49827744 CTGTCTGAGAGGAAGGCTGGTGG + Intergenic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1193164568 X:78265527-78265549 CTGTCCGGGAGGAAGGTGGGGGG - Intergenic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194038512 X:88911230-88911252 CTGTGGGAGACCAAGGTGGGAGG + Intergenic
1194046638 X:89014376-89014398 CTTTGAAAGACCAAGGTGGGAGG - Intergenic
1195370965 X:104172156-104172178 CTTTGGAAGACCAAGGTGGGAGG + Intronic
1195575108 X:106440622-106440644 CTGTGTAGGAGGAATAGGGGAGG + Intergenic
1195683235 X:107564226-107564248 CAGTGTATGAAGGAGGTGGGAGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199599223 X:149531875-149531897 CTTTGAAAGAGAAGGGTGGGTGG - Intronic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic